
Widgetcon Website and a Program for Quick Conversion among Common Population Genetic Data Formats is a website and a program for converting a number of specified input files to a new desired output format. The common population genetic data formats are target for WidgetCon. The program interface is designed using HTML and CSS. PHP programming language is used for file reading, data processing and file writing operations. To post the data from client-side to server-side and server-supplied response to client-side are using Jquery (a JavaScript library). The program will also be served on Apache or NGINX servers so that thousands of users can quickly and easily convert file formats at the same time. The program interface is in English and consists of 4 steps


Responsive image

In the first step, three parameters are asked in a drop-down menu. Selections are mandatory to proceed to the next step.


Selection of the Input file format is done here and cannot be changed in the later steps. The selection is mandatory from the drop down menu (e.g. Fasta, Mega, Phylip)


Similar to the selection of the Input, the Output file format is done here as well and cannot be changed in the later steps. The selection is mandatory from the drop down menu (e.g. Fasta, Mega, Phylip)

Data type

The nature of the population genetic data is also selected here and similarly mandatory (e.g. DNA, Protein, RFLP, AFLP, Distance) After selecting the required fields, users can proceed to the second step by clicking on the "Confirm" button.


Responsive image

In the second step, the user is asked to upload the input file to the program. The maximum uploadable file size depends on the server's maximum file upload size. Users can select their files from their computers by clicking on the "Browse File" button, or they can upload the program with the drag and drop method. Only a single input file can be uploaded per operation. If a replacement of uploaded file is desired, the uploaded file must be deleted prior to the new upload. If the input format has a specific file extension (e.g. MEGA files have the extension ".txt", ".meg" or have to be ASCII text files), the program will only allow the upload of the affiliated file extensions. The program will give a warning in the case of disagreement between a file type and its extension. During file upload, the Confirm button becomes inactive. If the file upload is successfully completed, users can proceed to the third step by clicking on the "Confirm" button.


Responsive image

In the third step, a few more questions are asked based on the form of population genetic data and the input file format. Each question is detailed below. Some of the questions can be answered via selection from the drop-down menu while others have to be manually inserted.

Type of the data

This was already selected in the first step and present here as a guide. No need to alter. The program will allow any alterations at this step anyway.

The form of SSR alleles

If the selected data type is SSR than a query to further elaborate the nature of the SSR coding is requested. SSRs are coded in a number of ways. They could be 4 coded as repeat number of the base sequence, albeit less common. If this is your choice, you will be asked to also provide the base number of each of your SSR marker so that the program calculates the exact length of fragment by multiplying them with the repeat number. If the SSR loci are coded either as the PCR fragment length or as an arbitrary code the program will consider them as is and convert to the desired format.

Ploidi level

The ploidi level of data is an important parameter to understand the nature data file. If the data is coded in single column in each of the marker loci, the form of the data is haploid regardless of the true biological nature of the species of interest. If two columns per marker loci are present, then the data is coded as diploid. Therefore the question asked here is targeting data rather than the species.

Missing data is coded as

Genetics and population genetics programs and file formats require different missing data coding. Here you are expected to manually insert missing data value.

Is there a row of marker names?

Usually the marker names are the first row of data. However, occasionally the marker names omitted. If your data includes a row of marker names please select Yes, otherwise select No.

Are individual names present?

If your data files includes the names of individuals prior to marker information/distance information please select Yes, otherwise select No.

Is there a specific column of population information (e.g. PopData) present?

If the data file in hand includes population information in addition to the individual names please select Yes, otherwise select No. After filling or selecting all the required fields, users can proceed to the fourth step by clicking on the "Confirm" button.


Responsive image Responsive image

In the fourth step, the required information must be entered or selected to determine how to write the data in the requested output file (interleaved or non-interleaved). Depending on the file format, some fields are optional, while some fields are mandatory. After providing all the necessary information in this final step is the converting and downloading step. The "Start Converting" button will execute conversion process. Then the data is customized according to the demanded specifications of the desired output format and written to a new file. Finally, the download link for the generated output file will appear in the same page. The download link is added to the "DOWNLOAD" button. The user can click the "DOWNLOAD" button and download the output file to the personal computer. After the file conversion or download is finished, the "HOME” button should be used to navigate to the homepage to start a new query.

Example Data Sets


>gi|186681228|ref|YP_001864424.1| phycoerythrobilin:ferredoxin oxidoreductase


!Title human/chimp contig example;
!Format DataType=DNA indel=- CodeTable=Standard;

!Domain=Data property=Coding CodonStart=1;




5    42


	Dimensions NTax=4;
	TaxLabels fisf frog snake mouse;

	Dimensions NChar=20;
	Format DataType=DNA;

	Tree best=(fish, (frog, (snake, mouse)));



     Title="mtDNA sequences in the Senegalese Mandenka (hypervariable region 1)"

	 #Data from :
	 #Graven, L., Passarino, G., Semino, O., Boursot, P., Santachiara-Benerecetti, A. S., 
	 #Langaney, A., and Excoffier, L., 1995, Evolutionary correlation between 
	 #control region sequence and RFLP diversity pattern in the mitochondrial genome 
	 #of a Senegalese sample, Mol. Biol. Evol. 12(2):334-345




	   	#Reference: Graven et al. 1995 Mol. Biol. Evol. 12:334-345.
	   	SampleData= {
49   1     ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ATGCTTACAAGCAAGTACAGCAATCAACCTTCAACTATCACACATTAACTGCAACTCCAAAGCCA-CCCCTCACCCACTAGGATATCAACAAACCTACCTACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCTTTCTCGTCCCCATGGATGACCCCCC


		StructureName="New Edited Structure"




D12S1638 D14S1007 D9S1779 D9S1825 D7S2477 D17S784 D16S403 D3S1262 D10S189 D20S103 D8S261 D8S262 D8S560 D4S403 D5S408 D4S408 D16S3401 D18S1390 D8S503 D10S212 D1S235 D11S969 D3S1560 D20S851 D6S305 D15S165 D16S422 D3S1311 D1S2682 D15S128 D1S468 D3S3630 D2S2986 D9S1838 D13S285 D3S3644 D22S1169 D9S1871 D16S516 D4S3360 D6S2522 D18S843 NA-D10S-2 D3S2409 D6S1021 D9S910 D14S592 D11S1993 D5S2488 D10S1221 D10S1222 D3S2418 D6S1027 D5S1480 D18S858 D15S652 D10S1225 D1S1627 D12S2070 D4S2394 D13S779 D12S1042 D4S2397 D2S1352 D21S1440 D2S1353 D6S1031 D15S655 D12S1045 D10S1230 D1S3462 D14S599 D4S2361 D10S1412 D11S2362 NA-D11S-1 D3S4523 D22S1045 D16S748 D16S2616 NA-D1S-4 D17S2193 D18S1370 D1S3720 D1S1589 D2S1356 NA-D5S-1 D16S3396 D17S2195 D9S2157 D10S1208 NA-D13S-1 NA-D17S-1 NA-D1S-1 D18S1357 NA-D18S-2 D11S4459 D6S1006 D17S2180 NA-D8S-2 D17S1298 NA-D7S-1 D4S1625 D1S1728 D4S3243 D10S2470 D2S2952 D11S4463 D7S3046 D7S3047 D18S542 D5S1456 D22S683 D16S539 D13S1807 D21S1432 D6S2410 D4S1644 D2S1360 NA-D10S-1 NA-D1S-2 NA-D1S-5 D3S4529 D20S1143 D21S2052 D1S3721 D1S534 D11S2363 D2S427 D18S535 NA-D1S-3 D5S2845 D14S1426 D7S3051 NA-D16S-1 D7S817 D5S2849 D8S2324 NA-D8S-1 D15S1507 D6S2439 D3S4545 D6S2436 D14S1434 D2S2972 D18S1371 NA-D18S-1 D2S2968 NA-D6S-1 D18S1376 D17S2196 NA-D9S-1 D21S2055 D7S3070 NA-D14S-1 D15S1515 NA-D22S-1 D8S1128 D5S1457 D22S689 D9S922 D19S1034 D1S1594 D16S3253 D3S2427 D4S2366 D3S2387 D19S586 D13S787 D2S1363 D11S1998 D7S1799 D11S1999 D6S1040 D7S1818 D7S3056 D4S2367 D17S1299 D12S1052 D8S1132 D1S1596 D15S642 D9S925 D2S1328 D3S2432 D1S1597 D4S2368 D11S2000 D17S1301 D4S3248 D6S1959 D1S3669 D19S589 D20S477 D4S1647 D5S816 D14S606 D7S3058 D2S2944 D11S2002 D6S474 D7S2846 D14S1280 D6S1009 D7S1824 D12S2078 D3S1744 D5S817 D7S820 D3S1763 D5S1462 D8S1136 D7S1802 D20S478 D16S764 D4S2417 D1S1653 D7S1804 D14S608 D13S793 D19S591 D20S480 D11S2006 D20S481 D1S1660 D9S930 D11S1981 D17S1290 NA-D12S-1 D3S1764 D2S1334 D2S410 D2S434 D12S395 D12S372 D1S549 NA-D15S-1 D8S1108 D1S1609 D15S643 D13S796 D20S482 D2S1384 D5S1501 D9S2169 D15S659 D12S1064 D11S2365 D10S1239 D6S1053 D11S4464 D13S800 D9S934 D18S877 D2S1391 D19S714 D5S2500 D5S2501 D3S2460 D6S1056 D2S1394 D1S551 D8S592 D11S1392 D12S373 D18S851 D5S820 D3S1766 D3S2398 D21S1446 NA-D4S-1 D10S1423 D10S1425 D2S1776 D9S1118 D16S2621 D16S769 D4S2632 D2S1780 D1S2134 D3S3038 D7S2204 D10S1426 D15S816 D12S1294 D14S742 D1S518 D5S1470 D4S1627 D9S301 D18S1364 D3S3039 D8S1179 D13S317 D6S1277 D9S1120 D16S2624 D3S3045 D10S1430 D5S2505 D12S1300 D15S818 D2S1788 D13S894 D9S1121 D10S1432 D10S1435 D2S1790 D15S822 D9S1122 D5S1725 D4S1629 D20S201 D3S1768 D17S974 D3S1746 D2S441 D2S405 D8S1110 D11S2371 D12S1301 D14S587 D22S686 D11S1984 D4S2431 D8S1477 D2S1399 D2S1400 D14S617 D9S938 D13S895 D1S1677 D10S1248 D13S1493 D19S433 D10S677 D1S1612 D21S1437 D7S1808 D16S753 D14S588 D3S2403 D1S1679 D7S3061 D11S1986 D8S1113 D17S1294 D10S2327 D6S1017 D17S1308 D5S211 D19S246 D19S245 D19S254 D12S269 D7S559 D22S345 NA-D12S-2 F13A1-D6S TPO-D2S D20S159 D21S1411 D20S164 D11S1304 D20S451 D12S297 D6S942 D8S1048 D22S532 D8S373 D19S559 D4S1652 D7S821 D1S1665 D6S1051 D5S1505 D4S2623 
995 82 Karitiana Brazil AMERICA 120 128 -9 129 156 234 148 124 182 98 134 120 148 217 258 241 171 175 218 198 183 143 251 134 230 200 188 146 141 207 183 182 158 173 104 166 120 149 170 180 208 188 249 115 141 120 234 -9 271 195 221 111 117 236 208 -9 -9 116 95 238 192 127 144 113 163 156 263 237 91 132 266 110 155 157 121 165 228 155 205 133 196 107 143 136 -9 243 244 142 179 166 194 156 -9 247 135 -9 -9 200 119 156 254 201 202 162 166 259 185 127 342 180 196 207 -9 164 198 135 232 198 140 192 155 233 151 176 141 220 206 277 251 155 130 155 137 170 157 157 202 204 144 212 254 228 145 228 236 149 382 183 181 204 147 192 165 204 355 216 157 264 115 218 259 234 116 187 229 120 205 246 255 188 153 179 109 277 191 184 139 -9 153 147 109 212 199 154 146 179 320 223 155 249 198 187 181 252 140 245 274 215 120 240 163 188 293 241 171 274 147 264 224 -9 195 249 189 271 108 275 108 278 -9 261 -9 296 331 245 242 294 162 198 -9 233 298 174 278 239 178 189 286 260 196 215 168 163 153 100 287 182 193 246 180 -9 241 311 222 133 -9 252 169 330 163 253 166 178 158 212 216 268 202 224 286 223 174 226 172 304 173 251 262 142 324 289 203 -9 164 136 176 372 215 -9 197 237 184 300 170 183 302 303 140 176 168 293 119 158 195 196 184 173 272 328 266 202 188 149 246 202 213 256 135 249 290 -9 100 270 204 198 254 -9 -9 111 149 -9 163 204 -9 239 211 217 -9 143 252 -9 141 256 160 134 244 237 256 204 167 304 202 209 203 134 121 205 131 249 187 133 366 317 207 216 316 265 220 202 -9 201 188 146 254 227 231 259 225 
995 82 Karitiana Brazil AMERICA 120 128 -9 129 142 228 142 118 182 98 130 114 148 217 258 235 165 165 218 194 175 143 249 134 230 184 188 144 119 207 174 172 158 163 102 166 120 147 166 174 208 182 246 115 141 108 225 -9 271 195 221 111 117 236 199 -9 -9 113 95 238 192 121 141 113 163 156 263 234 91 126 257 107 155 157 109 156 228 152 190 133 193 104 140 133 -9 243 244 139 179 163 179 150 -9 238 135 -9 -9 197 119 156 254 197 198 158 162 251 181 127 322 168 190 203 -9 152 190 135 232 194 140 188 155 233 151 172 141 220 200 273 243 151 126 151 133 166 149 157 202 204 140 208 254 224 145 228 232 149 374 183 181 204 147 188 153 204 355 216 153 244 111 210 259 234 116 183 231 120 193 238 255 184 145 179 109 273 187 180 135 -9 149 135 109 208 191 142 146 171 312 219 155 249 190 187 173 240 140 233 274 215 116 236 159 184 289 241 171 270 143 260 216 -9 191 241 185 267 104 267 104 278 -9 253 -9 292 323 245 238 290 154 194 -9 229 290 164 274 239 174 181 262 260 180 211 164 155 149 98 287 178 189 242 180 -9 237 299 214 129 -9 244 153 330 159 249 166 178 150 204 216 264 198 216 282 223 170 226 168 304 169 235 258 142 312 285 203 -9 160 132 172 368 203 -9 185 221 168 300 170 179 294 299 140 176 160 269 119 154 195 192 184 173 260 296 266 198 188 141 246 190 213 252 135 249 282 -9 100 266 180 186 246 -9 -9 111 141 -9 159 200 -9 235 205 217 -9 119 252 -9 125 256 156 134 240 233 252 204 155 304 198 185 199 118 121 205 129 245 181 129 358 305 207 204 308 265 216 198 -9 201 184 146 246 227 227 251 205 
996 82 Karitiana Brazil AMERICA 128 128 124 137 156 234 142 124 182 98 130 120 148 217 258 235 171 171 218 198 189 145 251 134 230 200 188 146 119 207 183 172 158 173 106 166 132 147 170 180 212 188 249 115 153 108 234 242 271 195 221 96 117 236 208 294 -9 113 95 238 192 127 144 116 163 156 257 249 91 132 257 107 155 157 118 165 240 155 202 133 193 107 146 136 205 243 244 151 179 166 179 156 184 247 135 172 252 200 119 156 254 201 202 162 166 259 189 127 322 180 196 207 182 164 198 143 244 198 144 188 159 241 151 176 145 220 210 277 251 155 126 -9 137 170 149 157 202 -9 140 208 254 228 145 228 240 149 382 183 181 204 151 188 153 200 355 216 157 264 115 214 259 234 116 183 225 120 205 246 255 184 153 183 109 277 191 184 135 196 149 147 109 218 191 142 146 179 312 223 155 249 198 187 173 256 140 245 274 227 120 248 159 188 289 241 175 274 147 264 220 276 195 241 189 271 104 275 116 278 224 257 108 292 331 245 242 290 162 198 209 233 306 168 278 235 178 193 -9 260 192 215 160 163 153 100 287 178 193 250 180 309 237 303 222 133 129 244 169 330 163 257 166 178 158 204 220 268 202 224 278 223 174 226 172 304 173 235 266 142 324 289 203 229 164 136 184 376 215 197 205 237 184 300 170 183 302 303 140 176 168 293 131 158 195 196 184 173 272 296 270 202 200 149 246 202 213 256 139 249 282 205 116 270 204 202 246 163 169 115 165 405 167 204 249 239 213 217 172 143 252 268 141 256 164 134 240 237 260 220 155 304 202 221 203 146 121 205 131 245 187 133 374 301 211 204 316 265 220 206 181 201 188 142 258 227 239 259 225 
996 82 Karitiana Brazil AMERICA 120 128 124 129 142 234 142 112 182 98 130 114 148 217 258 233 163 165 218 194 187 143 249 134 230 184 188 144 119 199 183 172 158 163 98 166 132 147 166 180 208 182 246 115 141 105 225 242 271 195 221 96 117 236 205 288 -9 113 95 238 192 121 141 113 163 156 251 246 91 126 257 107 155 157 115 165 228 152 190 133 193 104 140 133 205 243 241 142 179 160 179 150 184 238 126 172 246 197 119 156 254 193 202 158 162 251 181 119 322 168 190 207 180 152 190 143 240 194 140 188 155 233 151 164 141 220 202 273 243 151 118 -9 133 166 149 157 202 -9 124 208 254 224 145 228 232 133 382 183 181 200 147 188 153 200 355 204 153 240 111 210 259 230 112 183 225 120 177 242 255 184 145 175 109 269 187 180 131 196 149 147 109 206 191 142 146 175 312 199 155 233 190 187 169 252 140 233 274 211 116 236 159 184 289 241 171 270 139 260 220 272 195 241 185 263 104 275 104 266 220 257 84 292 319 245 238 290 154 194 205 233 298 164 270 223 174 189 -9 260 184 215 152 159 149 98 283 174 193 242 180 301 237 299 222 129 129 240 153 330 163 249 162 178 154 204 216 260 198 220 270 223 170 226 168 304 169 235 262 142 312 285 203 225 160 128 180 372 203 189 197 221 172 300 170 179 294 299 140 176 160 269 123 158 191 192 184 169 260 296 266 202 188 149 246 190 213 256 135 249 282 201 100 266 180 186 242 163 137 111 149 405 159 200 249 235 205 217 172 135 252 268 125 256 156 126 200 233 256 204 155 304 198 185 199 134 107 205 129 245 181 133 366 293 207 180 312 265 216 198 173 201 184 142 254 227 231 251 205 
997 82 Karitiana Brazil AMERICA 128 128 146 135 142 228 144 124 182 98 130 120 148 217 258 233 173 165 218 198 187 143 251 134 230 200 200 144 119 207 183 176 158 173 106 166 120 173 172 180 208 191 249 115 141 120 234 242 274 210 221 111 117 236 205 294 193 116 95 256 192 127 144 113 169 150 263 249 91 132 257 110 155 157 112 165 240 158 190 133 187 104 143 136 205 228 244 151 188 166 179 150 190 247 141 193 246 200 119 156 246 201 202 158 170 267 181 123 330 180 190 207 184 156 198 135 232 198 144 192 159 241 151 176 141 224 206 273 247 155 122 155 133 170 153 157 206 208 124 212 254 232 145 228 -9 149 378 187 181 208 147 192 157 204 355 216 153 244 119 218 259 234 116 187 247 132 205 246 255 184 153 183 113 277 -9 180 135 196 149 147 117 208 191 158 146 171 312 219 155 249 190 187 169 252 152 245 274 215 120 240 -9 184 301 241 175 274 159 264 220 276 195 253 185 267 104 271 104 278 224 261 108 292 323 245 242 298 158 198 213 233 290 174 286 239 178 193 278 264 196 215 168 163 153 98 287 178 193 246 180 301 237 299 222 129 125 244 173 330 163 253 166 186 154 216 216 264 198 220 286 223 194 234 180 304 173 255 262 150 324 293 203 237 168 132 176 376 203 185 201 233 184 300 170 183 302 311 140 176 160 289 119 158 195 200 208 173 268 296 266 198 200 153 246 190 209 268 139 249 282 201 112 266 204 198 246 167 141 111 149 417 167 204 249 239 205 217 172 119 252 268 137 256 176 134 244 237 256 204 167 312 198 185 207 134 121 205 123 249 187 133 358 313 211 216 312 265 216 206 177 201 184 146 258 227 227 259 225 
997 82 Karitiana Brazil AMERICA 120 128 124 129 142 228 134 124 182 98 130 114 146 217 258 233 165 165 218 198 183 141 249 134 228 184 188 134 119 199 174 172 154 169 102 166 120 147 166 180 208 185 246 115 141 105 225 239 271 195 221 111 117 236 196 294 190 116 95 241 192 121 132 113 163 144 257 237 91 126 257 107 155 157 112 165 228 155 190 133 187 104 137 130 202 228 241 139 179 160 179 150 184 241 126 172 246 197 119 156 246 193 202 158 162 263 181 119 322 176 188 203 180 152 190 135 232 194 140 188 155 233 151 164 133 220 200 273 243 147 114 155 133 146 149 157 202 204 124 204 254 228 121 228 -9 145 374 183 173 204 147 188 153 200 355 216 153 240 119 210 259 234 116 183 229 120 181 246 255 180 149 179 113 277 -9 180 135 196 149 135 109 208 187 142 146 163 308 199 155 249 190 187 157 244 140 233 274 207 116 236 -9 180 293 241 171 274 147 260 220 276 191 241 181 267 104 271 104 266 212 257 108 292 323 237 238 290 158 194 209 233 282 164 274 223 178 177 262 260 192 215 152 159 145 98 283 178 189 242 180 301 237 299 210 117 125 244 153 322 163 249 162 170 150 208 216 260 198 220 286 209 174 226 168 304 157 239 262 142 320 285 203 225 164 128 176 368 203 185 193 209 168 300 170 179 302 307 140 176 152 269 119 154 159 192 196 169 264 296 266 198 188 149 246 190 193 256 135 249 282 197 100 254 180 194 236 163 137 111 149 405 163 200 249 235 205 217 168 119 252 268 125 256 172 126 200 237 256 204 167 304 198 185 203 126 111 205 123 245 183 117 350 297 203 204 312 265 212 206 173 201 184 146 254 227 227 251 209 
998 82 Karitiana Brazil AMERICA 120 128 146 135 142 234 142 124 182 98 130 120 148 217 258 235 169 165 218 198 191 145 247 134 230 200 188 144 119 207 183 180 158 173 104 166 120 -9 170 180 208 188 249 115 150 126 234 242 -9 195 221 111 117 236 208 294 193 -9 95 256 192 130 141 113 163 156 251 234 91 132 257 107 155 157 118 165 240 155 -9 136 193 104 137 136 205 243 244 151 179 166 200 150 190 247 135 193 246 197 119 156 254 201 202 166 170 259 189 127 322 180 196 203 180 164 206 143 244 206 144 192 155 237 155 176 141 224 206 273 247 155 126 155 133 170 161 157 202 204 144 204 254 228 141 228 232 141 378 183 181 208 147 192 165 204 371 212 157 260 115 -9 259 234 116 183 229 128 205 246 -9 -9 153 179 109 -9 191 180 131 196 149 147 117 212 191 154 130 171 308 199 155 241 198 187 169 244 140 245 282 215 120 240 167 188 301 249 171 274 147 260 220 276 199 257 181 267 104 271 116 278 212 257 108 296 323 245 242 298 158 202 213 233 290 164 278 239 178 193 278 260 192 219 156 163 153 98 291 182 193 246 184 301 241 303 222 129 129 244 169 330 163 257 170 178 154 212 216 264 202 224 278 213 194 230 180 308 165 251 262 158 324 293 203 241 164 136 176 376 215 189 201 233 172 300 182 183 302 311 140 176 160 293 119 158 195 192 212 173 268 300 270 198 -9 153 246 202 213 280 139 249 282 201 100 266 180 186 236 163 165 111 165 417 167 204 249 235 205 217 172 131 268 268 129 256 168 134 200 237 256 204 167 304 198 221 203 134 121 205 123 249 187 133 358 317 211 204 316 265 220 206 181 205 184 142 254 231 231 259 209 
998 82 Karitiana Brazil AMERICA 120 124 124 129 142 228 134 112 182 98 130 120 148 217 258 229 165 165 218 196 187 143 247 134 228 184 188 134 119 193 174 172 158 169 100 166 120 -9 166 180 208 185 246 115 141 105 234 239 -9 195 221 96 117 233 199 291 187 -9 95 241 192 121 132 113 157 150 251 234 91 126 257 107 155 157 106 156 228 155 -9 133 187 98 137 130 205 228 244 139 179 160 179 150 184 235 132 172 246 197 119 156 246 201 202 166 162 251 185 123 322 172 192 199 180 152 190 135 244 198 140 192 151 233 151 172 137 220 206 273 247 155 122 151 133 170 149 157 202 204 124 204 238 228 129 228 232 133 370 183 177 200 147 188 153 204 355 200 153 240 111 -9 259 234 116 183 229 120 177 242 -9 -9 145 175 109 -9 191 180 131 196 149 147 117 212 191 142 126 163 308 199 155 233 190 187 169 240 140 237 274 207 116 240 151 180 301 241 171 270 143 260 216 268 191 241 181 267 104 267 104 278 212 257 108 292 323 245 230 298 154 198 205 229 282 164 262 239 174 181 262 260 184 211 152 159 149 98 287 178 189 242 180 301 237 299 210 129 125 244 169 322 163 253 166 178 154 208 216 260 198 220 274 213 174 226 168 308 157 235 258 142 320 289 203 233 160 136 176 364 203 189 197 209 168 300 170 179 298 275 140 176 148 269 119 154 191 192 208 169 264 296 266 198 -9 149 238 202 209 256 135 249 282 197 100 254 180 182 236 163 141 111 165 405 163 200 249 235 203 217 172 119 252 260 125 256 164 134 196 233 256 204 155 304 198 221 203 134 119 205 123 245 187 133 350 317 207 180 316 245 216 198 177 201 184 138 246 223 227 251 205 
999 82 Karitiana Brazil AMERICA 120 128 146 129 156 228 144 124 182 98 134 120 148 227 260 235 165 165 218 198 187 143 249 134 230 200 200 138 119 205 183 172 158 -9 102 166 -9 149 172 -9 208 185 255 115 150 120 225 242 274 210 221 111 126 236 205 294 193 116 95 241 192 127 141 113 169 150 263 249 91 132 257 107 158 157 115 165 240 155 190 133 193 104 146 133 202 243 244 142 179 166 179 150 -9 247 135 172 246 200 119 156 246 201 202 178 162 267 185 127 322 180 196 203 184 156 198 143 232 198 140 188 155 241 151 172 137 224 210 273 247 155 126 155 133 170 153 -9 206 208 128 212 254 232 121 228 232 149 386 183 193 208 155 188 153 204 363 216 153 260 119 214 259 234 116 187 247 132 205 246 255 184 153 179 117 277 187 180 139 196 149 155 117 208 191 158 146 179 312 -9 155 249 190 187 173 252 152 245 274 215 120 248 167 188 301 257 171 274 159 264 224 276 195 253 185 267 108 271 -9 -9 224 257 108 292 323 237 242 290 174 202 213 237 290 174 286 239 178 193 282 264 192 215 152 159 149 98 287 178 189 250 184 301 237 303 214 129 129 244 169 322 163 257 166 170 154 208 216 264 198 224 286 209 174 238 180 304 157 255 262 150 324 285 203 -9 168 128 176 376 203 185 193 209 184 300 170 183 302 311 140 176 164 293 131 158 195 196 208 173 264 296 266 202 204 149 246 210 209 280 135 249 286 201 100 266 204 194 246 167 -9 111 165 405 167 204 249 235 213 217 -9 135 252 268 137 256 176 134 244 237 256 216 171 304 198 185 203 134 121 213 125 245 191 117 358 -9 211 204 312 265 216 210 177 205 184 146 258 231 -9 263 225 
999 82 Karitiana Brazil AMERICA 120 128 124 129 142 228 142 116 182 98 130 120 146 217 258 233 165 165 218 198 183 143 241 134 228 200 188 134 119 199 174 172 158 -9 102 166 -9 147 166 -9 208 185 246 115 141 120 225 239 274 195 221 96 117 233 205 294 190 113 95 238 192 121 132 113 163 144 263 246 91 126 257 107 155 157 112 165 228 155 190 133 187 104 143 130 202 228 244 139 179 160 179 150 -9 244 126 172 246 200 119 148 246 201 186 158 162 251 181 119 322 172 188 203 180 152 190 135 232 194 140 188 155 241 151 164 133 224 206 273 247 147 122 155 133 146 149 -9 202 204 124 208 242 228 121 228 228 133 374 183 173 204 147 184 153 192 355 216 153 244 119 210 259 230 116 183 225 132 197 242 255 184 153 175 113 277 187 176 135 196 149 147 117 206 191 142 146 171 308 -9 155 249 190 187 157 240 140 237 274 207 120 240 159 188 289 241 171 270 155 260 220 276 191 241 181 263 104 271 -9 -9 212 253 100 292 319 233 230 290 158 198 193 233 282 168 278 223 178 177 278 260 180 211 152 159 145 98 287 174 177 242 180 301 237 299 210 117 125 240 153 322 163 249 162 170 150 204 216 260 198 220 286 209 174 226 168 304 147 255 262 142 324 285 203 -9 164 128 176 376 203 185 189 209 168 292 170 183 302 307 140 176 152 289 119 154 195 192 184 169 264 296 262 198 200 149 246 190 193 268 135 249 282 201 100 254 180 194 236 167 -9 111 149 405 163 200 249 223 205 217 -9 119 252 268 137 256 160 134 200 233 248 204 167 304 198 185 203 126 107 205 123 245 183 117 350 -9 211 168 308 265 216 206 173 201 184 142 250 227 -9 259 225 
1000 82 Karitiana Brazil AMERICA 120 124 146 129 142 228 146 124 182 98 130 120 148 217 258 235 169 165 218 -9 183 145 247 134 230 184 188 144 141 -9 183 176 158 169 102 166 120 173 170 180 212 188 249 115 141 120 234 242 271 195 221 111 129 236 208 294 190 116 95 256 192 127 141 113 169 156 251 237 91 132 266 107 155 157 118 165 240 158 205 136 187 104 137 136 205 243 244 142 188 160 179 156 190 247 135 190 246 197 119 156 246 201 202 166 170 263 189 127 322 180 196 207 184 164 198 147 244 206 144 192 159 241 151 176 145 220 206 273 247 155 122 155 137 170 157 157 202 208 132 204 254 228 141 228 -9 149 378 187 193 208 147 192 153 204 371 216 157 260 115 218 263 234 116 187 231 128 193 246 255 180 153 183 109 277 -9 180 135 196 149 147 117 214 191 158 146 171 312 209 155 249 198 187 181 244 140 245 282 215 120 240 -9 188 301 241 171 274 147 264 220 276 191 257 185 267 108 275 104 278 212 257 -9 296 323 245 242 298 158 202 205 233 274 174 274 239 178 177 282 264 196 219 168 163 153 98 287 194 193 246 180 309 241 311 222 133 129 248 169 330 163 257 166 186 162 212 216 268 202 224 286 219 174 226 180 -9 165 239 270 150 324 293 207 241 164 140 176 372 203 189 197 209 184 300 182 183 302 307 140 176 160 293 119 158 191 192 212 173 268 300 270 194 204 153 246 202 213 276 135 -9 290 209 100 270 180 198 246 163 165 111 165 405 167 204 253 235 209 217 172 135 268 268 125 256 176 134 248 237 256 204 171 312 198 221 207 134 121 205 123 249 187 133 342 317 211 204 316 265 220 206 177 205 184 142 258 231 227 259 205 
1000 82 Karitiana Brazil AMERICA 120 124 124 129 142 228 142 112 182 98 130 114 148 217 258 229 165 165 218 -9 183 143 247 134 230 184 188 134 119 -9 174 176 158 163 100 166 120 147 166 180 212 185 249 115 141 108 225 239 271 195 221 111 117 233 205 294 187 116 95 238 192 121 132 113 157 150 251 237 91 132 266 107 155 157 106 156 228 155 190 133 187 104 137 133 205 243 241 139 179 160 179 150 184 238 126 172 246 197 119 156 246 201 202 158 162 251 185 123 322 176 196 199 180 152 190 143 232 198 140 192 155 237 151 176 141 220 206 273 243 151 114 151 133 146 149 157 202 204 124 204 246 228 129 224 -9 133 370 183 181 200 147 192 153 204 355 212 153 240 111 210 263 234 112 187 229 120 193 242 255 180 145 179 109 273 -9 180 131 196 149 135 117 208 191 154 130 163 308 199 155 249 190 183 173 240 140 237 274 215 116 236 -9 180 289 241 171 274 147 260 216 276 191 241 181 267 104 267 104 278 212 257 -9 292 323 245 230 290 154 198 193 229 274 164 262 223 174 177 278 260 184 211 156 159 145 98 283 186 189 242 180 305 237 299 210 129 125 244 169 322 163 253 166 178 154 208 216 264 198 216 274 213 174 226 172 -9 157 235 262 150 320 289 203 233 160 132 176 364 203 189 193 209 184 300 178 179 302 275 140 176 160 269 119 154 191 192 208 169 256 296 266 194 188 153 242 190 209 256 135 -9 282 201 100 266 180 186 236 163 153 111 165 405 163 200 249 235 203 217 172 131 252 264 125 256 168 134 196 233 256 204 167 304 198 185 203 134 107 205 123 245 181 117 342 313 207 180 316 265 216 206 173 201 180 138 258 231 227 251 205 
1001 82 Karitiana Brazil AMERICA 120 128 146 129 142 234 140 124 186 98 130 120 148 227 258 233 173 165 218 198 187 145 249 134 230 200 188 146 141 205 183 180 158 173 102 172 132 147 166 174 212 191 249 115 153 120 228 242 274 210 221 96 126 -9 208 306 190 116 95 253 195 127 141 116 163 156 257 249 91 132 266 110 155 157 115 165 228 152 202 133 193 107 137 136 202 -9 244 151 179 166 179 150 184 247 135 190 246 200 119 148 254 201 202 166 162 255 185 131 338 172 200 211 180 164 190 135 244 198 140 188 155 241 151 172 137 224 206 273 255 151 126 155 137 170 149 173 206 204 128 204 254 228 145 228 236 141 378 183 193 204 159 188 157 200 363 216 157 264 123 222 263 234 116 183 243 132 197 246 255 188 149 183 113 277 187 184 139 196 153 151 117 218 199 158 146 179 328 223 155 237 190 187 181 256 152 237 278 223 120 248 159 188 293 257 175 274 151 264 220 276 195 241 189 267 104 271 108 278 220 257 108 292 319 245 246 290 162 206 193 233 290 174 270 235 178 189 282 260 192 215 156 163 149 100 287 182 193 250 184 309 249 299 222 133 133 248 169 322 167 253 166 178 158 204 216 268 202 220 282 223 194 238 180 304 165 251 266 150 324 285 207 241 168 136 180 376 223 189 193 209 184 300 -9 183 302 275 144 176 160 293 131 158 195 192 212 173 272 296 270 202 200 153 254 210 209 284 139 249 286 201 100 270 204 194 246 167 169 111 165 405 167 200 249 223 205 217 172 143 260 268 137 264 168 134 240 229 260 216 155 312 202 221 203 146 121 205 129 245 187 117 358 309 211 180 312 265 220 210 181 205 184 146 254 231 231 263 205 
1001 82 Karitiana Brazil AMERICA 120 124 124 129 142 228 140 112 182 98 130 118 148 217 250 233 165 165 218 196 183 143 241 134 228 184 188 138 139 199 183 172 158 173 98 166 120 145 166 174 208 188 249 115 141 108 225 242 271 195 221 96 126 -9 208 291 190 113 95 241 192 127 132 113 163 150 251 234 91 126 257 107 155 157 112 165 228 152 190 133 187 104 137 133 202 -9 241 142 179 154 179 150 184 238 135 172 246 197 119 148 254 193 198 158 162 251 181 127 322 168 196 203 178 164 190 135 240 194 140 188 155 233 151 172 137 200 206 269 251 147 114 155 133 166 149 157 202 204 124 204 242 228 121 224 228 133 370 183 181 200 155 188 153 192 347 216 157 244 111 218 259 230 112 175 225 128 177 246 255 188 149 175 109 277 187 180 135 196 149 135 117 214 191 142 142 175 316 215 151 233 190 187 169 240 140 233 274 211 112 248 159 188 289 241 167 270 143 260 220 272 195 241 185 267 104 263 104 266 220 257 100 292 319 241 242 290 146 194 181 229 274 164 262 235 178 189 282 260 188 211 156 155 145 98 283 174 177 250 180 305 237 299 214 129 125 244 169 322 163 249 162 178 150 204 216 260 198 220 278 209 178 226 172 304 147 235 258 146 320 285 203 225 164 136 176 368 215 181 189 209 160 296 -9 179 302 275 140 176 148 269 119 150 191 192 208 169 268 292 262 194 188 149 242 202 209 268 135 249 278 197 100 266 204 194 246 163 165 111 141 405 159 200 246 223 203 205 152 143 252 264 129 256 160 126 240 229 248 204 151 312 202 185 203 126 107 203 123 245 181 117 342 297 211 168 308 209 216 206 173 201 180 142 254 223 227 259 205 
1003 82 Karitiana Brazil AMERICA 126 124 146 129 142 228 146 124 186 98 140 120 148 227 258 233 173 165 218 198 187 143 249 134 228 184 188 146 141 207 183 180 162 163 106 166 132 147 172 180 208 191 249 115 153 108 -9 242 274 210 221 111 126 236 208 306 190 116 95 253 192 121 141 116 163 159 263 249 91 132 266 110 155 157 115 165 228 152 199 133 193 107 146 136 205 243 247 151 179 166 179 153 184 247 135 172 246 200 119 156 254 201 202 166 174 255 185 127 358 176 196 207 180 164 202 143 240 202 144 196 155 241 151 172 141 220 206 273 251 155 130 155 137 170 157 169 202 204 128 204 254 228 121 228 236 141 378 183 193 208 147 192 153 204 351 216 -9 264 115 222 259 234 116 183 231 128 197 246 255 188 149 179 109 277 191 180 143 196 153 155 117 212 191 154 150 179 320 219 155 249 190 187 181 240 152 233 282 223 120 236 167 188 297 257 171 270 155 264 220 276 195 241 189 267 104 263 104 278 224 257 108 292 327 241 238 298 162 198 193 233 290 174 278 239 178 177 278 260 188 219 152 163 149 100 291 194 197 -9 184 309 237 303 210 129 129 244 169 322 159 257 170 178 158 212 220 268 198 224 278 223 198 238 180 304 157 235 258 158 320 289 203 241 168 140 176 376 203 197 197 229 168 300 182 195 302 303 -9 176 160 293 127 158 195 196 208 173 268 296 270 198 204 153 254 202 213 280 139 249 282 -9 100 274 204 198 246 175 173 115 165 417 163 204 249 239 211 217 -9 143 260 268 129 256 168 134 244 237 256 220 171 312 202 221 203 134 121 213 129 249 191 117 358 309 211 216 312 265 216 206 181 201 -9 150 254 227 -9 263 209 
1003 82 Karitiana Brazil AMERICA 120 124 144 129 142 228 140 112 180 98 130 118 148 217 258 229 163 165 218 196 187 141 241 134 228 184 188 138 119 201 174 172 158 163 102 166 120 145 166 174 208 182 249 115 150 105 -9 242 271 210 221 96 117 236 205 294 190 116 95 241 192 121 132 113 160 150 263 237 91 126 257 110 155 157 106 165 228 152 190 130 187 104 137 136 202 243 241 142 179 154 179 150 184 241 126 172 246 200 119 148 254 197 202 162 162 251 185 119 338 168 190 203 178 164 190 143 232 194 144 188 155 237 151 168 137 200 200 273 247 147 114 151 133 170 149 157 202 204 124 204 242 228 121 224 228 133 378 183 181 204 147 188 153 192 347 216 -9 264 111 218 259 234 116 175 225 120 177 242 255 184 145 175 109 273 187 176 139 196 149 135 117 210 191 142 126 175 316 209 155 245 190 187 165 240 152 233 266 207 120 236 155 176 289 241 167 270 143 260 216 268 191 241 181 251 104 263 104 278 220 253 100 292 327 237 230 290 146 198 185 229 286 164 274 223 174 173 278 260 184 215 152 163 145 98 287 182 193 -9 180 301 237 299 210 129 129 240 169 322 159 253 166 178 154 212 208 264 198 220 278 209 190 226 172 304 147 235 258 142 320 285 203 241 168 136 176 372 203 185 189 209 168 296 182 187 298 299 -9 176 148 289 119 158 195 196 184 169 264 292 266 198 200 153 242 202 209 252 135 249 274 -9 100 270 200 194 246 163 153 111 141 405 159 200 249 235 203 205 -9 143 252 260 125 256 160 134 200 229 256 216 151 312 198 185 203 126 107 203 123 249 183 117 354 297 203 180 312 265 216 206 173 201 -9 142 254 223 -9 259 205 
1004 82 Karitiana Brazil AMERICA 120 128 -9 129 156 234 146 116 -9 98 130 120 148 227 258 235 173 165 218 198 189 149 247 -9 230 200 188 146 119 205 183 182 162 171 102 166 132 149 172 180 208 188 -9 115 153 120 234 242 271 210 221 96 132 233 208 294 190 116 95 241 192 130 141 113 163 156 263 249 91 126 266 107 155 157 115 -9 228 155 -9 133 187 107 -9 136 205 243 244 142 188 160 -9 150 184 -9 135 172 249 197 119 156 254 201 202 178 162 255 185 127 342 180 196 207 182 164 190 143 232 202 152 196 155 241 151 172 137 224 206 309 251 151 118 155 137 178 165 173 206 204 124 208 254 -9 145 228 240 141 386 183 181 208 159 192 153 -9 -9 216 157 248 123 222 259 234 124 187 225 132 197 246 255 188 149 179 109 277 195 180 139 196 153 155 117 214 199 158 146 179 320 223 155 249 190 187 181 260 152 237 -9 215 120 236 167 188 293 257 171 274 159 264 220 276 195 249 185 267 108 271 104 278 224 261 100 292 327 245 246 290 162 194 185 233 290 168 278 239 178 189 278 268 180 215 156 163 149 100 287 182 193 250 184 301 237 303 214 133 133 248 173 322 163 257 166 178 158 212 216 268 202 224 286 223 190 238 180 308 169 255 270 142 324 289 207 241 168 128 180 376 219 189 201 237 184 300 178 183 302 307 140 176 168 293 131 158 199 192 208 177 272 296 270 202 204 149 246 202 209 280 139 249 -9 -9 100 274 204 194 236 175 -9 111 165 417 159 204 253 223 211 217 -9 143 260 -9 141 256 168 134 240 233 264 220 171 304 202 185 203 138 121 213 129 249 187 117 358 -9 211 216 308 265 220 210 181 205 188 146 254 231 239 263 205 
1004 82 Karitiana Brazil AMERICA 120 128 -9 129 142 228 142 112 -9 98 130 120 148 217 258 233 165 165 218 198 175 143 245 -9 228 200 188 144 119 199 183 174 158 163 102 166 120 145 172 174 208 185 -9 115 150 105 225 239 271 207 221 96 117 233 208 288 190 116 95 238 192 127 132 113 157 150 263 246 91 126 260 107 155 151 115 -9 228 152 -9 130 187 98 -9 130 202 243 241 139 179 154 -9 150 184 -9 135 172 246 197 119 148 246 197 186 166 162 251 181 127 338 172 196 203 180 164 190 135 232 194 140 188 151 233 151 172 133 220 200 273 247 147 114 155 137 170 157 157 202 204 124 208 254 -9 121 224 228 133 370 183 173 200 155 184 153 -9 -9 216 153 244 115 214 259 234 112 175 225 128 185 242 255 184 149 179 109 269 187 176 131 196 149 135 113 206 199 142 126 171 308 209 155 233 190 187 181 240 140 233 -9 215 112 236 159 180 289 241 167 270 147 264 216 276 191 241 181 263 104 271 104 258 224 257 100 292 327 241 242 286 150 194 181 233 282 164 270 235 178 177 262 264 180 211 156 155 149 98 283 182 189 246 180 301 237 299 214 129 129 240 169 322 159 253 162 170 150 204 216 260 198 220 270 209 174 226 172 304 147 235 262 142 320 285 203 241 160 128 180 372 203 181 189 209 160 296 170 183 298 299 140 176 164 293 119 158 195 192 184 169 268 296 266 202 200 149 246 190 209 256 135 249 -9 -9 100 266 180 182 236 163 -9 111 141 405 159 200 249 223 205 217 -9 135 256 -9 129 256 152 134 240 233 248 216 155 304 202 185 199 126 119 205 123 245 181 117 350 -9 211 180 308 245 216 198 173 201 188 138 246 231 231 259 205 
1005 82 Karitiana Brazil AMERICA 128 128 146 135 156 228 142 124 182 98 142 120 148 227 258 233 165 165 218 -9 187 143 249 134 230 200 200 144 119 207 174 176 158 177 102 166 130 173 172 180 208 191 246 115 150 105 -9 242 271 207 221 111 117 236 208 294 193 116 95 238 192 127 141 122 163 156 263 249 91 132 257 110 155 157 112 165 240 158 -9 133 193 104 143 133 205 246 247 151 188 166 200 156 184 247 135 193 246 197 119 156 254 201 202 162 170 267 185 127 322 180 200 207 184 164 190 135 244 198 144 188 155 241 159 172 133 220 206 273 247 151 126 155 133 170 153 157 206 204 144 204 254 232 129 228 240 149 378 183 181 204 147 192 153 204 355 216 157 244 119 214 259 234 124 187 247 132 193 246 255 184 153 183 113 273 191 180 135 200 149 147 117 214 191 158 146 179 328 219 155 249 190 187 169 260 152 245 274 215 120 240 167 188 301 249 171 274 159 268 220 276 195 241 185 267 104 271 104 278 224 261 108 300 323 245 246 -9 -9 198 209 233 274 164 274 239 178 189 278 264 196 215 172 159 153 106 287 182 193 246 180 309 241 303 222 133 129 244 173 330 163 257 166 178 154 208 216 268 198 224 286 209 198 234 168 308 169 255 262 154 324 289 203 241 168 136 176 -9 203 189 201 237 184 300 170 195 302 311 140 176 160 293 131 154 195 192 208 173 272 296 266 198 188 149 246 190 213 268 139 249 282 -9 112 270 180 194 246 167 165 115 165 417 167 204 253 231 205 217 176 131 252 268 129 256 172 134 248 237 256 204 167 312 198 221 203 134 111 205 129 249 187 117 342 297 -9 204 316 265 216 206 -9 201 184 146 254 227 239 259 205 
1005 82 Karitiana Brazil AMERICA 128 126 124 135 142 228 134 112 182 98 130 120 146 217 258 233 163 165 218 -9 187 141 247 134 230 184 190 144 119 199 174 176 158 173 102 166 120 147 166 180 208 185 246 115 141 105 -9 239 271 195 221 96 117 233 208 294 187 113 95 238 192 127 132 122 157 156 257 234 91 132 257 107 155 157 106 165 228 155 -9 133 187 98 137 130 205 246 241 139 188 166 179 156 184 238 135 172 246 197 119 156 246 201 202 158 162 251 185 119 322 176 188 203 180 156 190 135 232 198 140 184 151 237 151 164 133 220 200 273 247 147 122 151 133 170 149 157 202 204 128 204 254 228 121 228 232 145 374 183 181 204 147 188 153 200 355 200 157 240 119 210 259 234 116 183 231 120 181 238 255 180 153 179 109 273 187 180 135 196 149 135 109 208 191 154 146 171 312 209 155 233 190 187 157 248 140 237 274 207 120 236 159 180 293 241 171 274 139 268 216 276 191 241 181 263 104 271 104 262 212 253 100 296 323 233 242 -9 -9 194 209 233 274 164 274 223 178 177 262 260 184 215 156 159 149 98 283 178 185 242 180 301 237 303 222 117 125 244 153 322 163 249 162 178 150 208 216 260 198 220 270 209 194 226 168 308 157 235 258 154 320 285 203 225 168 128 176 -9 203 189 197 209 160 300 170 195 302 311 140 176 152 289 119 154 195 192 184 169 264 296 266 198 188 149 242 190 209 256 135 245 282 -9 112 254 180 182 246 159 165 111 165 405 163 204 253 231 205 217 172 119 252 268 125 256 168 126 244 233 252 204 155 304 198 185 203 134 107 203 123 245 181 117 342 297 -9 180 308 265 212 206 -9 201 184 142 246 227 227 251 205 
1006 82 Karitiana Brazil AMERICA 126 128 148 129 142 228 146 116 182 98 130 120 148 227 258 233 169 165 220 198 187 149 251 134 230 200 190 146 119 209 183 180 158 173 106 166 -9 147 172 180 212 191 249 115 150 126 234 242 274 210 221 111 132 239 208 294 190 116 95 256 192 121 144 122 163 156 257 237 91 132 260 110 155 157 106 165 228 155 205 133 193 110 146 133 205 246 241 151 188 166 179 156 184 247 141 193 246 197 122 156 254 201 210 162 170 263 189 127 322 180 200 203 182 164 190 143 244 198 140 196 155 241 159 176 145 228 210 277 247 147 126 155 137 178 149 157 206 204 144 212 254 232 145 228 -9 133 382 187 181 204 147 188 161 204 355 216 157 240 119 214 259 234 116 187 229 132 185 246 255 184 149 183 109 273 -9 188 139 200 149 155 117 214 199 154 146 179 328 219 155 249 190 187 177 260 152 245 274 215 116 240 -9 188 301 241 171 274 151 264 220 276 191 249 185 267 108 271 104 278 220 261 108 300 323 245 246 290 162 -9 209 233 278 176 274 239 186 189 282 264 196 211 168 155 153 98 291 194 193 242 184 309 241 303 222 133 129 244 169 330 163 257 174 178 158 212 216 268 218 224 282 227 198 238 180 308 173 235 262 158 324 289 203 261 168 140 180 376 203 189 201 233 172 300 170 195 302 311 144 176 164 293 127 158 195 200 208 173 268 296 270 202 188 153 246 202 209 256 139 249 282 201 100 270 180 198 246 167 165 111 165 405 163 204 253 239 213 217 172 135 252 268 -9 264 168 134 244 237 256 220 167 304 202 221 203 134 121 205 129 249 187 129 346 -9 207 180 316 265 220 210 177 201 184 146 258 227 239 251 225 
1006 82 Karitiana Brazil AMERICA 122 126 124 129 142 228 142 112 182 98 130 114 148 217 258 229 165 165 218 198 183 149 247 134 228 184 188 134 119 207 183 176 154 169 104 166 -9 145 166 180 208 185 246 115 141 105 225 239 271 210 221 96 117 236 196 294 187 113 95 238 192 121 141 122 157 150 251 234 79 126 257 107 155 157 106 165 228 149 190 133 187 104 143 133 205 243 241 139 176 160 179 150 184 238 135 190 246 197 119 140 246 197 202 158 162 259 185 119 322 176 194 203 180 164 190 143 244 194 140 188 151 241 151 164 137 220 200 273 243 147 122 155 133 170 149 157 202 204 128 204 250 228 121 228 -9 133 374 183 181 204 147 188 153 204 355 200 153 240 115 214 259 234 116 183 231 120 181 238 251 180 145 179 109 273 -9 180 131 200 149 147 109 212 187 142 130 171 308 199 151 233 190 179 165 240 140 245 274 215 116 236 -9 180 297 241 171 270 139 264 216 276 187 241 185 251 108 267 104 262 212 253 108 292 319 237 242 286 158 -9 205 233 274 164 274 235 174 177 278 260 180 211 156 155 153 98 287 186 185 242 180 301 237 303 222 129 125 244 165 330 163 249 162 178 154 208 216 260 198 220 278 209 194 238 172 304 173 235 258 142 320 289 203 241 168 136 176 364 203 185 185 233 160 300 170 179 298 299 140 176 160 269 119 154 183 192 196 169 264 296 266 198 188 149 246 190 193 256 135 249 278 197 100 266 180 182 236 163 137 111 165 405 163 200 249 231 205 213 168 131 252 264 -9 256 168 130 196 237 252 204 155 304 198 221 199 126 107 205 129 245 187 117 342 -9 203 180 308 245 220 206 173 201 180 142 246 227 235 251 205 
1007 82 Karitiana Brazil AMERICA 120 128 146 133 156 228 146 116 186 98 134 120 148 227 258 235 173 165 218 198 189 143 245 134 228 200 188 146 139 205 183 182 162 173 102 166 -9 149 172 180 208 185 249 115 153 120 234 242 274 210 221 111 126 236 208 294 190 116 95 238 192 130 141 122 -9 150 263 249 91 126 260 107 158 157 115 165 228 155 190 133 193 104 146 136 205 243 244 142 179 160 179 150 190 244 135 172 246 200 119 156 254 201 202 178 162 255 185 127 342 -9 196 203 184 164 190 143 232 198 140 196 155 241 151 172 141 224 210 277 251 155 126 155 133 178 165 161 202 204 128 208 254 228 141 228 240 141 386 183 193 208 155 192 153 192 -9 216 157 260 123 214 259 234 124 183 225 132 197 246 255 188 153 179 117 -9 191 180 139 196 153 155 117 210 199 158 150 179 312 209 155 249 190 187 181 240 152 237 -9 223 120 248 167 188 293 257 171 274 155 264 224 276 195 249 185 267 108 271 104 278 224 261 108 296 327 245 238 290 174 206 213 237 290 168 278 235 178 189 282 264 180 215 -9 163 149 100 287 194 193 250 184 301 237 303 214 129 133 244 173 322 163 257 166 178 150 212 -9 260 -9 224 286 209 190 238 180 308 147 255 270 142 324 289 203 261 168 136 176 -9 203 185 201 233 184 296 186 183 -9 311 140 176 164 293 131 158 195 196 184 177 272 296 266 202 204 149 246 210 209 280 135 249 286 201 100 274 204 194 -9 175 165 111 165 417 167 204 249 235 213 217 -9 135 256 268 137 256 168 134 200 233 252 220 171 304 198 185 203 134 119 213 129 245 191 117 358 -9 -9 204 316 265 220 210 173 205 184 142 254 231 231 263 225 
1007 82 Karitiana Brazil AMERICA 120 124 146 129 142 228 142 116 182 98 130 114 148 217 258 235 165 165 218 194 187 143 241 134 228 184 188 138 119 199 183 172 158 171 102 166 -9 145 172 174 208 182 249 115 150 105 225 242 271 207 221 96 117 233 205 288 190 113 95 238 192 127 132 113 -9 144 263 246 91 126 257 107 155 151 112 165 228 155 190 130 187 104 137 133 202 243 244 142 179 160 179 150 184 241 135 172 246 197 119 148 246 197 186 162 162 251 181 119 322 -9 190 199 182 152 190 135 232 194 140 188 151 233 151 172 137 220 200 273 247 147 118 155 133 170 149 157 202 204 124 208 242 224 121 228 228 133 370 183 173 200 147 184 153 192 -9 204 153 244 120 214 259 230 116 175 225 128 185 242 255 184 145 175 113 -9 187 176 131 196 149 151 117 206 191 142 146 175 308 199 155 233 190 187 173 240 140 233 -9 215 112 236 159 180 289 241 167 270 147 264 220 276 191 241 181 263 104 267 104 258 224 253 100 292 319 233 230 286 146 198 193 233 290 164 270 239 178 177 282 260 180 211 -9 159 149 98 283 174 177 250 180 301 237 299 214 129 129 240 169 322 159 253 166 170 146 204 -9 260 -9 216 286 209 174 238 172 304 143 235 262 142 320 285 203 257 168 128 176 -9 203 181 189 209 160 292 170 183 -9 303 136 176 164 273 119 158 191 192 184 169 264 296 262 198 200 149 246 202 209 256 135 249 282 201 100 266 180 194 -9 167 137 111 161 405 159 200 249 223 203 217 -9 119 252 264 129 256 160 134 200 233 248 216 155 304 198 185 203 126 107 213 125 245 187 117 358 -9 -9 168 308 245 216 210 173 201 184 142 250 223 231 259 205
1008 82 Karitiana Brazil AMERICA 120 128 -9 135 142 234 146 116 182 98 130 120 148 217 258 235 169 165 218 -9 187 145 245 134 230 200 200 144 119 207 183 180 158 -9 106 166 132 173 172 -9 212 188 249 115 150 126 234 242 274 195 221 96 117 239 208 294 -9 -9 95 256 192 130 144 113 163 156 257 237 91 132 266 110 155 157 118 165 240 155 -9 136 193 107 143 136 205 243 244 151 179 166 200 150 190 241 135 193 249 197 119 156 254 201 202 162 170 267 189 127 342 180 192 199 182 156 198 143 244 206 144 -9 155 237 159 176 141 224 206 273 247 151 126 155 133 166 149 157 206 208 144 212 254 -9 141 228 232 141 378 183 181 208 -9 192 165 204 363 216 153 260 119 222 259 234 116 187 231 132 205 242 -9 184 153 183 109 273 195 180 135 196 149 155 117 218 191 158 146 179 308 219 155 249 198 187 173 252 140 245 274 215 120 240 167 188 297 249 171 274 147 268 220 276 199 257 185 267 108 -9 116 278 224 257 108 300 323 245 242 298 158 202 209 233 290 164 278 239 178 181 278 260 184 219 164 163 153 98 291 178 193 246 180 309 241 311 222 133 129 248 173 330 163 257 166 178 154 212 216 268 218 224 282 213 174 230 180 308 173 255 270 150 324 289 203 241 164 136 184 -9 215 189 201 237 172 300 178 183 302 311 -9 176 160 293 127 158 195 192 208 173 268 328 266 202 -9 153 242 202 209 276 135 -9 282 -9 100 270 204 186 236 163 165 115 165 417 167 204 249 235 203 217 184 131 252 -9 -9 256 168 134 228 237 256 204 167 312 198 185 207 134 121 205 123 249 187 133 358 -9 211 204 316 265 220 206 181 201 184 142 258 227 -9 259 205 
1008 82 Karitiana Brazil AMERICA 120 128 -9 129 142 234 142 112 182 98 130 120 148 217 258 229 165 165 218 -9 175 143 249 134 228 184 188 134 119 199 183 176 158 -9 102 166 120 145 170 -9 208 185 246 115 141 105 225 239 271 195 221 96 117 236 205 294 -9 -9 95 238 192 121 132 113 157 150 251 234 91 126 257 107 155 157 106 156 228 155 -9 133 193 98 137 130 205 243 244 142 179 160 179 150 190 235 132 172 246 197 119 156 246 193 186 158 162 263 181 123 330 176 190 195 178 152 190 135 244 194 144 -9 155 233 151 172 137 220 206 273 247 147 126 155 133 146 149 157 202 204 124 204 238 -9 129 228 232 133 374 183 177 204 -9 188 153 204 355 204 153 240 119 214 259 234 116 183 225 120 177 238 -9 184 145 179 109 273 195 180 131 196 149 147 109 212 191 142 146 171 308 199 155 249 190 187 169 244 140 245 274 207 116 240 159 180 289 241 171 270 147 264 216 276 191 241 185 267 104 -9 104 262 220 257 100 296 323 245 230 290 154 198 205 229 282 164 278 239 174 177 278 260 180 215 152 159 145 98 283 178 185 242 180 297 241 299 210 129 125 244 165 322 163 253 166 178 154 208 216 260 198 216 270 209 174 226 168 304 169 235 266 142 320 285 203 237 160 132 176 -9 203 185 193 233 168 300 170 179 302 275 -9 176 160 289 119 158 191 192 196 169 264 296 262 198 -9 153 238 190 205 256 135 -9 282 -9 100 266 180 182 236 163 141 111 149 405 159 200 249 235 203 217 168 119 252 -9 -9 256 164 134 196 233 256 204 155 304 198 185 199 126 119 205 123 249 187 133 350 -9 203 180 312 245 216 198 173 201 180 142 258 227 -9 251 205 
1009 82 Karitiana Brazil AMERICA 126 128 124 131 156 234 150 124 182 98 142 120 148 227 262 233 165 165 218 -9 193 143 243 -9 226 202 188 136 141 207 174 176 158 175 110 172 132 171 172 180 212 188 255 115 156 120 234 242 274 210 -9 111 126 233 205 -9 190 113 95 241 198 127 132 116 166 150 260 246 91 135 263 110 155 157 112 156 228 152 190 133 193 104 134 133 205 252 244 145 182 160 194 156 181 247 135 -9 246 200 119 156 254 205 206 166 170 259 185 127 338 176 198 203 180 152 202 143 244 198 156 188 155 241 155 180 141 224 206 269 255 151 126 151 137 170 161 173 210 208 124 208 250 232 121 228 236 133 374 183 181 204 147 188 157 200 355 212 157 264 119 214 263 238 116 183 231 128 181 242 259 180 153 179 109 269 195 180 135 200 157 -9 113 214 191 146 150 171 312 219 155 249 190 187 169 256 144 245 274 223 116 244 151 180 293 241 175 278 151 268 220 276 191 253 185 271 108 271 104 278 220 253 100 300 323 241 242 302 166 186 209 233 286 172 282 239 186 185 290 264 192 207 156 151 149 106 287 198 193 250 180 305 237 307 -9 133 125 248 169 334 163 257 170 178 158 212 212 264 202 228 282 223 194 226 180 304 169 239 -9 150 320 289 203 265 168 136 180 -9 215 201 197 225 160 300 178 187 302 303 140 176 164 265 131 158 199 200 216 177 268 296 294 202 188 153 258 202 213 252 135 249 282 197 100 274 200 198 246 175 137 111 141 417 167 204 249 231 205 217 172 131 264 268 133 264 148 134 244 241 260 204 151 304 206 185 207 134 119 207 129 253 181 129 -9 -9 -9 212 324 265 216 206 177 -9 184 146 254 227 239 263 221 
1009 82 Karitiana Brazil AMERICA 126 122 124 129 156 234 142 124 180 96 142 114 148 217 258 233 147 165 218 -9 193 143 249 -9 204 184 188 134 119 201 174 176 158 171 102 166 120 145 170 174 208 182 249 115 141 120 234 239 268 210 -9 111 126 230 196 -9 187 113 95 238 198 121 132 116 166 144 239 237 88 132 263 107 155 157 106 156 228 152 190 127 193 98 134 133 205 243 241 139 179 160 194 150 181 247 126 -9 246 200 119 156 246 201 198 158 170 259 181 127 326 176 194 203 178 152 190 139 240 194 144 184 155 237 155 172 141 204 202 269 251 147 122 151 133 166 149 157 202 204 124 204 246 232 121 228 236 133 370 183 181 200 147 188 157 196 351 212 153 240 119 214 259 238 116 183 225 120 181 234 259 180 153 179 109 269 191 176 135 196 153 -9 105 212 191 146 146 171 312 199 155 233 190 187 169 244 140 237 274 207 112 236 151 180 289 241 171 274 143 264 212 276 187 253 181 239 108 267 104 262 212 253 84 292 323 233 230 290 154 186 189 233 286 172 270 239 182 177 278 260 184 207 152 151 145 106 287 182 193 250 180 305 237 303 -9 129 125 236 153 322 151 253 162 178 154 212 212 264 198 220 274 223 194 226 172 304 143 239 -9 138 320 285 199 229 168 132 180 -9 211 197 189 209 160 296 178 187 298 275 140 176 148 265 119 154 199 192 216 169 264 296 258 202 188 149 242 194 205 252 135 249 282 197 100 270 200 182 246 163 137 111 141 405 167 204 249 227 203 213 164 127 252 264 121 264 148 134 204 229 252 204 151 304 198 185 203 126 107 207 125 249 181 117 -9 -9 -9 204 312 265 216 206 173 -9 184 146 250 227 227 263 205 
1010 82 Karitiana Brazil AMERICA 128 128 146 129 142 228 146 124 182 98 130 120 148 227 258 233 173 175 220 198 187 149 249 134 230 184 200 146 141 209 174 180 162 169 106 166 120 149 172 182 208 188 255 115 153 126 234 242 274 210 221 111 132 236 205 291 190 -9 95 256 192 127 144 113 163 150 263 237 91 132 266 110 158 157 112 165 240 158 205 133 193 110 146 136 205 243 247 151 179 166 179 156 190 247 135 196 246 197 119 156 246 201 206 162 170 267 185 127 358 176 196 207 184 164 202 143 244 202 144 192 155 233 159 176 145 228 210 277 251 155 130 159 137 170 149 169 210 208 132 204 254 228 141 228 240 141 378 183 181 204 147 188 153 204 371 216 157 264 115 218 259 238 120 183 231 132 205 242 255 188 153 179 117 273 195 180 135 196 149 155 117 218 199 154 154 179 320 199 155 249 190 187 169 240 140 237 282 223 120 240 167 180 289 241 171 274 147 264 220 276 199 249 185 267 104 267 116 278 224 261 100 296 327 245 242 290 170 198 209 233 278 176 278 239 186 193 278 264 192 219 156 159 153 98 287 194 193 250 184 309 237 307 222 133 129 248 169 330 163 257 174 178 154 212 216 264 202 220 286 227 198 -9 180 304 173 255 266 146 324 289 203 241 168 136 184 376 215 189 197 233 172 300 182 179 298 299 144 176 160 293 119 158 195 196 208 173 272 296 266 202 188 153 246 202 217 256 135 249 282 209 100 266 204 198 246 175 153 111 165 405 163 200 249 239 211 217 -9 143 252 268 -9 256 168 134 200 237 256 204 167 308 202 221 203 134 121 213 129 249 187 133 346 -9 203 216 316 265 220 210 177 205 184 150 254 231 239 271 209 
1010 82 Karitiana Brazil AMERICA 126 124 124 129 142 228 140 124 182 98 130 114 148 217 258 229 161 171 218 198 183 143 245 134 228 184 188 144 119 207 174 176 154 159 104 166 120 147 172 174 208 182 249 115 150 108 225 239 271 198 221 96 117 236 199 291 190 -9 95 241 192 121 132 113 160 150 251 234 91 126 257 107 155 157 106 165 228 152 190 130 187 104 137 136 205 243 241 142 179 160 179 150 184 241 126 172 246 197 119 156 246 197 202 158 162 255 185 119 342 176 190 203 178 156 202 135 244 198 140 188 151 233 151 172 141 220 200 273 247 155 122 155 137 146 149 157 198 204 128 204 250 228 121 224 228 133 370 183 173 200 147 184 153 204 355 204 157 240 111 218 259 234 116 183 229 120 177 238 255 184 153 179 109 269 191 176 135 196 145 147 109 212 191 142 126 171 312 199 151 249 190 183 165 240 140 233 274 223 120 236 159 176 289 241 171 274 143 264 216 268 195 241 181 251 104 263 104 278 224 253 100 292 319 237 238 286 166 190 193 229 274 164 274 239 178 189 278 260 180 211 156 155 145 98 287 194 181 242 180 301 237 303 210 129 129 240 169 330 163 253 166 178 154 204 216 260 198 216 266 223 194 -9 180 304 157 235 258 142 316 289 203 241 160 136 176 372 203 185 197 209 168 300 170 179 298 299 140 176 160 289 119 154 191 192 208 173 256 296 266 198 188 149 242 198 205 252 135 249 278 201 100 254 180 194 246 167 137 111 165 405 159 200 249 231 203 217 -9 119 252 268 -9 256 164 134 200 233 252 204 155 304 198 221 199 126 107 205 123 249 183 117 342 -9 203 180 312 265 216 206 173 201 180 146 246 227 235 263 205 
1011 82 Karitiana Brazil AMERICA 120 128 142 135 142 234 146 116 182 98 130 120 148 217 258 235 165 165 218 198 187 145 245 134 230 -9 200 144 119 199 183 180 158 171 106 166 120 147 170 180 212 188 249 115 150 126 225 242 274 198 221 96 117 239 205 294 190 116 95 256 192 130 141 113 163 156 251 246 94 132 266 107 155 157 118 165 240 155 190 133 193 104 143 136 205 243 244 151 179 160 179 150 190 241 132 172 249 197 119 156 254 201 198 158 170 263 189 127 334 180 190 207 182 156 198 143 244 194 144 192 159 237 155 172 141 224 206 -9 247 151 126 155 137 166 153 157 202 204 144 208 254 232 145 228 240 141 378 183 181 208 147 188 165 204 363 216 157 240 119 214 263 234 116 187 243 132 205 246 255 184 153 183 117 273 195 184 135 196 149 147 117 212 191 158 146 171 328 219 155 249 190 187 173 252 140 245 274 215 120 240 167 188 289 249 171 274 147 268 220 276 195 257 185 267 108 275 116 278 224 261 100 296 327 245 242 298 170 206 213 233 290 164 278 239 178 181 278 260 192 219 152 163 153 100 291 182 193 250 180 301 241 311 222 129 129 244 173 330 163 257 166 186 154 212 216 264 218 224 286 213 174 -9 180 -9 169 255 270 150 324 289 207 237 164 136 184 -9 215 189 201 237 168 300 170 183 -9 307 140 176 160 293 131 158 195 192 208 173 272 328 266 202 204 153 246 202 205 256 135 -9 282 -9 100 266 180 202 236 163 165 111 -9 417 167 200 249 235 205 217 -9 131 252 -9 137 256 164 134 228 237 256 216 155 312 198 221 207 134 121 205 123 249 187 133 358 317 203 204 316 265 220 206 181 201 184 146 258 227 239 259 205 
1011 82 Karitiana Brazil AMERICA 120 128 124 129 142 234 134 112 182 98 130 120 148 217 258 233 163 165 218 196 183 143 249 134 230 -9 188 134 119 199 174 176 154 169 106 166 120 145 166 174 212 185 246 115 141 108 225 242 271 195 221 96 117 236 205 288 190 113 95 241 192 121 132 113 157 156 251 234 91 132 266 107 155 157 115 156 228 149 190 133 187 98 137 130 205 243 244 142 179 160 179 150 184 235 126 172 246 197 119 156 246 201 186 158 162 259 185 119 330 172 188 195 182 152 190 135 244 194 144 188 155 233 151 168 137 220 206 -9 247 147 114 155 133 146 149 157 202 204 124 204 254 228 129 224 232 141 374 183 177 204 147 188 153 204 355 216 153 240 119 214 259 234 116 183 231 120 177 242 255 184 153 179 109 273 191 180 131 196 149 147 109 208 191 158 126 171 308 199 151 233 190 183 169 252 140 233 274 207 120 240 167 180 289 249 171 270 147 264 220 276 191 241 185 251 104 271 104 278 224 257 100 296 323 237 230 290 154 202 205 233 290 164 262 223 174 177 278 260 184 215 152 159 145 98 291 178 185 246 180 297 237 299 210 117 125 244 165 322 163 257 166 178 154 212 216 260 198 216 282 209 174 -9 168 -9 165 239 262 142 320 289 203 237 160 132 180 -9 203 185 193 209 168 300 170 179 -9 275 140 176 148 289 127 158 191 192 208 169 268 296 266 194 200 149 238 202 193 256 135 -9 282 -9 100 266 180 186 246 163 165 111 -9 405 167 200 249 235 203 217 -9 119 252 -9 137 256 160 134 200 233 252 204 155 304 198 185 203 134 119 205 123 249 187 133 358 317 203 180 316 245 216 198 173 201 180 142 258 227 227 259 205 
1012 82 Karitiana Brazil AMERICA 120 128 142 129 156 228 146 124 182 98 130 120 148 227 258 233 173 165 218 198 -9 143 247 134 230 200 188 146 119 207 183 176 162 173 102 166 132 149 172 174 212 191 -9 115 159 108 234 242 271 207 239 96 117 236 208 294 190 116 95 241 192 130 141 113 163 156 263 249 91 132 266 110 155 157 115 165 228 152 202 133 193 104 146 136 205 243 244 142 188 160 179 150 190 241 135 172 249 197 119 156 246 197 202 166 170 255 185 127 338 180 196 207 180 164 202 143 240 202 152 196 155 241 151 176 145 220 210 309 251 151 126 155 137 178 165 157 206 204 136 208 254 228 145 228 232 149 378 183 181 208 159 188 153 204 355 216 157 248 119 222 263 234 116 183 -9 132 205 246 255 188 153 183 113 273 187 -9 139 196 157 155 113 218 199 142 146 179 320 223 155 249 190 187 181 240 140 245 274 215 120 236 159 188 289 241 171 274 159 264 220 280 191 253 185 267 104 271 116 278 224 257 108 292 327 245 246 290 150 206 209 233 298 168 278 239 178 193 278 264 184 215 -9 163 153 98 287 182 193 250 184 305 237 307 214 133 129 248 173 330 163 253 166 178 162 204 216 268 210 224 278 223 198 226 180 304 169 235 270 142 324 289 207 241 164 136 180 376 219 189 201 237 184 300 178 183 302 299 140 176 168 293 131 158 199 192 212 177 272 328 270 202 204 149 246 202 209 280 139 253 282 -9 100 270 204 194 246 175 137 111 165 417 -9 200 249 235 205 217 176 143 256 -9 141 264 168 134 244 233 264 220 155 304 202 221 203 138 121 205 129 253 187 117 366 309 211 216 308 265 216 210 181 201 192 146 254 231 239 259 205 
1012 82 Karitiana Brazil AMERICA 120 128 124 129 156 228 142 112 182 98 130 120 148 227 258 229 165 165 218 198 -9 143 245 134 230 200 188 146 119 205 174 174 158 171 102 166 132 147 166 174 208 188 -9 115 153 105 225 239 271 195 221 96 117 233 199 288 190 113 95 241 192 127 141 113 163 150 239 246 91 126 257 107 155 157 112 162 228 152 190 130 187 98 137 133 205 228 241 142 179 160 179 150 184 238 135 172 246 197 119 148 246 197 202 158 162 251 181 127 322 172 196 203 180 164 190 135 232 198 144 192 155 241 151 172 137 220 200 273 247 151 114 155 133 170 149 157 202 204 124 208 254 228 121 228 228 141 370 183 173 200 147 184 153 204 355 204 157 244 115 222 259 234 112 175 -9 132 197 246 255 184 149 179 109 269 187 -9 131 196 149 155 109 214 191 142 126 179 312 199 155 233 190 187 169 240 140 233 274 215 120 236 159 184 289 241 167 274 147 264 220 276 191 249 181 251 104 267 104 258 224 257 100 292 319 245 242 286 146 194 181 233 282 164 278 235 178 177 262 264 180 211 -9 163 149 98 287 182 193 246 180 301 237 299 210 133 129 248 169 322 159 253 162 178 158 204 216 260 198 220 270 209 174 226 180 304 165 235 258 138 320 289 207 225 160 128 172 372 203 185 197 209 184 296 170 179 298 275 140 176 160 293 119 158 191 192 184 173 272 296 266 194 188 149 242 190 209 256 135 249 282 -9 100 266 180 182 236 175 137 111 149 405 -9 200 249 223 203 217 168 139 252 -9 125 256 164 134 240 233 252 204 151 304 202 185 199 118 121 205 123 245 187 117 350 301 211 216 308 245 212 210 181 201 188 142 254 227 231 251 205 
1013 82 Karitiana Brazil AMERICA 128 128 146 129 142 228 140 116 186 98 130 120 148 217 258 235 171 175 218 198 187 149 251 134 230 200 200 146 141 207 183 176 162 169 102 166 120 147 168 174 212 188 255 115 150 120 234 242 -9 210 221 111 117 236 205 291 190 116 95 241 192 127 144 122 163 156 263 234 91 132 266 -9 155 157 115 165 228 155 190 133 193 104 146 136 205 246 247 151 179 160 197 150 184 247 135 193 246 197 119 156 254 201 202 162 170 263 189 127 334 176 190 203 180 164 202 143 244 202 144 192 155 237 163 168 137 224 210 273 247 155 126 151 133 166 157 169 210 204 128 208 254 228 145 228 240 145 382 183 177 208 147 188 157 204 363 216 157 244 119 218 263 234 116 187 243 132 205 246 255 184 149 187 109 277 191 184 135 196 149 147 117 212 191 158 146 175 320 223 155 249 190 187 173 260 140 233 278 223 120 248 167 180 301 241 171 274 147 264 220 276 195 253 189 263 108 271 116 282 224 257 108 300 327 245 242 298 154 198 213 233 290 164 286 239 178 189 282 264 188 223 168 163 149 98 291 194 189 250 180 309 237 299 222 129 129 248 169 330 163 257 166 178 162 212 216 260 202 224 286 223 194 226 180 304 173 255 266 150 324 285 203 237 164 136 180 372 215 189 197 209 172 300 170 195 302 311 140 176 168 293 131 158 199 196 184 173 268 300 266 202 188 149 246 202 209 268 135 249 286 201 100 270 200 198 246 163 165 111 165 417 -9 200 253 239 209 217 172 143 252 268 137 256 164 142 240 237 256 216 167 312 202 185 203 134 119 213 129 245 191 129 358 313 211 204 312 265 216 206 181 201 188 146 258 227 227 271 209 
1013 82 Karitiana Brazil AMERICA 120 124 124 129 142 228 140 112 182 98 130 118 148 217 258 233 163 165 218 190 187 143 245 134 228 184 188 138 119 205 183 172 158 163 100 166 120 145 166 174 212 182 246 115 150 105 231 242 -9 195 221 96 117 236 199 291 187 113 95 238 192 127 141 113 157 150 257 234 91 126 257 -9 155 157 115 162 228 152 190 130 187 98 137 130 205 243 241 139 179 160 179 150 184 247 126 172 246 197 119 156 246 193 202 158 162 251 185 119 334 176 190 203 178 156 198 135 244 198 144 188 151 233 151 164 133 224 206 273 247 155 122 151 133 146 149 157 202 204 124 204 246 228 141 228 232 141 378 183 173 204 147 188 153 196 351 212 157 240 119 214 263 234 116 175 225 120 205 238 255 184 149 179 109 273 191 180 131 196 149 135 109 212 191 154 146 171 312 215 155 237 190 183 169 252 140 225 278 215 116 248 159 176 289 241 171 270 143 260 216 276 195 241 185 263 104 271 100 278 212 253 100 292 319 237 242 290 150 198 209 233 278 164 270 239 178 189 278 264 184 211 152 151 145 98 283 174 177 250 180 297 237 299 210 129 125 248 153 330 159 257 166 178 154 204 216 260 198 220 286 209 170 226 168 304 169 235 258 146 320 285 203 225 160 128 176 372 203 189 189 209 168 300 170 183 302 275 136 176 168 289 119 150 191 192 184 173 268 292 262 202 188 149 242 190 193 256 135 249 282 197 100 266 180 182 242 163 165 111 165 405 -9 200 249 235 205 217 172 119 252 260 125 256 164 134 240 229 252 204 151 304 198 185 199 134 119 205 129 245 181 117 346 309 211 180 312 265 212 198 173 201 188 146 246 215 227 259 205 
1014 82 Karitiana Brazil AMERICA 120 128 146 129 142 228 146 116 182 98 130 120 148 -9 258 235 175 175 218 198 187 149 247 134 230 200 188 138 141 207 183 174 158 -9 104 166 120 147 172 180 212 191 252 115 159 -9 234 242 274 210 221 96 126 236 208 294 190 -9 95 256 192 127 132 113 169 156 263 246 79 132 266 110 158 157 112 165 240 152 -9 133 -9 98 137 136 205 246 244 142 179 166 200 150 190 247 135 193 246 200 119 156 254 201 202 162 170 263 189 119 342 -9 196 203 180 164 202 143 232 202 152 200 155 241 155 172 149 228 206 -9 247 155 126 155 137 178 165 157 206 208 140 212 246 232 137 228 240 145 382 187 177 204 147 192 153 204 -9 216 -9 260 119 222 259 234 116 183 229 132 205 246 255 184 149 175 117 281 195 188 135 196 157 155 117 214 199 158 146 179 320 219 155 249 190 187 181 260 152 245 282 215 120 244 163 188 293 245 171 274 155 264 224 280 195 253 185 263 104 271 108 278 224 257 108 304 327 233 246 290 162 202 209 237 298 174 274 223 178 193 262 260 180 223 172 163 153 106 287 182 193 -9 180 301 237 311 214 129 129 244 169 330 163 253 162 178 154 212 216 268 206 220 286 223 174 -9 180 304 169 251 270 150 324 289 203 261 172 136 180 376 203 189 193 237 160 300 182 179 302 311 144 176 168 -9 119 158 191 192 216 169 264 296 270 202 200 149 246 202 209 280 139 249 290 201 100 274 204 194 250 163 141 111 161 405 163 204 249 235 211 217 -9 143 256 264 141 264 164 134 -9 237 256 204 171 312 200 185 203 134 119 213 123 245 187 129 366 313 211 216 308 265 216 206 181 201 184 142 258 239 231 271 205 
1014 82 Karitiana Brazil AMERICA 120 128 146 129 142 228 142 116 182 96 130 120 146 -9 258 235 169 165 218 194 183 141 251 132 230 184 188 134 139 205 183 172 158 -9 102 166 120 145 168 174 208 188 246 115 141 -9 225 242 271 207 221 96 126 233 208 288 187 -9 95 241 192 121 132 113 163 150 251 237 79 132 260 110 155 157 106 165 228 149 -9 133 -9 98 137 136 202 246 244 139 179 154 179 150 184 238 135 172 246 197 119 156 246 197 202 158 162 259 181 119 330 -9 190 203 180 164 190 143 232 194 144 188 155 237 151 172 137 220 206 -9 247 143 126 155 137 170 161 157 202 208 124 204 242 228 137 228 232 133 370 183 173 200 147 188 153 200 -9 204 -9 240 119 214 259 234 116 175 225 120 197 246 255 184 145 175 113 273 187 180 135 196 149 147 109 210 191 158 134 163 316 209 151 249 190 187 157 248 140 237 274 207 120 240 155 180 289 241 163 274 147 264 220 276 191 245 181 263 104 267 104 258 220 257 108 292 319 233 242 290 146 202 185 229 278 164 274 223 178 189 262 260 180 215 164 159 149 100 283 178 177 -9 180 301 237 303 210 129 125 240 153 322 159 249 162 178 150 204 216 260 198 220 282 209 170 -9 180 304 147 235 258 150 320 285 199 237 168 132 172 372 203 181 193 209 160 296 182 179 302 299 140 176 164 -9 119 158 191 192 208 169 260 296 266 202 188 149 242 202 193 256 139 249 274 201 100 270 180 182 246 163 137 111 141 405 159 200 245 235 205 213 -9 135 252 260 129 256 160 134 -9 233 256 204 155 304 198 185 203 134 111 205 123 245 183 117 346 313 203 180 308 209 212 198 173 201 184 142 254 227 227 251 205 
1015 82 Karitiana Brazil AMERICA 126 128 146 129 156 234 142 116 182 98 130 120 148 217 258 235 173 175 218 -9 187 145 245 134 230 186 188 146 139 207 183 182 162 175 102 166 -9 147 170 182 212 191 -9 115 159 -9 225 242 271 210 221 111 126 236 205 294 190 116 95 241 192 127 144 113 157 156 251 237 91 132 266 110 158 157 115 165 240 152 205 133 -9 104 146 136 205 246 244 151 179 163 197 150 184 241 135 196 246 200 119 156 254 201 202 166 162 255 189 127 -9 172 190 211 180 152 198 143 244 202 148 192 155 233 155 176 141 220 200 -9 251 155 130 155 137 170 149 157 210 204 128 212 250 224 141 228 232 145 378 183 177 208 151 192 153 204 367 216 157 244 115 222 263 234 120 187 229 120 185 238 255 184 153 183 113 273 187 184 135 196 149 151 117 214 191 158 146 179 320 215 155 249 198 187 181 244 152 245 274 215 120 236 167 180 289 245 171 270 147 260 220 276 -9 257 189 267 104 271 104 278 224 257 108 292 323 245 246 294 170 198 209 233 290 174 286 239 174 189 278 264 188 219 168 163 149 98 287 194 189 250 184 309 237 311 214 129 129 244 169 330 163 253 166 178 154 216 216 264 202 224 286 219 194 -9 180 304 173 255 262 150 324 289 203 237 160 136 184 -9 219 197 197 209 172 300 186 183 302 299 144 176 160 -9 131 158 191 200 184 173 272 296 270 202 200 149 246 210 209 268 135 -9 282 209 100 270 -9 198 250 163 169 111 165 405 167 204 249 239 213 217 -9 143 264 268 141 256 172 134 244 237 260 204 167 312 198 221 203 146 121 205 129 245 181 133 358 -9 -9 204 316 265 220 210 173 205 184 146 258 235 231 -9 209 
1015 82 Karitiana Brazil AMERICA 120 124 146 129 142 234 140 112 182 98 130 120 148 217 258 235 163 171 218 -9 187 143 245 134 230 184 188 138 119 199 183 182 154 163 98 166 -9 145 168 174 212 182 -9 115 153 -9 225 242 271 195 221 111 126 236 199 291 187 116 95 241 192 121 141 113 157 144 239 234 88 126 263 107 155 157 109 165 228 152 190 130 -9 98 137 136 205 243 241 139 179 160 194 150 184 241 135 193 246 197 119 156 246 197 202 158 162 255 181 127 -9 172 190 203 178 152 190 135 232 198 144 188 155 233 151 164 137 220 200 -9 247 143 122 151 137 166 149 157 202 204 124 208 238 224 137 224 232 133 378 183 173 204 147 188 153 204 355 216 157 240 115 218 263 234 116 183 225 120 185 238 255 180 149 175 109 273 183 184 131 196 149 147 109 212 191 158 146 175 312 199 155 233 190 187 169 240 140 233 274 215 116 236 155 180 289 241 171 270 143 260 216 276 -9 241 185 267 104 267 104 270 216 257 100 292 311 241 234 290 150 194 205 233 278 164 270 235 174 189 262 260 184 215 156 159 145 98 287 178 189 246 180 301 237 299 210 129 125 240 169 322 163 253 166 178 146 208 208 260 198 220 274 213 170 -9 168 304 169 235 262 138 320 285 199 229 160 132 176 -9 203 189 189 209 160 292 170 179 302 275 144 176 148 -9 119 158 191 192 184 173 264 292 270 202 188 149 246 190 193 256 135 -9 282 205 100 266 -9 182 246 163 169 111 141 401 163 200 249 235 205 217 -9 135 252 268 141 256 168 134 240 229 252 204 155 304 198 221 203 146 119 205 123 245 181 117 346 -9 -9 180 312 265 216 206 173 197 180 142 258 227 231 -9 205 
1016 82 Karitiana Brazil AMERICA 128 128 -9 129 156 234 142 116 182 98 140 120 148 227 258 233 173 165 218 198 187 149 245 134 230 200 188 146 119 205 183 182 162 -9 102 166 132 149 172 180 208 191 255 115 150 -9 234 242 274 -9 221 111 126 236 208 294 190 -9 95 253 192 127 141 122 163 150 263 249 -9 126 266 110 158 157 112 165 228 155 -9 133 -9 107 137 136 205 243 244 151 188 160 179 156 184 244 135 190 246 197 119 156 254 201 202 166 162 255 185 127 342 168 200 203 180 164 198 143 232 202 152 196 155 241 155 176 -9 224 210 273 251 151 122 155 137 174 157 161 202 208 128 208 254 228 121 228 240 149 378 183 193 204 159 192 165 200 363 216 157 248 123 226 259 234 116 187 225 132 197 246 255 188 153 175 113 277 195 184 139 196 153 155 117 214 199 158 150 179 320 209 155 249 190 187 181 252 152 237 282 215 120 248 167 180 289 257 171 -9 -9 264 220 276 -9 245 189 267 108 267 116 278 224 -9 108 292 327 245 246 290 162 206 213 237 290 168 278 235 178 193 282 -9 180 215 156 163 149 100 287 194 193 250 184 301 237 303 214 133 133 248 169 322 163 257 166 178 158 212 216 268 202 224 286 213 190 238 180 308 173 255 262 146 324 289 203 -9 172 132 176 376 219 189 201 237 184 292 178 183 302 299 144 176 164 -9 131 158 199 196 184 173 264 296 270 202 204 153 246 210 209 280 135 249 290 -9 100 274 204 194 246 163 165 111 165 417 163 204 249 235 211 217 176 143 260 -9 141 256 160 134 200 237 264 220 171 308 198 221 203 138 121 213 123 245 187 133 358 317 211 180 308 265 220 206 181 205 188 146 254 231 239 263 225 
1016 82 Karitiana Brazil AMERICA 126 128 -9 129 142 234 140 116 182 98 130 114 148 217 258 233 165 165 214 198 175 143 241 134 228 184 188 138 119 199 183 172 158 -9 102 166 132 145 166 174 208 188 249 115 141 -9 225 242 271 -9 221 96 117 233 199 288 190 -9 95 241 192 127 132 113 163 144 263 237 -9 126 257 107 155 157 112 165 228 152 -9 130 -9 104 137 133 202 243 244 139 179 154 179 150 184 241 135 172 246 197 119 156 246 197 202 158 162 251 181 127 342 168 196 199 180 152 190 135 232 194 140 188 151 241 151 172 -9 220 206 273 247 147 114 151 137 170 149 157 202 204 124 208 254 224 121 224 228 141 370 183 173 200 155 184 153 192 347 216 153 244 115 222 259 230 112 175 225 128 185 242 255 184 145 175 109 269 191 180 131 196 149 135 113 208 191 142 146 179 316 199 155 233 190 187 177 240 140 233 274 215 112 236 159 180 289 241 167 -9 -9 264 216 276 -9 241 181 267 104 263 104 278 220 -9 100 292 319 233 242 286 146 194 185 233 286 164 270 223 178 177 282 -9 180 211 156 155 149 98 283 174 177 250 180 301 237 299 214 129 129 240 149 322 163 249 166 178 150 204 216 264 198 216 286 209 174 226 172 304 169 235 258 142 320 285 203 -9 168 128 176 376 203 181 189 209 160 292 170 183 298 275 140 176 148 -9 119 158 199 192 184 169 256 296 262 198 200 149 242 202 209 256 135 249 274 -9 100 270 180 186 236 163 137 111 141 405 159 200 249 231 205 205 168 119 260 -9 129 256 152 134 200 233 248 216 155 304 198 221 199 134 119 213 123 245 181 117 354 297 211 168 308 265 216 198 173 201 184 138 246 231 231 259 225 
1017 82 Karitiana Brazil AMERICA 126 128 124 129 142 228 146 116 182 98 130 120 148 227 258 235 175 165 218 198 183 149 249 134 230 200 188 138 139 209 183 176 158 163 102 166 -9 147 172 180 212 191 252 115 159 120 234 242 274 210 221 111 126 236 208 294 190 113 95 253 192 127 132 113 163 159 263 246 91 132 266 110 155 157 115 165 228 155 202 133 193 104 146 136 205 243 244 151 179 154 179 156 184 247 135 193 249 200 119 156 254 197 202 162 170 259 185 127 342 180 196 203 182 164 202 143 244 202 152 200 155 241 163 172 137 228 210 309 247 147 126 155 137 178 165 157 206 208 140 212 258 228 145 228 232 133 386 187 181 208 147 192 153 204 347 216 157 260 123 226 263 234 116 183 231 128 197 246 255 184 149 183 117 281 187 180 139 208 149 155 117 210 199 158 146 179 320 209 155 249 190 187 181 260 152 245 282 215 120 244 159 188 293 241 167 274 155 268 220 280 195 245 185 263 104 271 104 270 220 261 108 292 327 245 246 290 162 202 209 237 290 174 274 235 186 189 286 260 180 223 172 163 153 106 287 182 189 250 184 301 237 311 214 129 133 244 169 322 159 257 162 178 154 212 220 268 202 220 286 223 190 226 180 304 165 239 270 150 320 285 207 241 172 136 180 376 203 189 -9 209 172 300 182 183 302 311 140 176 168 293 131 158 191 196 212 173 260 296 270 202 204 153 242 202 209 280 139 249 282 201 100 274 204 194 246 163 153 111 173 405 163 204 249 235 211 217 168 143 256 268 137 264 160 142 240 237 256 204 171 312 198 213 203 138 119 213 129 245 191 133 358 313 211 216 312 265 216 206 173 205 184 142 258 239 231 271 205 
1017 82 Karitiana Brazil AMERICA 120 128 124 129 142 228 142 112 182 96 130 120 148 217 258 229 173 165 218 198 175 143 247 132 228 196 188 138 119 205 174 174 158 163 102 166 -9 145 172 180 208 185 249 115 150 108 234 242 271 207 221 96 117 233 208 288 190 113 95 241 192 121 132 113 160 150 251 237 79 126 260 107 155 157 106 165 228 149 202 133 193 98 137 136 202 243 244 142 179 154 179 150 184 247 135 172 246 197 119 140 254 197 202 162 162 259 181 119 330 172 190 199 180 164 190 143 232 194 144 188 155 241 151 172 137 200 206 273 243 143 126 155 133 170 149 157 202 208 124 204 242 228 137 228 228 133 382 183 173 204 147 188 149 200 347 204 153 240 119 214 259 234 112 175 225 120 177 246 255 180 149 175 109 273 187 176 135 196 149 155 117 208 191 142 126 175 316 209 151 249 190 187 181 252 140 237 274 215 112 240 155 180 289 241 163 274 143 264 220 268 191 241 181 263 104 267 104 258 220 257 100 292 327 233 230 286 146 198 185 229 278 168 270 223 178 177 262 260 180 215 156 163 149 98 283 178 177 246 180 301 237 303 214 129 129 240 153 322 159 253 162 178 150 212 216 260 198 220 274 209 174 226 172 304 147 235 262 142 320 285 199 237 172 132 176 376 203 181 -9 209 160 296 170 179 302 303 140 176 148 265 119 158 191 192 208 169 256 296 270 194 200 149 246 202 193 252 139 249 274 197 100 254 180 182 236 163 141 111 161 405 159 200 249 231 203 213 168 131 252 264 129 256 152 134 240 233 256 204 151 308 198 185 203 134 107 205 123 245 183 117 346 301 211 180 308 265 216 206 173 201 180 138 254 223 231 263 205 
1018 82 Karitiana Brazil AMERICA 128 128 146 129 156 234 142 124 182 98 134 120 148 217 258 233 165 165 218 198 187 143 249 134 230 184 188 146 119 201 183 180 162 171 102 166 132 173 172 180 208 191 -9 115 150 108 234 242 274 207 221 111 129 236 205 294 190 116 95 241 192 127 144 122 163 156 263 249 91 132 266 107 155 157 112 165 240 158 190 133 187 104 137 136 205 243 244 151 188 160 179 156 184 241 135 190 246 197 119 156 254 197 202 166 162 259 185 127 -9 -9 196 207 184 164 190 147 232 202 144 196 155 241 155 180 141 220 210 273 251 151 122 155 137 170 157 161 202 204 144 208 254 228 145 228 240 149 378 183 181 204 159 192 -9 208 363 216 153 244 123 222 263 234 116 175 247 132 197 246 255 188 153 179 113 -9 195 180 131 200 149 135 117 214 199 158 146 179 320 209 155 241 198 187 177 260 140 237 282 215 120 236 163 188 289 241 171 274 155 264 220 276 191 241 189 267 108 271 116 278 224 261 108 292 323 245 242 290 158 194 213 237 -9 164 278 235 178 193 282 264 184 215 -9 163 153 98 287 194 185 -9 180 305 237 307 214 133 133 244 169 322 163 -9 170 178 150 216 -9 264 202 224 286 219 190 -9 180 308 -9 235 262 154 324 289 203 241 172 132 176 376 203 189 201 237 184 300 170 183 -9 299 -9 -9 164 293 131 158 199 196 212 173 264 296 270 202 204 -9 246 210 209 256 135 249 290 209 100 274 180 194 246 171 165 111 165 417 167 204 249 235 211 217 -9 131 260 268 137 264 176 134 248 233 -9 220 171 304 198 221 207 134 121 213 123 249 181 133 358 317 -9 204 316 265 216 206 181 205 188 150 254 231 231 263 225 
1018 82 Karitiana Brazil AMERICA 120 126 146 129 142 234 140 116 182 98 130 120 148 217 258 233 165 165 218 198 183 143 241 134 230 184 188 144 119 199 183 172 158 163 102 166 120 149 166 174 208 188 -9 115 141 105 225 242 271 195 221 111 117 233 199 294 187 116 95 238 192 121 141 113 157 144 251 249 91 126 257 107 155 157 112 165 228 152 190 133 187 104 137 133 205 228 241 151 179 160 179 150 184 238 135 172 246 197 119 156 246 197 202 158 162 255 181 123 -9 -9 190 199 180 164 190 135 232 202 140 192 151 237 151 176 133 220 206 273 247 151 114 155 133 170 149 157 202 204 124 204 246 228 121 224 240 149 370 183 173 200 147 184 -9 200 347 216 153 244 111 218 259 234 116 175 225 120 177 246 251 180 145 175 113 -9 187 180 131 196 149 135 113 208 191 142 146 179 312 209 155 233 190 187 177 252 140 233 274 207 112 236 159 180 289 241 167 274 139 264 216 276 191 241 185 263 104 267 104 262 220 257 108 292 319 233 242 286 146 206 189 233 -9 164 270 223 174 177 278 264 180 211 -9 155 149 98 283 174 177 -9 180 301 237 303 210 129 129 240 169 322 163 -9 166 178 150 204 -9 264 198 216 286 213 170 -9 180 308 -9 235 258 142 320 289 203 237 160 128 176 376 203 181 197 209 160 292 170 179 -9 275 -9 -9 152 269 127 154 159 192 184 169 256 296 258 194 204 -9 246 190 209 256 135 249 282 201 100 266 180 194 236 163 165 111 141 405 159 200 249 231 203 205 -9 119 252 268 129 256 152 134 200 233 -9 204 171 304 198 185 199 134 107 205 123 245 181 117 350 313 -9 168 308 265 216 198 173 201 180 138 246 231 227 263 205 
1019 82 Karitiana Brazil AMERICA 122 128 148 135 142 228 142 124 182 98 130 120 148 217 258 235 165 165 218 -9 -9 143 249 134 230 200 188 134 119 209 183 180 158 165 104 166 132 147 166 180 212 188 249 115 150 120 234 239 271 207 -9 -9 117 239 205 294 190 116 95 256 192 -9 144 113 163 156 263 237 91 132 257 110 158 157 112 165 228 -9 205 133 187 107 137 133 -9 243 244 151 188 166 179 150 190 247 141 193 246 197 -9 156 254 201 206 162 162 251 185 119 -9 180 192 199 180 164 206 143 244 206 144 192 159 -9 159 176 145 228 210 -9 247 155 122 155 137 178 153 157 202 208 128 204 254 228 141 228 240 133 378 187 193 208 147 188 153 204 363 216 153 240 119 222 263 234 116 187 229 132 205 246 255 188 153 179 113 273 191 180 135 196 149 147 117 212 199 158 146 179 320 215 155 249 190 187 169 260 140 245 274 223 120 240 167 184 289 249 171 -9 -9 268 216 276 -9 253 185 267 104 275 116 278 224 261 108 292 327 245 242 298 158 202 193 233 290 164 278 239 178 193 282 264 196 211 156 163 153 98 291 194 193 250 180 309 241 311 222 133 129 248 169 330 163 257 166 -9 154 212 216 264 218 224 286 219 194 -9 180 308 157 239 -9 150 320 293 203 241 168 136 176 -9 203 189 197 233 184 300 178 179 -9 311 140 176 160 293 127 154 195 192 212 169 268 296 266 198 188 153 246 202 213 280 135 249 282 201 100 266 180 194 246 167 165 -9 165 405 167 200 253 235 205 217 -9 135 252 268 -9 264 164 134 248 237 -9 216 167 304 202 221 203 134 107 213 129 249 -9 117 -9 -9 -9 204 316 265 220 210 177 201 184 142 246 231 239 267 205 
1019 82 Karitiana Brazil AMERICA 120 124 124 129 142 228 142 112 182 98 130 120 146 217 258 231 161 165 218 -9 -9 143 245 134 230 184 188 134 119 207 183 176 154 163 102 166 132 145 166 174 212 185 249 115 150 105 225 239 271 195 -9 -9 117 236 196 294 187 116 95 256 192 -9 132 113 157 150 257 234 79 126 257 107 155 157 106 165 228 -9 190 130 187 104 137 133 -9 243 241 139 188 160 179 150 184 238 126 190 246 197 -9 156 254 201 202 158 162 251 185 119 -9 180 190 195 178 152 190 143 232 198 140 188 151 -9 155 164 133 220 206 -9 247 147 114 155 133 170 153 157 202 204 124 204 254 228 129 224 232 133 370 183 181 204 147 188 153 204 355 200 153 240 115 222 259 234 116 175 229 120 177 246 255 180 149 179 109 273 187 180 131 196 149 147 117 208 191 142 146 171 308 199 155 233 190 179 169 244 140 245 274 215 116 236 159 180 289 241 171 -9 -9 260 216 268 -9 241 181 267 104 267 104 278 224 257 100 292 323 245 238 298 146 198 189 233 282 164 274 235 174 177 278 260 184 211 156 155 153 98 287 186 193 242 180 301 237 303 210 129 129 244 165 330 163 249 166 -9 154 208 208 260 202 216 270 209 174 -9 180 304 143 235 -9 142 320 289 203 241 160 132 176 -9 203 189 193 209 172 300 170 179 -9 307 140 176 148 269 127 154 191 192 208 169 264 296 262 194 188 149 246 190 209 268 135 249 278 201 100 254 180 182 236 167 141 -9 165 405 163 200 249 235 205 217 -9 131 252 268 -9 264 164 134 244 229 -9 204 155 304 198 221 203 134 107 205 123 245 -9 117 -9 -9 -9 204 312 265 216 206 173 201 184 138 246 227 227 251 205
830 83 Surui Brazil AMERICA 126 128 124 135 156 234 146 124 186 98 130 120 148 227 258 231 175 165 218 194 187 147 249 -9 230 206 188 144 141 207 183 178 158 173 102 172 -9 145 170 180 212 188 261 115 141 -9 234 242 277 -9 239 96 117 236 208 -9 190 113 95 241 192 127 144 119 166 156 263 246 91 132 260 107 155 157 115 165 228 155 190 133 193 104 134 133 205 246 244 142 182 172 194 150 184 247 135 -9 246 200 119 156 246 201 202 166 170 251 181 123 342 176 190 203 178 164 190 147 248 202 144 196 155 241 155 172 141 232 202 273 251 155 126 163 133 170 153 173 202 212 128 208 -9 228 121 228 228 145 382 187 177 204 155 192 157 192 367 216 157 264 123 222 259 234 116 183 239 132 177 242 259 192 157 179 121 273 199 184 135 200 153 159 117 212 191 154 154 171 324 215 159 249 190 183 177 260 152 237 278 211 120 252 167 180 293 265 175 274 147 268 220 276 195 245 185 267 112 271 108 278 220 257 104 292 323 241 242 294 170 202 -9 233 286 164 282 239 182 -9 282 268 184 211 168 163 149 98 295 182 189 242 184 297 245 315 -9 133 129 248 169 322 163 257 170 178 154 208 216 264 202 224 278 209 194 230 180 304 165 239 266 150 324 289 203 261 164 136 172 372 211 189 197 209 176 296 186 179 306 275 140 176 148 289 123 154 191 196 212 177 264 292 266 202 200 153 242 202 205 276 135 249 282 201 100 266 208 198 242 167 137 111 161 405 -9 200 249 235 203 217 176 139 252 264 125 264 164 146 240 233 -9 220 159 304 204 221 207 134 111 205 129 249 183 133 354 309 215 216 304 265 216 206 177 205 184 150 254 235 235 263 221 
830 83 Surui Brazil AMERICA 126 128 124 129 142 232 138 112 186 98 130 120 148 217 258 231 165 165 218 194 187 143 243 -9 230 200 188 134 141 207 183 176 158 171 102 172 -9 145 170 180 208 182 258 115 141 -9 225 242 271 -9 221 96 117 230 196 -9 187 113 95 238 192 127 144 113 160 150 263 246 91 126 257 107 155 151 112 165 228 155 190 133 193 104 134 133 202 246 244 139 179 160 179 150 184 238 126 -9 246 200 119 152 246 197 202 158 170 251 181 123 338 176 190 191 178 152 190 147 248 198 140 192 155 233 151 172 137 220 202 269 247 147 126 159 133 170 149 157 202 200 128 204 -9 228 121 228 228 145 374 187 173 200 155 188 157 192 351 216 157 260 115 218 259 234 116 183 231 128 177 234 259 180 153 175 113 273 187 180 131 196 149 151 105 212 191 142 154 163 308 199 151 233 190 183 169 240 132 233 274 211 112 240 151 172 289 241 175 270 139 264 220 268 187 245 181 263 108 267 108 254 220 257 84 288 323 233 242 286 146 202 -9 233 278 164 266 239 182 -9 278 268 180 211 164 163 141 98 283 174 185 242 180 297 237 311 -9 133 125 248 149 322 163 249 162 178 146 204 216 248 202 220 274 209 170 226 172 292 143 235 258 146 320 285 199 233 164 132 172 372 211 181 189 209 168 296 186 179 298 275 136 176 148 289 119 154 191 196 188 173 264 292 262 202 188 149 242 202 201 252 135 245 282 201 100 254 208 198 242 163 137 111 141 405 -9 200 245 235 203 217 172 139 252 260 117 256 164 146 216 233 -9 216 151 304 198 213 199 134 111 203 123 245 181 117 346 297 203 216 300 265 212 206 173 201 180 146 250 231 231 259 221 
832 83 Surui Brazil AMERICA 126 128 124 129 156 232 146 124 186 98 130 120 148 227 260 231 175 165 218 194 187 147 249 136 228 206 188 146 141 207 183 178 158 173 102 172 128 173 166 180 208 185 258 115 141 120 234 242 271 213 239 96 117 236 196 294 187 113 95 256 192 127 144 119 166 156 266 246 91 126 260 113 155 157 -9 165 228 155 190 133 193 104 143 136 205 246 244 142 179 160 194 150 184 247 132 196 246 200 119 156 250 201 202 158 166 251 181 131 338 176 192 207 178 164 202 147 248 202 144 196 159 237 151 172 137 224 204 301 255 155 126 163 133 170 157 173 202 212 128 204 254 228 121 232 240 145 382 183 193 204 155 192 157 200 367 220 157 260 123 222 259 234 116 183 231 132 189 242 259 180 149 175 113 273 195 184 143 200 149 159 113 212 191 142 154 171 324 241 159 237 190 187 173 244 152 237 274 223 120 248 151 180 293 265 175 274 147 268 224 276 187 253 185 267 112 267 108 278 220 257 104 292 323 237 246 298 170 202 209 233 286 168 278 239 182 185 282 268 196 211 168 159 149 106 295 194 193 250 180 297 245 315 222 133 125 248 -9 322 163 253 174 178 154 212 216 264 202 224 282 209 170 226 172 308 165 255 266 150 320 285 203 265 168 136 172 372 211 189 197 221 168 296 186 195 306 275 140 196 148 289 119 154 191 196 212 177 264 296 274 202 200 153 242 202 205 276 135 249 282 201 116 270 204 198 242 175 153 111 165 405 159 200 249 235 207 217 176 139 260 268 125 264 164 146 208 241 260 216 159 -9 202 217 199 134 111 205 123 245 183 133 -9 309 211 216 320 265 216 206 177 205 184 150 258 231 235 271 221 
832 83 Surui Brazil AMERICA 126 128 124 129 142 228 146 116 186 98 130 120 148 227 260 231 175 165 218 194 175 143 243 134 204 200 188 144 141 207 183 176 158 171 102 172 128 145 164 180 208 182 258 115 141 108 225 242 271 201 221 96 117 230 196 294 187 113 95 241 192 127 132 113 160 150 263 246 91 126 257 110 155 157 -9 156 228 152 190 130 193 98 134 133 202 246 244 139 179 154 194 150 184 229 126 172 246 200 119 140 246 201 198 158 162 251 181 123 338 168 192 207 178 156 190 143 232 194 140 192 155 233 151 172 133 216 202 269 251 147 126 151 133 146 149 157 202 208 128 200 238 228 121 228 228 133 374 183 173 200 155 188 157 192 359 216 157 260 115 222 259 234 112 175 231 128 177 238 255 180 149 175 109 273 187 184 139 200 149 151 109 212 191 142 154 163 312 219 159 237 190 183 169 240 152 237 274 211 108 240 151 172 289 241 175 270 147 260 224 268 187 245 181 263 108 263 108 278 220 253 100 292 323 237 242 286 154 202 193 233 286 164 266 239 178 173 278 264 180 211 160 155 145 98 287 174 189 242 180 297 237 311 214 133 125 236 -9 322 163 249 162 178 146 204 216 264 202 220 274 209 170 226 172 308 147 239 258 138 316 277 203 265 164 136 172 372 203 181 197 209 168 296 186 179 298 275 140 196 148 289 119 154 191 192 184 169 264 292 266 202 200 149 242 202 201 252 135 249 274 201 100 266 204 194 242 167 137 111 141 405 159 200 245 227 203 217 172 139 252 264 117 256 164 130 204 233 260 204 151 -9 202 185 199 134 111 199 123 245 181 133 -9 301 203 216 312 261 212 206 173 205 180 146 250 231 231 263 205 
833 83 Surui Brazil AMERICA 126 128 144 135 156 234 146 112 186 98 130 120 148 223 258 235 175 165 -9 194 187 143 249 132 230 -9 190 146 141 -9 183 178 158 173 102 172 -9 173 170 -9 212 188 261 115 141 -9 225 245 277 -9 221 111 129 236 196 294 187 113 95 256 192 127 144 119 160 150 -9 246 91 129 260 107 155 157 112 165 240 155 205 133 -9 104 134 133 202 246 244 142 182 172 194 150 184 247 135 196 249 200 113 156 -9 201 202 166 170 259 181 135 338 -9 192 207 178 164 202 147 248 202 144 188 159 241 159 180 141 220 202 -9 255 155 126 163 137 170 149 173 202 208 128 204 250 228 121 228 236 149 374 183 177 204 151 192 -9 208 367 216 -9 260 123 218 259 238 116 183 243 136 201 242 255 192 153 179 113 -9 195 -9 139 200 149 151 117 212 195 154 154 163 324 225 151 249 190 183 169 260 152 237 274 227 116 248 151 184 289 245 175 -9 147 268 224 276 195 253 185 271 108 271 108 278 220 253 100 292 327 237 246 294 154 202 209 233 286 164 278 239 182 185 282 268 180 211 160 163 145 98 291 174 189 -9 184 297 -9 315 218 133 133 248 157 322 163 -9 170 178 162 216 216 264 202 224 286 209 170 230 180 -9 165 255 -9 -9 324 289 203 265 164 136 172 -9 207 181 197 209 168 304 186 179 306 275 -9 -9 148 -9 123 154 191 200 212 181 264 296 270 202 196 -9 246 -9 205 276 135 245 286 201 100 270 208 198 246 175 153 111 161 405 167 200 249 235 213 225 172 139 252 264 125 264 164 146 240 241 -9 220 159 304 202 209 199 138 119 201 129 249 181 133 354 309 215 216 304 265 224 210 177 205 184 146 258 235 -9 263 221 
833 83 Surui Brazil AMERICA 126 124 124 129 142 234 140 112 186 98 130 120 148 217 258 231 173 165 -9 194 175 143 243 132 226 -9 188 144 141 -9 183 176 158 171 102 166 -9 145 166 -9 208 185 258 115 141 -9 225 242 271 -9 221 96 117 230 196 294 187 113 95 241 192 124 132 113 157 150 -9 237 91 126 257 107 155 151 106 165 228 152 190 133 -9 104 131 133 202 246 244 139 179 160 194 150 184 238 132 172 246 200 113 140 -9 197 202 166 162 251 181 123 334 -9 190 191 178 156 190 147 232 194 140 188 155 237 151 180 137 220 202 -9 247 151 126 155 133 170 149 173 202 204 128 200 238 228 121 228 236 133 374 183 177 204 147 188 -9 208 351 216 -9 244 123 218 259 234 112 175 229 132 193 238 255 180 149 175 109 -9 195 -9 131 200 149 143 105 212 179 142 150 163 320 219 151 237 190 183 169 244 132 233 274 227 116 236 151 184 289 241 175 -9 139 264 220 276 195 245 185 263 108 267 108 278 220 253 84 280 319 233 242 286 146 202 209 233 278 164 278 239 182 173 278 260 180 211 152 155 141 98 283 174 185 -9 184 297 -9 311 214 125 125 244 149 322 163 -9 170 178 146 204 212 260 202 224 278 209 170 230 172 -9 165 239 -9 -9 320 285 195 229 164 132 172 -9 203 181 189 209 168 296 170 179 306 275 -9 -9 148 -9 119 154 191 196 208 177 264 296 266 202 188 -9 242 -9 201 276 135 245 274 201 100 266 200 190 242 163 137 111 141 405 159 200 245 235 203 217 172 123 252 260 117 256 164 138 204 237 -9 204 159 304 196 209 199 134 107 201 123 249 181 117 346 309 211 180 304 261 212 206 177 201 184 146 250 227 -9 259 205 
834 83 Surui Brazil AMERICA 126 124 144 129 156 228 146 112 186 96 140 120 148 223 258 231 177 165 218 -9 -9 143 249 132 230 -9 190 144 141 -9 183 182 158 173 102 172 -9 173 172 182 212 182 261 115 141 -9 234 242 271 216 -9 96 129 236 196 294 187 113 95 256 192 -9 144 119 160 150 239 246 91 129 260 110 158 157 115 165 240 155 190 133 -9 104 143 133 205 246 244 142 184 -9 194 150 184 247 135 196 246 200 -9 156 -9 201 198 166 170 259 181 135 338 176 196 203 182 164 190 147 240 202 148 192 159 241 159 180 137 224 202 297 247 151 126 163 129 170 149 -9 210 212 128 -9 250 236 121 228 236 149 382 183 177 204 155 192 157 204 351 204 157 264 123 218 259 238 112 183 229 132 201 242 259 192 153 179 109 277 195 180 143 200 149 159 117 212 199 142 154 163 324 -9 155 249 190 183 169 260 152 249 274 223 116 248 155 188 293 241 175 -9 147 268 224 276 199 253 185 267 108 267 108 254 220 253 104 292 327 237 246 302 -9 202 209 233 286 168 -9 239 182 177 282 268 180 211 168 159 145 104 291 182 193 242 184 309 249 311 214 133 133 248 157 322 163 257 170 178 158 216 216 264 202 224 286 227 194 230 180 -9 165 255 -9 158 320 289 199 265 164 136 168 376 207 181 201 209 176 296 182 179 306 275 140 176 148 -9 119 154 191 196 212 177 264 296 266 202 200 149 246 202 201 276 151 -9 286 201 100 270 200 194 250 175 153 111 165 405 159 200 249 235 213 225 172 139 264 264 125 256 164 146 240 233 260 220 159 312 204 209 207 134 119 199 129 245 -9 129 -9 -9 211 216 316 265 220 206 177 205 184 146 258 231 239 259 205 
834 83 Surui Brazil AMERICA 126 124 124 129 156 228 140 112 186 96 130 120 148 217 258 229 175 165 218 -9 -9 143 243 132 230 -9 190 134 141 -9 183 176 158 171 102 172 -9 145 166 180 208 182 258 115 141 -9 234 242 262 195 -9 96 117 230 196 294 187 113 95 256 192 -9 144 113 157 150 239 237 91 126 260 107 155 151 106 156 228 155 190 130 -9 104 134 130 205 246 244 139 179 -9 179 150 184 238 126 172 246 200 -9 156 -9 201 198 158 162 251 181 123 330 168 192 203 174 156 190 139 232 202 144 188 155 237 151 180 137 220 202 269 247 147 118 163 129 170 149 -9 202 200 124 -9 238 228 121 228 224 145 374 183 173 200 151 188 157 200 351 204 157 240 123 214 259 234 112 175 229 132 193 238 259 192 149 179 109 273 191 180 131 196 149 151 105 212 179 142 150 163 312 -9 151 249 190 183 169 244 132 237 274 223 116 240 151 176 289 241 175 -9 139 264 220 276 199 249 181 263 108 263 108 254 212 253 84 288 323 233 242 294 -9 194 189 233 278 164 -9 239 182 173 278 260 180 211 160 155 141 102 283 174 189 242 184 297 237 311 214 125 125 244 149 322 163 249 166 170 154 212 212 264 198 216 278 223 170 226 172 -9 165 239 -9 146 320 285 199 229 164 136 172 376 203 181 197 209 168 296 182 179 298 275 136 176 148 -9 119 154 159 196 208 173 264 292 266 202 188 141 242 202 201 276 135 -9 274 201 100 254 200 190 242 163 137 111 161 405 159 200 245 235 203 217 172 139 252 260 125 256 160 146 208 233 256 204 151 304 196 185 199 134 107 199 129 241 -9 117 -9 -9 203 180 304 261 212 206 177 205 184 146 250 227 235 259 205 
835 83 Surui Brazil AMERICA 126 124 124 135 156 228 150 112 186 98 140 120 148 223 258 231 177 165 218 194 187 149 249 132 230 200 190 146 141 209 183 182 158 171 102 172 -9 145 172 180 212 182 261 115 141 120 234 245 271 195 221 96 129 236 196 294 187 113 95 256 192 127 132 113 166 156 -9 246 91 126 260 107 158 151 112 165 228 155 190 130 193 104 140 136 205 246 244 142 184 172 194 150 184 247 135 196 246 200 119 152 246 197 206 166 162 251 185 131 342 176 188 203 180 164 202 143 244 202 144 188 155 241 155 180 137 224 202 301 247 151 126 163 137 170 165 177 210 208 140 208 254 236 121 228 236 145 382 183 193 204 163 192 157 208 351 212 -9 264 123 218 259 238 116 183 229 140 201 242 263 192 153 179 109 277 199 180 143 200 149 159 117 212 191 158 154 171 324 241 155 249 190 183 173 260 152 249 274 227 116 248 155 184 289 241 175 274 147 268 220 276 199 253 185 267 108 271 108 282 220 257 104 292 323 241 246 294 146 202 213 233 298 170 278 239 182 177 282 268 180 211 168 159 149 102 295 174 193 -9 184 305 249 315 218 125 133 248 169 322 163 257 174 178 154 208 216 264 202 224 286 223 170 230 172 300 165 255 262 142 320 289 199 233 168 136 172 372 211 189 197 209 168 296 190 179 306 275 140 176 168 293 119 154 191 192 212 181 264 296 270 202 200 149 242 202 201 276 135 245 286 205 100 270 200 194 250 163 153 111 165 405 159 200 249 243 213 217 172 139 260 264 125 256 164 146 240 241 264 220 159 312 202 209 207 134 113 201 129 249 183 117 346 301 211 216 316 265 224 206 177 205 184 146 258 235 235 267 -9 
835 83 Surui Brazil AMERICA 126 124 124 129 156 228 140 112 186 96 130 120 148 223 258 229 177 165 218 194 175 143 249 132 204 200 190 144 141 207 183 178 158 171 102 172 -9 145 166 174 208 182 258 115 141 120 225 242 262 195 221 96 117 230 196 294 187 113 95 256 192 124 132 113 157 150 -9 234 91 126 260 107 155 151 109 156 228 152 190 130 193 104 131 133 202 246 244 139 179 160 194 150 184 238 135 196 246 200 113 140 246 193 198 158 162 251 181 131 330 176 188 203 178 156 190 139 232 194 144 188 155 237 151 172 137 220 202 273 247 151 126 155 129 170 149 161 202 208 124 204 238 228 121 228 228 145 374 183 177 204 151 192 157 208 351 204 -9 244 119 218 259 234 112 175 229 132 201 238 259 192 149 179 109 269 199 180 143 196 149 151 105 212 191 142 150 163 312 199 151 237 190 183 169 240 140 237 274 227 112 248 151 180 289 241 171 274 139 264 220 276 187 253 181 263 108 267 108 254 220 253 100 288 323 233 242 286 146 194 209 233 278 170 278 223 178 173 282 260 180 211 160 155 145 98 283 174 189 -9 180 297 237 311 214 117 133 244 149 322 159 249 166 178 146 204 212 260 198 216 278 209 170 226 172 300 165 239 258 138 320 285 199 229 164 132 168 368 203 181 197 209 168 296 182 179 306 275 140 176 148 269 119 154 191 192 208 177 264 296 266 202 188 141 242 202 201 276 135 245 274 201 100 254 200 194 242 163 141 111 161 405 159 200 245 227 203 217 164 131 252 260 125 256 164 134 208 233 256 204 159 304 196 185 199 134 111 201 129 241 181 117 366 297 203 216 304 261 220 206 177 201 184 146 254 231 231 259 -9
837 83 Surui Brazil AMERICA 126 128 124 129 156 234 146 124 186 98 140 120 148 223 260 231 177 165 218 198 191 143 249 144 230 200 188 144 141 207 183 182 158 173 102 172 -9 145 170 174 208 185 261 115 141 120 231 245 277 201 221 96 129 236 196 306 190 113 95 238 192 127 144 119 163 156 -9 237 91 126 260 107 155 157 115 165 228 155 205 133 193 104 140 130 205 246 244 148 182 172 194 150 184 247 132 196 249 200 119 156 250 197 202 162 162 251 181 127 338 176 192 207 178 164 198 147 244 194 148 200 159 241 159 180 137 224 206 309 251 155 118 163 137 170 157 177 210 212 128 208 242 236 121 228 232 145 382 183 181 204 147 192 157 192 367 204 157 264 123 222 259 234 116 183 239 140 201 234 259 192 149 179 109 273 199 180 139 200 153 151 117 212 191 154 154 163 320 219 151 249 190 183 173 244 152 237 274 211 116 240 151 188 289 265 175 -9 151 268 224 276 199 253 185 271 108 267 108 278 220 257 104 296 323 241 246 298 154 202 209 233 298 170 278 239 182 177 286 -9 196 211 160 163 149 102 295 194 185 242 184 305 237 315 218 133 133 248 149 322 163 253 170 178 158 208 216 264 202 224 278 209 170 230 172 304 165 239 266 158 324 289 203 233 164 140 172 372 207 181 201 209 168 296 186 191 302 275 144 196 148 269 123 154 191 196 212 177 264 296 270 202 200 153 242 202 205 252 135 249 282 201 100 266 204 -9 250 167 149 111 141 405 167 200 249 235 207 217 172 139 264 268 137 264 168 146 240 233 260 220 159 304 204 185 207 -9 117 205 129 249 181 129 366 309 203 216 316 265 216 206 173 205 184 146 258 231 239 259 221 
837 83 Surui Brazil AMERICA 126 128 124 129 142 228 140 124 186 96 130 120 148 217 258 229 165 165 218 188 175 143 249 132 228 184 188 134 141 207 174 178 158 171 102 172 -9 145 168 174 208 182 258 115 141 120 225 245 271 195 221 96 126 230 196 294 187 113 95 238 192 127 144 113 160 156 -9 237 91 126 260 107 155 157 109 156 228 155 190 130 193 104 134 130 205 246 244 142 179 160 179 150 184 247 132 172 246 200 119 152 246 197 202 158 162 251 181 127 326 176 192 191 174 152 190 143 232 194 140 188 155 237 151 164 137 224 202 269 247 155 110 163 133 170 149 157 202 212 124 200 238 228 121 228 228 133 374 179 173 204 147 192 157 192 367 204 145 260 123 218 259 234 112 175 231 140 177 234 259 180 149 179 109 269 191 176 131 196 153 143 117 208 179 142 126 163 308 199 151 237 190 183 165 244 152 233 274 211 112 236 151 180 289 241 175 -9 147 268 220 268 187 245 181 267 104 263 108 278 220 253 84 292 319 237 242 294 146 202 189 233 278 164 278 239 182 173 282 -9 180 211 156 159 141 98 283 174 185 242 180 297 237 307 218 133 129 240 149 322 159 249 166 178 146 204 216 264 202 220 274 209 170 230 172 300 165 235 258 150 320 289 199 229 164 136 172 368 203 181 197 209 168 296 182 179 298 275 140 176 148 265 119 154 191 192 208 173 264 296 262 202 188 153 234 198 201 252 135 245 282 201 100 266 200 -9 242 163 141 111 141 405 159 192 245 231 203 217 172 135 252 264 117 256 160 138 208 233 260 216 151 304 202 185 207 -9 111 205 123 249 181 117 346 305 203 204 300 265 212 206 173 205 180 146 250 231 235 259 221 
838 83 Surui Brazil AMERICA 126 124 124 135 156 234 146 112 186 98 140 120 148 217 258 235 165 165 218 194 193 143 249 132 230 -9 190 146 141 207 183 178 158 171 102 172 -9 145 166 -9 -9 188 261 115 150 -9 234 242 271 195 239 -9 117 236 196 294 190 113 95 241 192 127 141 113 163 -9 -9 246 91 132 266 110 161 157 -9 165 240 155 190 133 -9 104 143 136 205 246 244 142 182 172 194 150 184 247 132 196 246 200 119 156 -9 201 202 166 170 251 181 135 342 176 190 203 182 164 190 143 248 202 148 196 159 241 155 180 137 224 202 297 255 155 118 163 137 170 165 177 210 208 128 208 254 228 145 228 236 149 382 187 193 204 155 192 173 208 367 204 -9 244 -9 218 259 234 116 183 231 136 201 242 259 192 157 179 109 277 199 180 143 200 153 159 117 212 179 158 154 175 324 225 151 249 190 187 177 244 152 249 274 227 116 248 151 180 289 241 175 274 151 268 220 276 199 253 185 271 108 271 108 254 220 257 96 -9 327 241 242 294 170 202 213 233 286 168 278 239 178 185 282 268 180 211 164 155 149 -9 283 174 189 -9 184 301 -9 311 214 133 133 248 169 322 163 257 174 -9 162 216 216 264 202 224 -9 209 -9 230 180 -9 165 255 258 158 320 293 199 233 164 136 176 -9 211 201 189 209 176 296 186 199 298 275 140 -9 -9 -9 123 154 191 196 208 177 264 296 -9 202 200 -9 242 -9 205 276 151 245 282 201 100 270 208 194 246 175 161 111 165 405 167 200 257 235 211 217 176 139 252 264 137 256 164 146 240 233 -9 220 159 -9 204 217 207 138 111 201 129 249 181 133 354 309 -9 216 316 265 224 206 177 205 184 150 258 231 235 259 -9 
838 83 Surui Brazil AMERICA 126 124 124 129 142 234 140 112 180 96 130 120 148 217 258 231 165 165 218 194 187 143 243 132 228 -9 190 134 141 205 174 176 158 163 102 166 -9 145 166 -9 -9 182 258 115 141 -9 231 242 262 195 239 -9 117 236 196 294 187 113 95 241 192 127 138 113 163 -9 -9 246 91 126 266 107 155 157 -9 165 228 155 190 130 -9 98 140 133 202 246 244 139 179 154 194 150 184 235 126 190 246 200 113 152 -9 197 198 162 170 247 181 135 330 176 190 191 178 156 190 139 244 202 144 188 155 241 151 172 133 224 202 269 247 151 118 151 129 170 149 157 202 200 124 204 250 228 121 224 228 149 374 183 173 204 147 192 157 204 367 204 -9 240 -9 214 259 234 116 175 229 132 177 238 259 180 153 175 109 269 191 180 131 196 149 151 109 212 179 154 150 171 308 199 151 233 190 183 169 240 132 233 274 223 112 248 151 176 289 225 171 274 139 264 220 276 195 245 181 267 108 271 108 254 220 253 84 -9 323 237 242 286 146 202 209 233 278 164 278 239 178 173 278 268 180 211 152 155 141 -9 283 174 185 -9 184 297 -9 311 214 125 125 244 157 322 159 253 166 -9 154 212 212 264 198 224 -9 209 -9 226 172 -9 143 239 258 146 320 289 195 229 164 136 172 -9 207 181 185 209 168 296 170 179 298 275 140 -9 -9 -9 119 154 159 192 188 173 264 292 -9 202 188 -9 242 -9 201 268 135 241 282 201 100 266 200 190 242 163 141 111 141 405 167 200 249 235 203 217 172 139 252 260 125 256 164 146 216 233 -9 220 151 -9 202 209 199 134 107 199 129 249 181 117 346 305 -9 216 304 265 220 206 177 205 184 146 258 231 231 259 -9
839 83 Surui Brazil AMERICA 126 128 124 129 -9 234 146 124 -9 98 130 -9 148 223 258 231 165 -9 218 194 187 143 249 132 228 -9 190 146 141 207 183 182 158 171 102 172 128 145 170 182 208 188 261 115 141 120 231 245 -9 201 239 96 126 236 196 294 190 113 95 241 192 127 -9 113 163 156 -9 246 91 132 266 107 -9 157 109 165 228 155 190 133 193 104 140 133 205 246 244 148 182 172 194 150 184 247 132 196 246 200 119 152 -9 197 202 162 170 -9 181 135 342 176 192 -9 178 156 198 143 248 202 148 200 159 241 151 180 137 224 206 269 251 -9 118 163 133 170 149 177 210 212 128 204 254 236 -9 -9 236 149 382 -9 193 204 147 192 173 208 367 204 157 -9 123 222 259 -9 116 183 231 -9 201 238 259 192 153 179 109 269 199 180 -9 200 -9 151 117 -9 191 -9 154 175 324 225 151 -9 190 183 169 244 152 237 274 227 -9 248 151 188 289 241 175 274 151 268 224 276 195 253 185 271 108 271 108 278 220 257 104 -9 323 241 246 298 170 -9 209 233 278 170 278 239 182 185 282 268 180 211 160 163 149 98 295 174 189 242 184 305 237 315 218 133 133 248 169 322 163 257 174 178 -9 212 216 264 202 224 -9 209 -9 230 -9 -9 165 255 258 158 324 289 199 233 164 136 176 372 211 201 201 209 168 296 186 179 302 -9 140 176 148 265 123 154 -9 192 212 173 264 296 270 202 200 153 242 202 205 268 135 245 282 201 100 266 208 198 250 175 149 111 141 405 167 200 249 235 211 217 176 139 252 264 137 256 168 -9 240 -9 260 220 159 304 202 209 207 138 111 205 129 249 181 -9 346 309 211 216 304 265 224 -9 177 205 184 150 258 231 239 259 221 
839 83 Surui Brazil AMERICA 126 124 124 129 -9 234 140 112 -9 96 130 -9 148 217 258 229 165 -9 218 188 175 143 243 132 228 -9 188 144 141 207 174 176 158 163 102 172 118 145 166 174 208 185 261 115 141 105 231 242 -9 195 221 96 117 230 196 294 187 104 95 238 192 127 -9 113 163 156 -9 237 91 126 260 107 -9 157 109 156 228 155 190 130 193 104 134 130 202 246 244 142 179 154 179 150 184 247 132 196 246 200 113 152 -9 197 198 162 162 -9 181 127 326 176 190 -9 178 152 190 139 244 194 140 188 159 237 151 172 137 224 202 269 247 -9 118 151 129 170 149 157 210 208 124 200 238 228 -9 -9 228 145 374 -9 173 204 147 192 157 192 367 204 145 -9 115 218 259 -9 112 183 231 -9 177 234 259 180 149 179 109 269 191 180 -9 200 -9 151 109 -9 179 -9 126 163 308 199 151 -9 190 183 165 240 152 233 274 211 -9 240 151 180 289 241 171 270 151 264 220 276 187 245 185 267 108 267 108 254 220 253 96 -9 323 237 242 294 146 -9 209 233 278 164 278 239 178 173 282 268 180 211 152 155 149 98 283 174 185 242 184 297 237 311 214 133 133 244 149 322 159 249 166 178 -9 208 216 264 198 224 -9 209 -9 230 -9 -9 165 235 258 146 320 289 199 229 164 136 172 372 203 181 189 209 168 296 170 179 298 -9 140 176 148 265 119 154 -9 192 208 173 264 296 266 202 188 149 242 202 205 252 135 241 282 201 100 266 204 194 246 167 141 111 141 405 159 192 245 231 203 217 172 135 252 260 137 256 164 -9 240 -9 260 220 151 304 202 185 199 134 111 201 123 249 181 -9 346 305 203 204 300 265 216 -9 173 205 184 146 250 231 231 259 221 
840 83 Surui Brazil AMERICA 126 128 124 135 -9 234 146 124 -9 96 140 -9 148 217 258 231 165 165 218 198 -9 143 249 132 230 -9 190 146 141 207 183 178 158 171 102 172 130 145 170 182 212 185 261 115 150 120 234 245 -9 201 239 96 129 236 196 294 190 113 95 241 192 127 -9 113 163 156 -9 -9 91 132 266 110 -9 157 109 165 240 155 190 133 193 104 143 133 205 246 244 148 182 172 194 150 184 247 132 196 246 200 119 156 -9 197 202 -9 170 -9 181 135 342 176 192 -9 182 156 198 143 244 202 148 200 155 241 159 180 137 224 202 297 255 -9 118 -9 137 170 149 177 202 -9 124 204 254 228 -9 -9 236 149 374 -9 173 204 147 192 173 208 367 204 -9 -9 123 -9 259 -9 116 183 239 -9 201 242 259 -9 153 179 109 277 199 180 -9 196 -9 151 117 -9 191 -9 154 175 308 199 151 237 190 183 177 244 152 249 274 227 -9 248 163 188 289 241 175 274 151 268 224 276 199 253 181 271 108 271 108 278 220 257 84 292 327 241 246 298 170 -9 209 233 278 164 278 239 182 173 282 268 180 211 160 163 141 102 295 174 189 242 184 301 237 311 218 133 129 248 169 322 163 253 174 186 -9 216 216 264 202 224 -9 209 194 230 -9 -9 165 255 258 150 324 289 203 233 164 136 176 372 211 201 197 209 168 296 186 199 298 -9 140 196 148 289 123 154 -9 196 208 173 264 296 262 202 200 153 242 202 205 268 135 245 282 201 100 270 204 198 250 163 149 111 165 405 167 200 -9 235 203 217 176 139 264 264 137 264 164 -9 240 -9 260 220 159 304 204 217 207 138 117 205 129 249 181 -9 346 309 203 216 316 265 224 -9 177 205 184 150 258 231 235 259 221 
840 83 Surui Brazil AMERICA 126 124 124 129 -9 234 140 112 -9 96 140 -9 148 217 258 229 165 165 218 194 -9 143 249 132 230 -9 188 134 141 207 174 178 158 171 102 166 130 145 166 174 208 182 258 115 141 105 231 242 -9 195 221 96 117 230 196 294 190 104 95 238 192 127 -9 113 163 156 -9 -9 91 126 260 107 -9 157 109 156 228 155 190 130 193 104 134 130 202 246 244 142 182 172 179 150 184 247 132 172 246 200 119 152 -9 197 198 -9 162 -9 181 127 326 176 190 -9 178 152 190 139 232 194 140 196 155 237 151 180 137 224 202 269 247 -9 110 -9 137 170 149 157 202 -9 124 200 238 228 -9 -9 232 133 374 -9 173 204 147 192 157 192 367 204 -9 -9 115 -9 259 -9 112 183 231 -9 201 234 259 -9 149 179 109 269 191 176 -9 196 -9 143 109 -9 179 -9 150 163 308 199 151 233 190 183 165 244 152 237 274 211 -9 240 151 180 289 225 171 270 151 264 220 276 199 245 181 271 108 267 108 254 220 253 84 288 323 237 242 286 146 -9 209 233 278 164 278 239 178 173 278 260 180 211 152 155 141 98 283 174 185 242 184 297 237 307 214 125 125 248 149 322 159 249 170 178 -9 208 212 264 198 224 -9 209 170 226 -9 -9 165 235 258 146 320 289 195 229 164 136 172 372 203 181 189 209 168 296 182 191 298 -9 140 176 148 269 119 154 -9 192 208 173 264 296 262 202 188 149 234 202 205 252 135 245 282 201 100 266 200 190 242 163 141 111 141 405 159 200 -9 231 203 217 172 135 252 260 125 256 160 -9 240 -9 260 220 151 304 202 185 207 138 107 201 123 249 181 -9 346 305 203 216 300 265 216 -9 173 205 184 146 250 231 231 259 221 
841 83 Surui Brazil AMERICA 126 128 124 135 -9 234 146 124 186 98 140 120 148 227 258 235 165 165 218 198 193 143 249 144 230 -9 190 146 141 207 -9 182 158 171 102 172 128 145 170 174 208 188 261 115 153 -9 231 245 -9 195 239 96 129 236 196 306 187 113 95 241 192 127 -9 113 163 -9 -9 246 91 126 266 107 -9 157 -9 165 240 155 190 130 -9 104 143 133 205 246 244 148 179 172 194 150 184 247 132 196 246 200 119 156 -9 201 202 162 170 -9 181 135 342 176 192 -9 178 164 198 147 248 202 148 188 159 241 155 172 137 224 206 269 247 -9 118 163 137 170 165 177 202 212 128 208 250 236 -9 -9 228 149 374 -9 193 204 147 192 173 204 367 204 -9 -9 123 218 259 -9 116 187 239 -9 201 242 259 192 157 179 109 277 199 180 -9 196 -9 159 117 -9 191 -9 154 175 324 199 151 249 190 183 177 244 152 249 274 223 -9 236 151 188 289 241 175 274 151 268 224 276 199 253 185 267 108 271 108 278 220 253 104 296 323 241 242 298 170 -9 209 233 286 170 278 239 186 185 286 268 196 211 164 159 153 122 283 198 185 -9 184 305 237 315 218 133 133 248 157 -9 163 253 174 178 -9 212 216 264 202 224 -9 209 194 230 -9 -9 165 239 258 150 320 293 203 233 164 136 172 368 207 181 197 209 176 296 186 199 298 -9 140 176 168 -9 123 154 -9 196 212 177 264 296 266 202 200 153 242 202 205 276 135 249 282 201 100 266 200 198 250 163 161 111 165 405 167 200 257 235 211 217 172 139 252 264 137 260 168 -9 240 -9 260 220 159 304 204 209 207 138 111 205 129 249 181 -9 354 309 211 216 316 265 220 -9 177 205 184 146 258 231 235 259 221 
841 83 Surui Brazil AMERICA 126 124 124 129 -9 228 146 112 180 98 130 120 148 217 258 229 165 165 218 194 191 143 243 132 228 -9 188 144 141 207 -9 176 158 171 102 172 118 145 166 174 208 185 258 115 141 -9 225 242 -9 195 221 96 117 236 196 294 187 113 95 238 192 127 -9 113 160 -9 -9 237 91 126 260 107 -9 157 -9 156 228 155 190 130 -9 104 134 130 205 246 244 139 179 172 194 150 184 247 126 172 246 200 119 156 -9 197 198 162 162 -9 181 127 326 176 190 -9 174 152 190 143 244 194 148 188 159 241 151 164 137 224 202 269 247 -9 118 163 133 170 149 157 202 200 124 208 238 228 -9 -9 228 133 374 -9 173 204 147 192 157 192 367 204 -9 -9 111 214 259 -9 116 187 229 -9 177 234 259 180 149 179 109 269 191 176 -9 196 -9 143 117 -9 179 -9 150 163 308 199 151 237 190 183 173 240 132 225 274 211 -9 232 151 180 289 225 175 270 139 268 220 276 187 253 185 267 108 267 108 254 220 253 96 288 323 237 242 286 146 -9 209 233 278 168 278 239 182 177 282 268 180 211 160 155 149 118 283 182 185 -9 180 301 237 311 214 133 129 240 149 -9 163 249 166 178 -9 208 212 264 198 224 -9 209 170 230 -9 -9 143 235 258 146 320 289 195 229 164 136 172 368 207 181 189 209 168 296 186 179 298 -9 140 176 148 -9 119 154 -9 192 188 177 264 296 262 202 200 149 234 202 201 252 135 241 282 201 100 266 200 190 246 163 149 111 141 405 159 192 249 231 207 217 172 139 252 264 117 256 164 -9 216 -9 260 216 159 304 202 185 199 138 107 199 129 249 181 -9 346 305 203 204 304 265 212 -9 173 205 180 146 250 231 235 259 221 
842 83 Surui Brazil AMERICA -9 128 124 135 -9 234 146 124 -9 98 130 -9 148 223 258 235 177 165 218 194 191 143 249 132 230 -9 190 146 141 207 183 182 158 171 102 172 -9 145 168 174 208 185 261 115 141 120 234 245 -9 201 239 96 129 -9 196 294 190 113 95 241 192 127 -9 119 163 162 266 246 91 126 266 110 -9 157 115 165 240 155 190 133 193 104 143 136 205 246 244 142 182 172 194 150 184 247 132 196 249 200 119 156 -9 197 202 166 170 -9 181 -9 330 176 192 -9 178 156 198 147 248 202 148 -9 155 241 -9 180 137 224 202 309 255 -9 118 163 141 170 165 157 210 212 128 208 250 -9 -9 -9 232 149 374 -9 193 204 -9 192 173 208 367 204 -9 -9 123 218 259 -9 116 175 231 -9 201 242 -9 192 153 179 109 269 191 180 -9 200 -9 159 117 -9 191 -9 154 171 -9 225 151 -9 190 187 177 244 152 237 278 227 -9 248 151 188 289 241 175 274 147 268 224 -9 199 245 -9 271 108 -9 108 278 -9 253 104 296 327 241 246 294 154 -9 213 233 298 164 282 239 182 177 286 268 196 211 160 159 149 104 295 198 -9 -9 184 297 237 315 218 137 133 248 157 322 163 257 170 186 -9 216 216 -9 202 224 -9 209 170 230 -9 -9 165 255 266 158 324 -9 199 229 164 136 172 368 207 181 201 209 168 296 -9 199 298 -9 144 -9 148 289 123 154 -9 196 212 173 264 296 266 202 200 -9 242 202 -9 268 151 245 282 201 100 270 200 194 250 -9 141 111 165 405 167 200 257 235 207 217 172 139 252 268 137 256 164 -9 240 -9 -9 220 159 304 204 217 207 138 111 205 129 249 181 -9 366 309 211 216 304 265 224 -9 177 205 184 146 258 231 235 259 221 
842 83 Surui Brazil AMERICA -9 124 124 129 -9 234 140 112 -9 98 130 -9 148 217 258 229 165 165 218 188 187 143 243 132 228 -9 188 144 141 207 174 176 158 171 102 172 -9 145 166 174 208 182 258 115 141 105 225 242 -9 195 221 96 117 -9 196 294 190 104 95 238 192 127 -9 113 160 156 263 237 91 126 260 107 -9 157 109 165 228 155 190 130 193 104 134 130 205 246 244 139 179 172 179 150 184 235 132 172 246 200 119 156 -9 197 202 158 162 -9 181 -9 326 176 190 -9 174 152 190 139 232 194 140 -9 155 241 -9 180 137 224 202 301 247 -9 110 163 137 170 157 157 202 200 124 208 238 -9 -9 -9 228 133 374 -9 173 204 -9 192 157 192 367 204 -9 -9 111 214 259 -9 116 175 231 -9 177 234 -9 180 149 179 109 269 191 176 -9 196 -9 151 109 -9 179 -9 126 163 -9 199 151 -9 190 183 173 244 132 233 274 211 -9 236 151 176 289 241 171 270 139 268 220 -9 195 245 -9 267 108 -9 108 254 -9 253 84 288 319 237 242 286 146 -9 209 233 278 164 278 239 178 173 282 268 180 211 152 155 141 102 283 182 -9 -9 180 297 237 311 214 133 129 240 149 322 163 249 166 178 -9 204 216 -9 198 220 -9 209 170 230 -9 -9 143 235 258 158 320 -9 199 229 164 136 172 368 203 181 185 209 168 296 -9 179 298 -9 140 -9 148 265 123 154 -9 192 188 173 264 292 262 202 188 -9 234 198 -9 252 135 241 282 201 100 266 200 194 246 -9 141 111 141 405 159 200 245 231 203 217 172 139 252 264 125 256 160 -9 240 -9 -9 220 159 304 204 185 207 138 111 201 129 249 181 -9 346 309 203 216 300 265 212 -9 173 205 184 146 258 231 235 259 221 
843 83 Surui Brazil AMERICA 126 124 124 135 156 234 150 124 186 98 130 120 148 223 258 231 177 165 218 198 187 149 249 132 204 206 190 144 119 207 183 182 162 173 104 172 130 145 172 180 208 185 258 115 141 120 234 245 271 216 221 96 129 230 199 294 187 113 95 238 192 127 132 119 160 156 266 246 91 129 260 107 155 157 115 165 240 152 190 133 193 104 137 136 205 246 244 142 179 172 179 150 184 247 135 196 249 200 122 156 250 197 206 166 166 259 185 127 -9 176 192 207 180 164 190 147 240 194 148 192 159 237 159 180 137 232 202 301 255 155 130 155 137 170 165 161 202 212 140 208 254 236 121 228 236 145 382 183 193 204 155 196 157 208 367 216 153 260 119 218 259 234 116 183 243 140 201 242 259 192 153 179 109 -9 199 184 143 200 157 151 117 212 199 142 154 171 324 241 159 249 190 183 169 260 152 245 274 227 116 248 155 188 293 245 175 274 151 268 224 276 199 249 185 263 108 263 108 278 220 269 100 292 327 233 246 286 166 202 209 233 286 164 282 239 182 185 282 260 188 211 164 163 145 104 287 182 193 250 184 301 249 315 222 133 133 248 169 322 163 253 170 178 146 204 -9 264 202 224 278 223 170 230 180 304 -9 -9 262 150 320 289 199 265 164 136 176 372 211 189 201 221 180 296 186 195 306 275 140 176 168 289 119 154 191 196 212 173 264 296 266 202 200 149 242 202 209 256 135 245 282 201 100 270 208 194 242 167 153 111 161 405 163 200 249 243 203 225 176 131 260 264 137 264 164 138 240 233 260 204 159 304 198 209 207 134 119 205 129 249 187 117 354 309 211 216 304 265 224 206 177 205 184 146 254 227 235 267 221 
843 83 Surui Brazil AMERICA 126 124 124 129 142 232 140 124 186 98 130 114 148 223 258 231 165 165 218 194 175 143 243 132 204 200 188 134 119 203 183 176 158 171 102 166 126 145 170 174 208 182 249 115 141 108 231 242 271 216 221 96 117 230 196 294 187 113 95 238 192 124 132 113 157 150 254 234 91 126 257 107 155 157 112 156 228 152 190 130 193 98 134 133 202 243 244 139 179 160 179 150 184 247 132 172 246 200 119 152 246 197 202 166 162 251 185 127 -9 176 190 207 178 152 190 143 232 194 144 192 155 233 151 172 137 224 202 273 247 151 110 151 129 170 149 157 202 212 124 204 238 228 121 228 228 133 374 183 193 204 147 192 157 192 351 204 145 260 115 218 259 234 116 175 231 132 193 242 255 192 149 179 109 -9 191 180 131 200 149 151 117 212 191 142 150 163 320 215 155 237 190 183 169 260 132 237 274 211 112 240 151 184 289 241 175 270 147 264 220 268 183 245 181 263 108 263 108 242 220 253 84 292 323 233 242 286 146 198 209 229 278 164 278 223 178 173 282 260 184 211 148 159 141 98 287 174 185 242 180 297 237 307 214 125 129 248 157 322 163 249 166 178 146 204 -9 260 202 224 274 209 170 226 172 300 -9 -9 258 138 320 289 199 229 164 132 168 368 203 185 197 209 168 296 186 179 306 275 136 176 148 269 119 154 191 192 212 173 264 296 266 202 188 141 242 202 201 252 135 245 274 197 100 270 200 194 242 163 149 111 141 405 159 200 249 235 203 217 164 123 252 260 125 256 160 138 208 233 260 204 151 304 196 185 199 134 113 201 123 245 181 117 346 309 211 216 304 265 212 206 177 205 184 146 250 227 235 259 205 
844 83 Surui Brazil AMERICA 126 128 124 129 156 228 150 124 186 98 130 120 148 227 258 231 177 165 224 198 187 -9 249 132 228 206 188 134 141 -9 183 178 158 175 104 172 -9 145 170 180 208 185 258 115 141 120 231 245 271 216 239 96 117 236 208 294 187 113 95 256 192 127 144 113 160 156 266 246 91 126 260 110 161 157 112 165 228 155 190 130 193 104 137 133 205 243 244 148 184 160 194 150 184 247 135 196 249 200 122 152 250 201 206 166 170 251 185 123 342 176 192 203 180 164 190 147 -9 206 144 196 159 241 159 -9 141 224 202 309 251 147 126 163 137 170 149 157 202 212 124 204 254 228 121 228 228 145 382 187 193 204 155 196 157 200 367 204 157 260 123 218 259 234 116 183 243 136 -9 242 259 180 153 175 113 277 199 184 139 200 153 151 117 212 195 146 150 171 324 219 155 249 190 183 169 260 -9 237 274 231 120 240 155 188 293 245 187 270 151 268 224 -9 195 253 185 267 108 271 108 278 220 257 100 292 323 237 242 294 154 202 213 233 306 174 -9 239 182 185 282 268 196 215 164 163 149 98 291 194 189 246 184 297 249 311 218 133 129 248 149 322 163 253 174 178 146 204 216 264 202 224 278 209 170 226 172 308 169 255 262 150 324 289 203 -9 168 136 172 372 215 185 197 233 176 296 190 179 306 275 140 176 168 289 123 154 191 196 212 173 264 296 270 202 200 153 242 202 205 280 135 245 282 201 120 270 208 198 246 175 161 111 165 405 -9 200 257 235 207 217 176 139 252 264 137 264 164 146 240 241 260 204 159 304 198 217 199 134 113 205 129 249 187 133 374 317 211 216 316 265 216 206 177 205 184 150 258 231 239 267 205 
844 83 Surui Brazil AMERICA 126 128 124 129 156 228 146 112 186 96 130 114 148 217 258 231 171 165 218 194 175 -9 243 132 204 200 188 134 141 -9 183 176 158 173 102 172 -9 145 170 174 208 182 249 115 141 120 225 242 271 213 221 96 117 230 196 294 187 113 95 238 192 124 132 113 160 156 263 237 91 126 257 107 155 157 106 165 228 152 190 130 193 98 134 130 202 228 244 142 179 160 179 150 184 247 126 196 246 200 119 152 246 197 202 158 162 247 181 123 326 168 190 203 174 156 190 147 -9 194 140 192 155 233 155 -9 137 224 202 269 251 147 126 151 133 170 149 157 202 212 124 200 242 228 121 228 228 145 374 187 181 200 147 188 157 200 351 204 157 244 115 218 259 234 112 183 229 132 -9 238 259 180 149 175 105 273 191 180 131 196 149 151 113 204 191 142 146 163 308 215 151 237 190 183 169 244 -9 237 274 223 112 236 151 180 289 241 175 270 147 260 220 -9 187 253 185 263 108 267 108 254 212 257 84 292 319 233 242 294 154 198 209 233 278 170 -9 239 182 185 282 264 180 211 164 159 145 98 287 182 185 242 180 297 245 311 214 133 125 236 149 322 163 249 166 170 146 204 212 248 198 224 278 209 170 226 172 304 165 239 258 150 316 285 199 -9 164 136 172 372 211 181 193 209 168 296 186 179 298 275 136 176 160 289 119 154 191 196 196 169 264 296 266 202 196 153 242 202 201 276 135 245 274 197 100 266 200 194 242 163 149 111 141 405 -9 200 249 235 203 217 172 139 252 260 117 264 164 146 204 233 260 204 151 304 196 185 199 134 107 199 125 245 181 117 346 309 203 180 304 241 212 206 173 205 180 146 250 227 231 263 205 
845 83 Surui Brazil AMERICA 126 124 124 129 156 234 146 122 186 98 142 120 148 217 -9 233 171 165 218 198 193 147 243 -9 230 200 190 146 141 207 183 176 -9 173 102 172 -9 173 170 182 208 182 -9 115 150 120 231 245 277 201 221 96 129 236 196 294 190 113 95 241 195 124 144 119 166 150 254 246 91 132 266 110 158 157 115 165 228 155 205 133 193 107 143 133 205 246 244 148 184 154 194 153 184 247 135 -9 249 200 119 156 254 201 198 166 162 255 185 135 338 176 204 203 180 164 202 143 248 202 144 192 155 241 155 180 137 224 204 273 255 155 126 163 129 170 153 157 210 204 128 208 254 232 121 228 240 145 374 183 193 204 155 192 157 204 367 216 157 264 123 218 259 238 112 183 231 132 193 238 263 192 153 175 121 273 191 180 143 200 149 163 113 212 199 154 154 175 324 241 151 245 190 183 173 244 132 245 274 223 116 240 163 176 297 241 179 274 151 264 220 276 199 -9 185 267 108 271 108 266 220 257 104 292 -9 237 242 294 166 202 -9 233 306 164 278 239 182 185 282 -9 180 215 168 163 149 106 -9 178 189 242 184 305 245 311 218 137 133 244 -9 322 159 253 170 178 162 208 212 264 202 224 286 227 194 230 180 292 143 255 266 158 320 289 199 233 168 136 176 376 215 185 189 209 176 296 190 -9 298 303 140 176 160 269 131 158 191 192 212 177 264 296 266 202 200 153 246 202 209 268 151 245 286 205 100 282 208 198 246 163 153 111 165 405 167 204 249 231 211 217 176 139 260 272 137 256 164 146 244 237 260 204 159 304 -9 209 -9 138 113 205 130 245 187 133 374 297 215 216 304 261 216 210 177 201 184 146 258 231 231 267 205 
845 83 Surui Brazil AMERICA 120 124 124 129 156 228 138 112 186 98 130 120 148 217 -9 229 165 165 216 188 191 143 243 -9 230 184 188 134 141 207 183 172 -9 163 100 172 -9 145 166 180 208 182 -9 115 150 108 225 242 271 195 221 96 126 233 196 294 187 113 95 241 189 124 144 113 163 150 251 246 91 129 260 107 152 151 115 165 228 155 190 133 193 98 143 133 205 246 244 148 182 154 194 150 184 238 126 -9 246 200 119 140 246 201 198 162 162 251 181 127 330 168 196 203 178 156 190 143 244 198 144 188 155 233 155 172 133 220 204 269 247 151 126 155 129 170 149 157 206 204 124 204 254 228 121 228 236 145 374 183 173 204 147 188 157 200 351 204 145 244 115 218 259 238 112 183 229 132 189 238 255 192 153 175 109 269 187 180 131 196 149 143 105 212 191 146 154 171 308 199 151 233 190 183 169 244 132 237 274 215 116 240 151 176 289 225 175 270 151 264 220 276 195 -9 185 267 108 267 108 254 212 257 96 280 -9 233 242 290 146 202 -9 233 278 164 278 239 178 177 278 -9 180 211 164 159 141 98 -9 174 185 242 180 301 237 311 214 125 125 240 -9 322 159 253 166 178 158 204 212 264 198 216 278 209 194 214 180 292 143 239 258 146 320 285 199 229 164 132 172 368 211 181 185 209 168 296 186 -9 298 275 136 176 148 265 123 154 191 192 188 173 264 296 266 202 200 149 242 198 205 252 135 245 282 197 100 270 180 194 242 163 137 111 141 405 159 200 245 227 207 217 164 131 252 264 137 256 164 134 208 233 260 204 151 304 -9 209 -9 134 107 199 125 241 181 133 346 297 211 216 304 261 212 206 173 201 184 146 254 227 231 259 205 
846 83 Surui Brazil AMERICA 128 128 124 -9 142 228 146 116 186 98 130 120 148 227 260 233 173 165 218 198 187 149 243 132 228 206 188 144 141 207 183 176 162 169 104 172 120 173 170 174 212 185 258 115 141 120 234 242 271 195 236 96 126 236 199 294 187 113 101 256 192 127 144 113 166 150 257 246 91 126 260 113 158 157 109 165 -9 155 190 133 193 104 143 136 205 246 244 148 185 166 -9 150 184 247 132 172 246 200 119 152 250 201 198 166 170 251 -9 131 334 176 192 207 178 156 202 147 244 202 152 -9 155 237 159 180 141 224 202 301 255 155 126 155 137 170 165 173 202 212 128 208 254 232 121 228 236 145 374 183 193 204 -9 192 157 200 367 216 161 264 115 222 263 238 116 183 243 140 193 242 -9 180 157 179 113 277 195 184 143 200 149 151 109 212 191 142 154 171 324 225 155 237 190 187 177 260 152 237 274 223 116 248 155 188 293 245 175 274 147 264 220 276 199 253 185 271 108 271 112 278 220 253 100 296 323 237 246 294 166 202 209 233 306 174 278 239 178 185 282 268 188 211 168 163 145 98 291 186 185 250 184 309 241 311 214 133 133 248 169 326 163 257 174 178 158 204 216 268 202 224 282 227 170 230 180 304 157 255 266 142 324 293 203 229 164 136 176 372 211 185 189 209 172 300 190 195 306 275 140 196 168 289 119 154 191 200 212 177 264 296 266 202 204 153 242 202 201 272 135 245 286 -9 100 274 204 194 246 175 153 111 165 405 159 200 249 235 213 217 172 139 252 -9 137 264 164 146 244 233 256 220 167 -9 202 185 199 118 -9 205 123 249 183 129 374 297 211 216 320 265 220 206 173 205 184 146 258 235 235 263 205 
846 83 Surui Brazil AMERICA 120 128 124 -9 142 228 146 112 186 96 130 120 148 223 258 229 165 165 218 198 175 147 243 132 226 200 188 138 119 199 174 172 158 163 102 166 120 145 170 174 208 182 246 115 141 120 231 242 271 195 221 96 117 230 196 294 187 113 95 238 192 124 132 113 160 141 254 234 91 126 257 107 155 151 106 156 -9 155 190 133 193 98 131 133 205 228 244 142 185 160 -9 150 184 235 126 172 246 200 119 152 246 197 198 162 166 247 -9 127 330 176 188 207 178 152 202 147 244 194 144 -9 155 233 151 180 133 224 202 269 255 151 126 151 133 170 149 158 202 212 124 204 246 228 121 220 232 133 374 183 177 204 -9 188 157 192 367 204 157 244 115 222 263 234 112 175 231 132 177 238 -9 180 153 175 109 269 191 184 127 200 149 151 109 204 191 142 150 171 312 199 155 237 190 183 177 244 152 237 274 211 112 236 151 184 289 241 175 270 139 260 220 276 195 245 185 263 108 267 108 254 220 253 84 288 323 237 234 286 154 194 193 233 294 164 274 239 178 173 278 260 180 211 168 159 141 98 287 174 185 242 180 305 237 299 214 133 125 244 149 322 163 253 166 178 146 204 212 264 198 216 274 209 170 226 172 292 157 235 258 138 320 277 199 229 164 132 168 372 211 185 189 209 168 296 182 187 306 275 140 176 148 289 119 154 191 200 184 173 264 296 266 202 204 149 242 202 201 268 135 245 274 -9 100 254 196 194 242 163 137 111 165 405 159 196 249 235 213 217 172 131 252 -9 125 256 160 146 196 233 256 216 151 -9 200 185 199 118 -9 205 123 245 181 117 362 297 211 216 304 261 216 206 173 205 184 138 258 227 231 263 205 
847 83 Surui Brazil AMERICA -9 128 124 129 156 232 150 124 186 -9 130 120 148 227 258 233 177 165 218 196 187 143 243 132 226 206 188 134 141 207 183 176 158 175 104 172 -9 145 170 180 208 185 258 115 141 120 234 245 271 213 239 96 117 236 208 294 187 113 95 256 192 127 144 113 160 156 263 246 91 126 266 107 161 157 112 165 228 155 190 130 193 98 143 133 208 246 244 148 184 160 194 150 184 247 135 196 246 200 119 156 246 201 202 166 170 247 185 127 -9 176 192 203 180 156 202 147 248 202 144 196 159 241 159 180 137 224 202 305 255 151 126 163 133 170 149 173 202 212 140 204 -9 228 121 228 228 145 382 187 193 204 147 196 157 200 367 204 157 260 123 218 263 238 116 183 243 132 193 242 259 192 153 175 113 277 199 184 139 200 153 151 117 212 191 146 150 171 324 215 155 249 190 183 169 -9 152 237 274 223 116 240 151 184 289 265 187 274 151 264 220 276 195 253 185 267 108 271 108 278 220 257 100 296 323 237 242 294 154 202 209 233 306 174 282 239 182 185 282 268 196 215 168 163 145 98 291 186 193 242 184 309 245 311 222 133 125 248 165 322 163 -9 174 178 146 204 216 264 202 224 278 209 170 230 172 308 165 255 258 150 -9 293 199 261 168 136 172 372 215 189 197 209 176 296 186 195 306 275 140 176 168 289 123 154 191 196 212 169 264 296 266 202 196 153 242 202 205 280 135 245 274 197 100 270 208 198 246 175 161 111 165 405 163 200 257 243 213 217 172 139 252 264 125 264 164 146 240 241 260 204 151 304 198 209 199 138 119 205 123 249 187 133 374 317 211 212 320 265 220 206 177 205 184 150 258 235 239 267 221 
847 83 Surui Brazil AMERICA -9 124 124 129 142 228 146 112 186 -9 130 120 148 227 258 231 173 165 218 194 187 143 243 132 204 186 188 134 141 207 174 176 158 169 102 172 -9 145 170 180 208 182 249 115 141 120 225 242 271 195 239 96 117 230 196 294 187 113 95 241 192 127 132 113 160 156 254 246 91 126 257 107 155 157 106 165 228 152 190 130 193 98 134 130 205 246 244 142 179 160 194 150 184 229 126 196 246 200 119 152 246 197 198 166 162 247 181 123 -9 176 190 203 178 156 190 147 244 194 140 196 155 241 155 172 137 224 202 269 251 147 126 159 133 170 149 157 202 212 124 200 -9 228 121 220 224 145 374 183 181 204 147 192 157 200 351 204 157 260 115 218 259 234 116 175 231 132 193 238 259 180 153 175 113 273 199 180 131 196 145 151 113 208 191 142 150 163 312 215 155 237 190 183 169 -9 152 237 274 211 112 240 151 180 289 245 171 270 147 260 220 276 187 253 185 263 108 267 108 278 220 253 84 292 323 237 234 286 154 202 209 233 278 172 278 239 182 173 274 268 180 211 164 163 141 98 287 182 185 242 184 297 237 299 214 133 125 248 149 322 163 -9 166 178 146 204 212 264 198 224 278 209 170 230 172 300 157 255 258 138 -9 289 199 229 164 136 172 372 211 181 185 209 168 296 186 179 306 275 140 176 168 289 119 154 191 192 212 169 264 280 266 202 188 149 234 202 201 268 135 245 274 197 100 266 204 194 242 175 137 111 165 405 159 200 253 235 203 217 172 139 252 264 117 256 164 134 240 241 256 204 151 304 196 185 199 134 113 199 123 245 181 133 346 309 203 180 316 265 212 206 173 205 184 146 258 227 231 259 205 
848 83 Surui Brazil AMERICA -9 128 124 129 156 234 150 124 186 98 130 120 148 223 260 233 165 165 218 198 187 147 249 132 228 206 190 144 119 207 183 182 162 173 102 172 -9 145 172 180 212 182 249 115 141 120 231 245 271 216 236 96 126 230 196 294 187 113 95 256 192 127 132 119 166 156 254 246 91 126 257 113 155 157 115 165 240 155 190 133 193 104 137 133 205 -9 244 142 184 166 197 150 184 247 132 172 249 200 122 156 250 -9 202 166 170 259 185 127 330 176 190 207 180 -9 202 147 244 202 152 192 155 233 159 180 141 232 202 301 255 155 130 155 137 170 165 157 202 212 140 208 254 232 121 228 236 133 382 183 193 204 155 196 157 200 367 216 157 264 119 222 263 238 116 183 243 -9 201 242 259 192 157 179 109 277 191 184 131 200 157 151 117 212 191 142 154 171 320 215 159 249 190 183 177 -9 152 245 274 223 116 240 151 188 289 245 175 274 147 264 224 -9 199 249 185 263 108 271 112 278 -9 253 100 292 327 237 246 294 154 198 209 233 294 174 278 239 178 185 282 260 188 211 168 163 145 104 291 174 193 250 184 309 249 315 222 133 129 248 177 326 163 253 174 178 158 204 216 264 202 224 274 209 170 230 180 304 165 235 258 150 320 293 199 265 164 136 176 372 211 189 201 209 168 300 186 179 306 275 140 196 148 289 119 154 191 200 212 177 264 296 266 202 204 149 242 202 209 272 135 245 274 201 100 274 204 194 242 175 153 111 165 405 163 200 249 235 213 225 176 139 252 268 137 264 164 146 244 233 260 216 151 304 202 209 199 134 119 205 123 245 187 129 362 309 211 216 304 265 220 206 177 205 184 146 258 231 235 267 221 
848 83 Surui Brazil AMERICA -9 124 124 129 142 228 146 112 186 96 130 114 148 223 258 231 165 165 218 198 187 143 243 132 204 206 188 138 119 203 183 172 162 169 102 166 -9 145 170 174 208 182 246 115 141 108 231 242 271 195 221 96 117 230 196 294 187 113 95 238 192 124 132 113 160 141 254 234 91 126 257 107 155 157 109 165 228 152 190 133 193 104 131 133 202 -9 244 139 179 160 179 150 184 235 132 172 246 200 119 152 246 -9 198 166 162 247 177 127 326 176 188 207 178 -9 190 147 240 194 148 188 155 233 151 180 137 224 202 273 255 155 126 155 129 170 149 157 202 212 124 204 246 228 121 228 232 133 374 183 193 204 151 192 157 192 367 204 153 260 115 218 259 234 112 175 231 -9 193 238 259 180 153 179 109 269 191 184 127 200 149 151 109 204 191 142 150 163 312 199 155 237 190 183 169 -9 152 237 274 211 112 236 151 188 289 241 175 274 139 264 220 -9 183 245 181 263 108 263 108 254 -9 253 84 288 323 233 242 286 146 194 209 233 286 164 274 239 178 185 282 260 180 211 164 159 141 98 287 174 185 242 180 301 241 299 214 125 125 248 169 322 163 249 170 178 146 204 212 264 202 216 274 209 170 226 172 304 157 235 258 142 320 289 199 229 164 136 168 368 211 185 189 209 168 296 182 195 306 275 140 176 148 289 119 154 191 196 212 173 264 296 266 202 200 149 242 202 201 252 135 245 274 197 100 270 200 194 242 163 137 111 141 405 159 196 249 235 203 217 172 131 252 264 137 264 164 138 240 233 256 204 151 304 196 185 199 118 113 195 123 245 181 117 354 297 211 216 304 265 212 206 173 205 184 138 250 227 231 263 205 
849 83 Surui Brazil AMERICA 126 128 124 135 142 234 146 112 186 -9 130 114 148 223 258 235 177 165 218 194 193 149 249 132 230 206 190 134 141 207 183 182 158 173 102 172 -9 145 166 182 208 182 258 115 -9 120 234 245 271 195 239 96 129 -9 199 294 187 113 95 241 192 127 138 119 163 156 263 246 91 126 260 110 158 151 115 165 228 155 190 133 193 104 140 136 205 246 244 139 182 160 -9 150 184 247 -9 196 249 200 122 156 250 201 202 166 162 251 181 131 334 176 188 203 180 164 202 147 248 202 144 188 155 241 151 172 137 224 202 309 255 151 126 163 137 170 165 157 202 212 128 208 254 236 121 228 236 149 382 187 193 204 155 192 157 200 367 216 161 264 119 222 259 238 116 175 229 140 201 242 259 192 157 179 109 277 191 184 139 196 149 159 117 212 195 158 150 175 324 219 155 249 190 183 169 -9 152 237 274 223 116 -9 155 188 293 241 175 270 151 268 220 276 195 253 185 271 108 271 108 278 220 253 104 292 323 241 242 286 166 202 209 233 286 164 278 239 182 185 282 268 196 211 168 163 145 104 287 174 193 242 184 309 249 315 214 125 133 248 169 322 163 253 170 178 162 208 216 264 202 224 278 223 194 230 172 308 147 255 258 150 -9 289 199 229 164 132 172 376 211 201 197 221 168 300 -9 195 306 275 140 176 168 289 131 154 191 196 188 181 264 296 270 202 200 153 246 202 209 272 135 245 286 205 116 270 200 194 246 163 161 111 161 405 159 200 257 235 211 217 172 139 252 264 137 264 164 146 216 237 260 220 159 304 204 -9 199 138 113 199 129 245 183 117 354 309 203 216 316 265 224 210 -9 205 184 146 258 235 235 259 221 
849 83 Surui Brazil AMERICA 126 124 124 135 142 228 146 112 186 -9 130 114 148 217 250 231 165 165 218 194 187 147 249 132 204 200 190 134 141 207 174 178 158 169 102 166 -9 145 166 182 208 182 249 115 -9 108 231 242 271 195 221 96 117 -9 196 294 187 113 95 238 192 127 132 113 157 156 239 234 91 126 257 107 155 151 112 165 228 155 190 130 193 98 131 130 205 246 244 139 179 154 -9 150 184 241 -9 172 246 200 119 156 246 197 202 158 162 251 181 123 330 168 188 203 178 156 190 143 240 194 144 188 155 233 151 172 137 220 202 273 247 143 110 151 133 170 165 157 202 204 124 204 250 232 121 228 224 133 374 183 173 204 151 188 157 192 351 204 153 244 115 218 259 234 116 175 231 132 201 238 259 180 149 175 109 273 187 184 127 196 149 143 105 212 179 142 126 163 308 199 151 237 190 183 169 -9 132 237 274 223 116 -9 151 176 289 241 175 270 139 268 220 276 183 245 181 267 108 271 108 278 220 253 104 288 319 237 234 286 146 202 189 229 278 164 278 239 178 173 282 268 184 211 160 163 141 98 283 174 185 242 180 297 237 299 214 117 125 244 169 322 163 253 166 178 154 204 212 260 202 224 278 209 170 226 172 300 143 239 258 146 -9 289 199 229 164 136 172 368 203 185 189 209 168 296 -9 179 298 275 140 176 148 269 119 154 191 196 184 177 264 280 266 202 188 149 246 198 201 256 135 245 282 201 100 266 200 194 242 163 149 111 141 405 159 200 249 235 203 217 172 139 252 264 125 256 164 138 204 233 256 216 151 304 196 -9 199 134 111 199 123 241 181 117 346 301 203 216 300 261 212 206 -9 205 184 146 254 231 235 259 221 
850 83 Surui Brazil AMERICA -9 128 124 135 156 234 140 124 186 98 140 120 148 223 260 235 177 165 218 194 187 143 249 144 228 200 190 134 141 -9 174 182 158 173 102 172 -9 145 168 174 208 188 261 115 141 120 -9 245 277 195 239 96 126 236 196 294 190 113 95 241 192 127 144 119 163 156 263 246 91 132 266 110 161 157 115 165 228 155 190 133 193 104 140 136 205 246 244 142 179 172 194 150 184 247 132 196 246 200 119 152 254 201 202 166 170 251 181 -9 338 176 192 207 178 164 198 143 248 202 148 196 155 241 159 180 137 224 202 269 255 155 118 163 137 170 165 177 210 212 128 204 250 225 -9 228 -9 149 382 187 181 204 147 192 173 204 367 204 145 260 123 222 259 234 116 175 239 140 201 238 259 192 157 179 109 277 -9 180 131 196 153 143 117 212 179 154 154 171 320 199 151 249 190 187 169 244 152 237 274 223 116 248 -9 180 289 265 175 274 151 268 220 276 199 253 185 267 108 271 108 278 220 257 104 296 323 241 246 298 146 202 213 233 278 170 278 239 182 185 282 -9 180 211 156 159 149 102 283 -9 189 242 184 305 237 311 218 133 133 244 169 322 163 257 174 186 162 216 216 264 202 224 278 209 170 230 -9 304 165 239 266 158 324 293 203 233 164 136 172 368 211 201 201 209 168 296 186 191 302 275 144 196 168 265 119 154 191 192 208 177 264 296 270 202 188 153 242 202 205 268 135 249 282 201 100 270 200 194 246 167 149 111 141 405 167 200 249 235 211 -9 172 139 264 268 137 264 -9 146 240 233 260 220 159 304 204 209 207 138 117 205 129 249 181 117 346 309 203 -9 316 265 224 206 177 205 -9 146 258 231 239 259 221 
850 83 Surui Brazil AMERICA -9 124 124 129 142 228 140 112 180 98 130 120 148 217 258 229 165 165 218 188 175 143 243 132 228 184 188 134 141 -9 174 176 158 171 102 172 -9 145 166 174 208 182 261 115 141 105 -9 242 262 195 221 96 117 230 196 294 187 104 95 238 192 127 141 113 163 156 257 237 91 126 260 107 155 157 106 156 228 155 190 130 193 104 140 130 202 246 244 139 179 172 194 150 184 235 132 196 246 200 119 152 250 197 198 158 162 247 181 -9 330 176 190 191 178 164 190 143 244 194 148 188 155 237 155 164 137 224 202 269 247 151 110 151 129 170 157 177 210 208 124 200 242 225 -9 228 -9 145 382 183 173 204 147 192 157 192 367 204 145 240 115 218 259 234 112 175 231 136 177 234 259 180 149 175 109 273 -9 176 131 196 153 151 109 208 179 142 154 163 308 199 151 249 190 183 165 240 152 233 274 211 112 240 -9 180 289 225 175 270 147 264 220 276 195 245 181 267 104 263 108 254 220 257 96 288 323 241 242 286 146 202 189 233 278 164 278 239 178 173 282 -9 180 211 152 155 141 98 283 -9 185 242 184 297 237 307 214 133 129 240 149 322 159 249 170 178 158 208 216 264 202 220 278 209 170 226 -9 300 165 239 258 158 320 289 199 229 164 136 172 368 203 181 189 209 168 296 170 179 298 275 140 176 148 265 119 154 191 192 208 173 264 296 262 202 188 149 242 202 201 252 135 241 282 201 100 266 200 190 242 163 141 111 141 405 167 200 245 231 207 -9 172 135 252 264 125 256 -9 138 216 233 260 216 151 304 202 185 199 134 111 199 129 249 181 117 346 305 203 -9 316 265 216 206 173 205 -9 146 250 231 235 259 221 
851 83 Surui Brazil AMERICA 126 128 124 135 156 234 140 -9 186 98 130 120 148 217 258 235 175 165 218 -9 187 147 243 132 230 200 188 146 141 207 -9 178 158 171 102 172 -9 173 170 180 212 188 261 115 141 120 234 242 277 195 239 111 129 236 196 294 190 113 95 241 192 127 144 119 166 150 263 246 91 132 260 107 161 157 115 165 240 155 190 133 193 104 134 133 205 246 244 148 182 172 194 150 184 247 135 196 246 200 119 156 254 197 202 166 170 251 181 135 338 176 196 207 182 164 190 147 248 202 148 196 159 241 159 180 141 224 202 -9 247 155 126 163 137 170 153 173 210 204 128 208 250 228 121 228 236 149 374 187 181 204 155 192 -9 208 351 216 157 264 123 218 259 238 116 183 239 136 201 242 259 192 157 175 121 -9 195 184 143 200 153 159 109 212 191 154 154 175 324 225 151 249 190 183 177 244 152 237 278 227 116 248 155 184 293 265 175 274 139 268 220 276 199 245 185 271 108 271 108 278 220 257 104 288 327 241 242 294 -9 202 213 233 286 168 282 239 182 177 278 268 -9 211 168 163 145 106 287 174 189 242 184 305 237 311 214 133 125 248 169 322 163 257 170 178 162 216 -9 264 202 -9 286 209 194 -9 180 300 165 239 266 158 320 289 199 233 164 136 172 376 211 201 189 209 168 304 186 179 306 275 140 176 148 289 123 154 191 196 208 177 264 296 266 202 188 149 246 202 205 276 135 -9 286 205 100 270 208 198 246 163 153 111 -9 405 167 200 249 235 213 217 176 139 252 264 125 256 164 146 240 237 260 220 167 304 204 217 207 138 111 203 129 249 181 133 354 309 215 216 308 265 212 210 177 205 184 150 258 235 239 259 221 
851 83 Surui Brazil AMERICA 126 128 124 129 142 234 138 -9 186 96 130 120 148 217 258 231 165 165 218 -9 175 143 249 132 228 200 188 134 119 207 -9 176 158 169 102 166 -9 145 166 174 208 182 261 115 141 120 225 242 271 195 221 96 117 230 196 294 187 113 95 241 192 127 141 113 160 150 254 246 91 126 260 107 155 151 106 165 228 155 190 133 193 98 131 133 202 246 244 142 179 154 194 150 184 238 132 196 246 200 113 156 246 197 198 158 170 247 181 123 334 176 190 191 178 152 190 143 244 198 144 188 155 241 155 172 137 220 202 -9 247 151 118 151 133 170 149 173 202 200 124 204 246 228 121 228 228 145 374 183 177 204 147 188 -9 192 351 204 145 244 115 214 259 234 112 183 229 132 177 238 255 192 153 175 109 -9 187 180 131 196 149 143 105 212 179 142 150 163 308 199 151 233 190 183 169 240 132 233 274 211 112 248 151 172 289 241 175 274 139 264 220 276 195 245 185 267 108 271 108 254 220 253 84 280 323 237 242 286 -9 202 209 233 278 164 278 239 182 173 278 268 -9 211 152 155 141 98 283 174 185 242 184 297 237 311 214 125 125 244 149 322 163 253 170 170 154 208 -9 260 202 -9 278 209 170 -9 172 292 143 235 262 146 320 285 195 229 164 132 172 372 207 181 185 209 168 296 170 179 302 275 136 176 148 265 119 154 159 192 188 173 264 292 262 202 188 149 242 202 201 276 135 -9 282 201 100 254 200 190 242 163 137 111 -9 405 159 200 245 235 203 217 172 139 252 260 125 256 164 146 216 233 260 220 159 304 202 209 199 134 107 201 129 241 181 117 346 297 211 216 304 261 212 206 177 201 184 146 254 231 235 259 221 
852 83 Surui Brazil AMERICA 126 128 124 135 142 228 150 124 186 98 130 120 148 227 260 231 177 165 218 194 187 143 249 134 230 206 188 144 141 207 183 178 158 173 102 172 -9 145 170 180 208 182 258 115 141 120 234 245 271 216 239 96 117 236 196 294 187 116 95 238 192 127 144 113 166 156 -9 246 91 126 257 113 155 157 115 165 228 152 190 130 193 104 143 136 205 246 244 142 184 160 194 150 184 247 135 196 249 200 122 152 250 201 202 158 170 251 185 135 338 176 196 203 180 156 202 143 244 198 144 192 155 241 151 172 137 224 202 309 -9 151 126 151 137 170 149 173 202 212 128 204 254 228 121 228 -9 145 374 187 181 204 155 192 173 200 367 216 157 260 123 218 259 234 116 183 243 140 193 242 259 180 153 179 109 273 195 180 139 196 149 151 117 212 191 146 154 175 328 199 155 237 190 187 173 244 152 237 274 231 124 248 -9 184 293 241 187 -9 -9 260 224 276 199 253 185 271 108 267 108 278 220 253 104 292 323 241 246 294 170 202 213 233 306 174 282 239 182 185 282 268 196 215 160 163 145 100 295 182 189 242 180 305 237 311 222 133 133 248 157 322 163 249 170 178 146 204 216 264 202 224 278 223 170 230 172 304 165 255 262 150 324 289 203 265 164 136 176 372 215 185 197 233 176 296 190 187 306 275 140 196 168 289 131 154 191 196 212 173 264 296 270 202 200 153 242 202 205 280 135 249 282 201 116 270 208 -9 242 175 161 111 141 405 163 200 257 235 207 217 176 139 252 264 137 264 164 146 244 241 260 216 167 304 202 217 199 -9 111 205 129 249 -9 133 374 313 211 216 304 265 216 206 177 205 184 150 258 231 239 267 221 
852 83 Surui Brazil AMERICA 126 124 124 129 142 228 146 124 186 98 130 120 148 223 258 231 171 165 218 194 187 143 243 132 228 200 188 134 141 207 183 176 158 173 102 172 -9 145 166 174 208 182 249 115 141 120 231 242 271 195 221 96 117 230 196 294 187 113 95 238 192 124 132 113 160 150 -9 237 91 126 257 107 155 157 109 165 228 152 190 130 187 98 134 133 205 228 244 139 179 154 179 150 184 247 126 196 246 200 119 140 246 197 202 158 162 251 181 127 338 168 192 203 178 152 190 139 244 194 144 192 151 233 151 172 137 224 202 269 -9 147 110 151 133 146 149 161 202 208 124 204 242 228 121 228 -9 145 374 187 173 204 147 188 157 192 367 212 145 244 115 218 259 234 116 175 231 128 189 238 259 180 149 175 109 269 195 176 135 196 149 151 113 204 191 142 146 163 308 199 151 233 190 183 169 240 152 237 274 211 112 240 -9 184 289 241 175 -9 -9 260 220 268 187 245 181 267 108 263 108 242 220 253 100 288 319 237 242 294 166 198 209 233 278 170 274 223 178 177 282 268 184 211 152 159 141 100 291 182 185 242 180 305 237 311 214 125 125 236 149 322 163 249 166 170 146 204 216 260 198 224 274 209 170 226 172 300 165 235 258 150 316 285 199 233 164 132 172 368 203 181 197 209 168 296 186 179 298 275 140 176 160 289 119 154 191 196 212 173 264 296 266 202 196 153 242 202 201 252 135 245 274 201 100 270 208 -9 242 163 149 111 141 405 159 200 245 235 203 217 176 131 252 260 117 264 160 138 208 233 260 204 151 304 198 185 199 -9 107 205 124 241 -9 117 346 301 211 216 304 241 212 206 177 205 180 146 250 231 231 259 221 
702 81 Colombian Colombia AMERICA 120 128 142 133 142 230 140 124 186 100 130 120 148 227 258 241 177 165 218 196 187 149 249 136 230 -9 188 138 139 -9 -9 172 162 173 108 166 126 145 168 180 208 188 249 115 153 -9 228 239 277 207 221 96 126 233 205 306 190 113 95 256 195 121 138 119 163 156 251 246 91 132 260 113 155 157 115 165 240 155 202 130 -9 104 143 133 205 246 244 -9 184 166 197 150 184 247 135 187 252 200 119 156 -9 201 198 158 166 255 181 131 342 168 190 195 180 156 202 143 244 202 152 200 159 -9 159 176 137 224 206 313 251 155 126 155 137 170 161 169 206 208 128 208 246 232 145 228 228 145 382 187 177 204 147 192 201 200 359 220 165 260 119 214 259 234 116 183 225 140 193 242 263 184 153 183 109 281 199 184 143 200 157 147 117 212 191 158 142 175 320 225 155 241 194 187 173 260 152 249 278 227 120 244 151 188 297 257 171 270 151 264 224 276 203 253 189 275 104 263 116 286 224 273 108 296 327 249 246 298 158 198 185 237 294 164 278 239 178 177 282 264 188 223 156 167 145 106 287 178 189 246 180 301 245 311 222 137 137 248 169 322 163 -9 166 182 162 212 216 264 202 224 278 209 194 230 184 -9 143 235 266 146 324 289 203 229 168 136 184 376 215 209 197 225 164 296 186 199 302 303 140 -9 160 -9 131 158 199 192 184 177 268 300 270 206 196 -9 242 202 201 280 135 249 282 201 100 274 208 -9 246 175 137 111 149 405 163 204 257 235 207 217 176 131 264 264 133 -9 164 134 240 237 -9 204 151 312 202 221 203 138 111 213 123 253 191 129 362 309 203 216 316 265 216 218 181 209 184 150 262 235 235 267 237 
702 81 Colombian Colombia AMERICA 120 124 124 129 142 228 140 112 186 98 130 120 148 217 258 241 165 165 218 194 187 143 245 134 228 -9 186 138 119 -9 -9 172 158 173 98 166 126 143 166 180 208 185 249 115 153 -9 228 239 271 195 221 96 117 230 196 294 187 113 95 238 192 121 138 116 163 156 239 234 91 132 257 110 155 154 106 165 228 155 190 127 -9 104 128 133 202 246 244 -9 184 160 179 150 184 247 135 172 249 197 113 140 -9 201 198 158 162 251 181 127 334 168 190 195 174 156 190 143 240 194 140 184 155 -9 159 176 129 224 206 273 247 147 114 155 137 170 161 169 202 204 124 208 238 228 129 224 224 133 370 183 173 204 147 188 157 200 351 216 165 256 119 214 255 230 116 175 225 136 189 238 251 184 145 175 109 269 187 176 139 196 145 143 105 210 187 142 126 171 308 199 151 237 190 183 173 244 148 233 274 207 112 236 151 180 289 241 163 270 151 260 220 268 199 253 189 247 104 263 108 274 220 257 100 292 323 233 242 294 138 194 185 237 282 164 274 239 178 177 278 260 180 211 156 159 145 98 283 174 189 246 160 297 245 303 222 133 121 248 149 322 155 -9 162 178 158 204 216 264 198 224 278 209 170 226 180 -9 143 235 262 146 320 289 199 229 160 132 176 372 211 201 197 209 164 296 182 179 294 299 140 -9 148 -9 131 154 191 176 184 169 264 296 262 202 188 -9 242 190 197 280 135 249 274 197 100 274 204 -9 242 163 137 111 141 405 159 200 249 227 205 213 160 123 252 264 125 -9 148 130 216 233 -9 204 151 304 202 185 203 126 111 213 123 245 191 129 350 309 203 180 316 245 216 206 173 205 184 146 258 227 231 259 205 
703 81 Colombian Colombia AMERICA 120 128 146 129 156 230 140 118 182 108 142 120 148 225 258 231 173 165 218 198 187 149 251 132 224 200 190 146 139 207 183 184 162 173 112 166 130 173 168 180 208 188 255 115 150 108 -9 239 274 207 221 102 129 236 196 294 190 116 95 241 198 127 141 119 163 153 251 246 91 135 266 107 155 157 109 165 240 155 190 130 193 104 146 133 205 246 241 139 179 160 206 150 190 250 132 193 252 200 119 152 254 205 198 162 170 247 185 127 350 168 190 207 180 168 206 147 248 194 144 196 155 237 155 176 137 200 206 273 259 155 134 155 153 166 157 173 206 208 128 220 238 228 141 224 232 153 374 187 181 204 -9 192 193 200 355 212 157 264 119 214 259 234 120 183 231 -9 205 234 255 180 153 183 109 273 191 184 139 208 157 143 121 214 195 162 146 175 324 199 163 241 194 187 173 256 140 237 274 227 120 240 -9 180 297 249 175 274 155 268 220 276 199 257 185 255 108 263 104 278 216 261 108 292 323 249 246 298 162 198 209 233 290 164 274 239 178 185 282 264 188 219 168 155 145 100 287 194 193 250 180 309 249 303 222 129 129 248 169 322 163 253 174 182 158 212 216 268 202 232 278 227 202 230 -9 308 143 239 266 138 320 289 199 257 168 136 176 372 203 189 197 221 184 296 186 199 294 299 144 196 172 269 135 162 199 200 208 177 264 296 258 198 188 153 242 198 209 280 135 249 286 205 120 254 208 202 254 163 157 111 141 405 167 196 249 235 207 217 176 135 260 268 125 264 152 134 240 241 260 204 151 304 208 221 -9 134 107 203 129 253 191 133 358 313 203 212 316 249 216 206 181 205 -9 146 258 235 231 263 209 
703 81 Colombian Colombia AMERICA 120 124 124 129 142 226 140 112 180 98 142 114 148 217 258 229 147 165 218 194 187 147 247 128 204 186 188 134 119 205 183 172 162 171 110 166 126 147 168 174 208 188 249 115 141 108 -9 239 274 195 221 96 117 230 196 294 190 116 95 238 192 127 132 116 160 153 251 237 88 123 260 107 152 151 109 156 228 155 190 130 187 104 143 133 205 246 241 139 179 160 194 150 190 238 129 172 252 197 119 140 246 197 198 158 162 235 185 127 334 168 188 199 180 160 190 143 244 194 144 192 151 233 155 172 129 200 202 265 251 151 126 155 137 166 146 157 202 204 124 208 238 224 121 220 228 137 370 183 177 204 -9 188 153 196 347 204 153 248 115 214 259 234 120 183 225 -9 193 234 251 180 153 179 109 273 191 176 131 196 153 135 117 212 191 146 146 171 320 199 159 237 194 187 173 256 140 233 270 215 108 240 -9 172 289 241 171 274 147 260 220 276 195 241 185 251 104 263 104 278 212 253 84 292 323 237 242 290 158 190 181 233 282 164 274 223 174 177 274 260 184 207 164 155 141 98 287 182 185 246 160 297 241 303 210 117 125 244 169 318 159 253 170 182 158 204 216 264 198 212 266 217 174 226 -9 304 143 235 262 138 320 257 199 233 164 132 172 368 203 185 197 221 172 292 182 179 294 275 136 188 152 269 127 154 187 192 184 173 264 292 254 194 188 145 242 198 209 256 135 249 282 197 100 254 200 198 242 159 137 111 141 405 159 192 245 235 199 201 164 127 252 264 121 256 152 130 240 237 260 204 151 304 196 217 -9 118 107 199 125 245 181 129 350 301 203 204 316 245 212 206 173 201 -9 138 254 231 227 259 201 
704 81 Colombian Colombia AMERICA 126 128 146 129 156 228 150 124 186 98 134 120 150 227 258 231 173 167 218 194 187 143 249 132 230 184 192 146 141 207 183 176 158 173 102 172 120 145 170 182 -9 185 255 115 147 120 234 239 271 210 239 96 132 236 199 294 190 113 95 259 195 130 132 119 163 -9 251 246 91 135 263 110 158 157 115 165 240 155 190 133 193 104 140 139 205 246 244 139 182 166 194 150 190 238 135 193 249 200 119 156 254 197 166 162 162 259 -9 127 334 176 194 203 178 160 202 143 244 206 144 196 155 241 155 180 137 220 214 309 251 155 130 155 137 170 157 173 202 212 144 204 242 232 141 228 236 149 374 183 181 204 163 192 161 204 359 216 157 268 116 218 259 234 120 187 239 -9 185 234 255 180 153 183 117 281 195 180 143 196 157 163 117 212 191 146 126 175 320 211 151 245 194 187 173 256 148 237 278 -9 124 244 151 -9 293 245 171 274 159 264 224 272 199 245 185 267 108 267 108 278 224 257 108 296 327 241 238 298 170 202 189 237 302 168 278 239 178 189 278 260 188 207 156 159 145 -9 287 194 193 250 188 309 249 307 218 133 133 248 161 322 167 257 170 182 162 208 216 264 198 232 286 223 178 234 -9 304 143 239 266 146 320 289 203 233 168 136 172 372 211 193 197 229 172 296 194 195 298 303 136 196 164 289 131 166 195 200 184 177 272 296 -9 202 196 153 242 202 209 280 151 245 282 201 116 282 204 198 242 167 153 111 165 405 163 200 257 235 203 213 172 135 260 276 137 256 164 -9 240 233 260 204 151 304 202 229 203 126 121 203 -9 249 183 133 370 309 203 208 320 265 216 210 173 205 184 138 254 231 235 271 217 
704 81 Colombian Colombia AMERICA 126 124 144 129 156 228 140 124 182 98 134 114 148 217 258 229 165 167 218 194 183 143 243 128 228 184 188 144 119 207 183 176 158 171 100 172 120 145 168 180 -9 182 249 115 141 108 225 239 271 207 239 96 117 218 199 294 190 113 95 238 192 121 132 116 157 -9 251 246 91 126 260 101 155 154 106 165 228 152 190 130 193 104 134 133 205 246 244 139 179 160 179 150 190 238 135 190 246 197 113 152 246 197 202 158 162 255 -9 123 330 168 184 195 172 160 190 143 240 194 144 192 151 233 151 176 133 200 206 273 247 147 122 151 133 170 153 157 202 204 124 204 242 232 137 228 232 145 370 183 173 204 147 188 161 196 343 204 141 264 115 218 259 234 112 175 235 -9 185 234 255 180 153 175 109 277 187 180 135 196 149 151 117 210 191 142 126 171 320 199 151 237 194 187 169 244 148 233 266 -9 116 240 151 -9 293 241 171 274 151 264 220 268 187 241 181 263 104 267 104 266 212 253 108 292 319 233 238 286 166 194 189 233 282 164 278 239 174 189 270 260 188 207 144 155 141 -9 287 182 193 246 180 301 237 307 214 121 125 244 157 322 159 249 166 182 162 204 212 264 198 220 282 217 170 226 -9 304 143 235 262 138 320 257 203 225 168 136 172 372 211 173 193 209 172 296 182 183 298 303 136 176 164 269 131 154 191 192 184 169 264 292 -9 198 188 149 238 194 209 272 135 245 282 201 104 278 204 190 242 163 137 111 161 405 159 196 249 231 201 213 172 123 252 260 121 256 148 -9 208 233 260 204 151 304 202 185 203 126 107 203 -9 249 181 129 350 297 203 180 308 209 212 210 173 205 184 138 250 227 231 267 205 
705 81 Colombian Colombia AMERICA 126 128 124 129 156 234 140 124 186 98 134 120 148 219 262 231 175 165 218 194 187 143 247 132 230 184 192 146 139 211 183 176 158 175 110 172 -9 143 170 182 -9 188 258 115 141 -9 240 242 274 213 239 111 117 236 199 294 190 113 95 256 192 127 138 116 163 156 251 246 91 132 260 110 155 157 109 165 240 155 190 133 193 104 146 133 205 246 244 151 182 160 194 156 184 247 135 199 249 200 119 160 254 201 202 166 166 255 189 131 350 176 196 203 182 160 202 147 244 194 144 192 155 237 155 176 137 216 206 273 251 151 126 155 133 150 157 173 206 204 144 204 254 232 145 228 236 145 382 183 177 204 147 192 157 200 343 204 153 264 115 226 259 234 116 187 243 -9 185 234 263 192 153 175 109 277 199 184 139 196 149 147 117 212 191 150 146 175 324 219 155 249 -9 187 169 260 144 245 274 239 124 240 167 188 297 241 171 258 155 272 228 280 199 253 185 271 108 267 108 278 224 269 108 300 323 237 242 298 166 202 189 237 282 172 274 243 178 189 278 260 192 215 160 167 153 100 287 178 193 254 184 309 245 307 222 129 133 248 169 322 163 257 170 178 158 208 216 264 198 232 282 223 174 226 -9 308 173 239 266 150 328 289 199 229 160 136 172 380 215 189 197 221 192 300 186 179 298 303 144 176 160 -9 131 154 191 196 184 177 272 300 270 202 204 153 242 202 209 268 135 253 282 201 100 278 204 198 250 175 165 111 165 405 167 192 257 235 203 217 160 143 252 268 121 256 152 134 208 233 256 204 151 308 202 221 203 138 115 213 124 249 195 129 350 313 215 204 312 265 216 214 181 209 184 146 254 231 239 275 205 
705 81 Colombian Colombia AMERICA 126 128 124 129 142 230 140 112 182 96 130 120 148 217 258 229 165 165 218 194 187 143 243 128 230 184 188 144 119 201 183 172 158 173 110 166 -9 145 168 182 -9 185 249 115 141 -9 234 239 274 195 221 96 117 230 196 294 184 113 95 238 189 127 132 113 157 150 251 237 91 123 257 107 155 154 106 165 228 155 190 130 193 104 146 133 202 246 227 139 179 160 179 150 184 235 129 172 246 200 119 152 250 197 198 158 162 255 185 127 342 176 192 195 178 152 190 147 244 194 144 188 151 237 155 172 137 200 202 273 247 147 126 151 133 146 153 169 202 204 124 204 242 228 121 228 228 145 374 183 173 204 147 192 149 196 343 204 141 264 111 214 259 230 112 187 219 -9 185 234 255 184 145 175 109 269 187 180 131 184 145 139 109 212 187 142 146 175 308 199 155 245 -9 187 165 260 132 237 270 227 120 240 151 180 289 241 163 258 139 264 220 272 195 253 185 263 104 263 108 270 216 257 108 292 319 233 238 294 154 202 189 237 278 164 266 243 178 177 270 260 188 215 152 155 141 98 283 178 193 246 160 305 245 287 222 129 133 244 157 322 159 257 170 178 150 204 216 260 198 220 278 209 174 226 -9 304 173 239 258 146 316 289 199 225 160 136 172 372 211 189 185 209 168 296 170 179 282 299 132 176 160 -9 127 154 191 188 184 177 264 296 262 194 200 149 242 194 201 268 135 249 282 201 100 266 204 198 246 163 165 111 141 405 159 192 249 227 203 213 160 135 252 264 121 256 148 130 208 229 252 204 151 304 196 185 203 138 107 205 123 241 195 117 346 297 203 180 312 245 216 206 173 201 180 146 250 227 227 255 205 
706 81 Colombian Colombia AMERICA 128 128 146 129 142 234 140 118 182 98 134 120 148 225 262 233 165 -9 218 194 187 -9 249 132 230 186 192 144 141 211 183 172 158 175 110 172 130 145 168 182 -9 185 258 115 141 120 234 242 274 213 239 111 117 236 196 294 190 113 98 256 195 127 144 119 166 -9 251 237 91 132 266 110 155 157 112 165 228 155 205 133 193 104 146 133 205 246 244 151 182 160 194 150 184 247 135 199 249 200 119 152 254 205 202 166 162 259 185 131 342 176 200 207 178 152 202 147 244 206 144 188 155 237 155 176 141 228 210 273 247 151 130 155 137 166 161 173 206 204 144 204 242 232 141 228 228 149 374 183 177 204 147 192 157 200 343 216 157 264 119 218 259 234 116 187 235 -9 193 234 259 192 153 175 113 281 199 192 131 196 149 163 117 212 191 142 146 175 320 211 155 249 198 187 169 260 148 245 274 235 120 240 159 188 301 253 175 258 155 268 228 276 199 253 185 271 108 267 108 278 224 269 108 300 327 237 242 294 154 202 189 237 302 164 274 243 178 185 278 260 188 219 160 167 153 -9 287 186 193 250 176 309 245 307 222 129 133 248 169 322 167 -9 170 178 158 208 216 264 202 232 282 223 174 234 -9 304 173 239 266 150 328 289 203 229 160 136 172 380 211 189 197 221 192 296 178 179 298 303 144 176 160 269 131 158 191 196 212 177 272 296 262 202 204 149 246 194 209 276 135 253 282 201 100 270 204 198 246 167 165 111 165 405 167 200 257 235 203 217 176 139 252 276 121 256 152 134 208 249 256 204 163 304 198 209 203 138 111 213 129 253 195 117 370 309 207 216 312 265 216 210 181 205 184 150 258 235 239 275 225 
706 81 Colombian Colombia AMERICA 126 124 124 129 142 228 140 112 182 96 130 120 148 219 258 229 147 -9 218 194 187 -9 247 132 230 184 192 138 139 199 183 172 158 165 100 172 130 145 166 180 -9 182 249 115 141 120 234 239 274 195 239 96 117 230 196 294 184 113 95 238 192 127 132 113 163 -9 251 237 91 126 257 107 155 154 106 165 228 152 190 130 193 104 137 133 202 237 244 142 179 160 194 150 184 235 135 196 246 200 119 140 246 201 198 158 162 255 181 123 330 176 196 203 178 152 202 143 244 194 144 188 151 233 155 176 137 200 206 273 247 147 126 151 133 146 153 173 206 204 124 204 242 228 121 228 228 145 370 183 173 204 147 192 153 196 343 204 153 244 115 214 255 230 112 179 219 -9 185 234 255 184 153 175 109 269 199 180 131 196 149 139 105 210 191 142 126 163 308 199 155 237 198 187 165 256 144 237 270 227 116 240 151 180 297 241 163 258 151 264 220 272 191 241 185 263 104 263 108 262 224 257 108 292 323 237 238 286 146 194 189 233 278 164 274 219 174 177 270 260 184 215 152 159 141 -9 287 178 193 246 160 309 241 299 218 129 133 244 169 322 163 -9 170 170 150 204 216 260 198 220 278 223 174 226 -9 304 173 239 262 142 320 289 199 225 160 136 172 372 211 181 197 213 184 296 170 179 282 299 132 172 160 265 131 154 183 192 184 177 264 296 258 194 188 149 242 194 209 268 135 249 282 201 100 266 180 186 242 163 137 111 141 405 163 192 249 227 203 213 160 135 252 268 121 256 148 134 208 229 252 204 151 304 196 185 203 138 107 203 124 249 181 117 346 297 203 180 308 245 212 206 173 201 184 146 254 231 235 271 205 
707 81 Colombian Colombia AMERICA 126 128 124 131 156 234 142 124 186 98 134 120 148 227 264 229 175 165 218 194 187 143 247 -9 230 184 190 144 139 203 183 176 158 175 110 172 130 145 172 180 212 191 258 115 150 120 234 242 274 195 221 96 117 236 199 -9 -9 -9 95 256 192 127 138 119 163 156 251 246 94 132 260 110 155 157 109 -9 240 155 190 133 193 113 -9 133 205 246 244 148 182 160 194 150 184 247 135 -9 249 197 119 156 254 201 166 158 162 255 181 131 338 176 196 203 182 160 202 147 244 194 144 188 151 237 155 172 137 228 210 317 251 147 126 155 145 170 157 157 206 208 144 208 250 232 145 228 236 149 382 183 177 200 163 192 161 200 359 216 -9 264 111 218 267 234 116 191 243 140 201 234 255 192 145 179 117 273 199 184 139 196 145 147 109 212 191 146 158 175 320 215 155 245 190 187 173 260 148 245 278 231 120 244 159 172 293 241 175 274 155 268 220 280 199 253 185 271 112 267 104 278 220 253 108 292 323 237 242 294 150 202 197 237 282 168 278 243 178 177 274 260 188 215 160 167 153 106 287 194 193 -9 180 309 245 307 -9 133 133 248 161 322 159 257 170 182 162 212 216 264 202 232 282 223 182 234 180 308 143 239 258 146 320 289 199 233 160 136 180 372 203 189 197 233 192 296 178 187 298 311 144 176 168 265 131 166 191 200 188 181 272 296 274 202 196 153 242 202 205 268 139 249 282 201 116 278 204 198 246 175 165 111 169 405 167 204 253 239 207 217 160 135 252 264 137 256 172 134 240 237 260 220 151 308 202 221 203 138 119 213 124 249 195 133 350 313 211 204 316 249 216 214 181 213 184 146 254 231 239 271 209 
707 81 Colombian Colombia AMERICA 126 128 124 129 142 230 140 120 182 96 130 120 148 217 262 229 165 165 218 194 175 143 243 -9 228 184 188 144 139 199 183 172 158 173 100 166 130 145 170 174 208 191 255 115 141 105 234 239 271 195 221 96 117 230 196 -9 -9 -9 95 256 192 127 132 119 163 150 251 234 91 126 257 110 155 157 109 -9 228 155 190 133 187 104 -9 133 205 243 244 139 182 160 179 150 184 247 135 -9 246 197 119 140 254 201 198 158 162 251 181 127 330 176 190 203 180 152 190 143 244 194 144 188 151 233 151 164 129 200 202 273 247 147 126 151 133 146 153 157 202 204 124 204 242 228 145 224 228 149 378 183 173 200 147 192 153 192 343 204 -9 244 111 218 259 230 112 187 231 132 185 234 255 192 145 179 109 269 191 180 139 196 145 139 105 212 187 142 146 175 308 199 151 237 186 187 165 260 140 237 274 227 112 244 151 172 289 241 163 258 139 268 220 272 195 241 181 263 108 263 104 278 212 253 84 292 319 233 238 294 138 194 189 237 274 164 278 239 178 177 270 260 184 207 152 167 141 98 287 178 193 -9 160 301 245 303 -9 133 125 244 157 322 159 253 170 178 158 204 212 260 198 228 278 223 174 226 180 304 143 235 258 142 316 257 199 225 156 132 172 368 203 189 181 209 180 296 170 179 294 307 144 176 164 265 127 146 191 188 184 173 272 296 262 198 188 149 242 194 201 256 135 245 274 201 100 266 180 170 242 163 137 111 141 405 159 200 245 235 203 217 160 123 252 264 125 256 164 134 208 237 256 204 151 308 202 185 203 126 111 203 123 245 195 133 342 297 203 180 312 241 216 206 177 205 184 142 254 227 235 255 205 
708 81 Colombian Colombia AMERICA 126 128 124 129 156 234 142 124 186 98 140 120 148 227 262 231 175 165 218 194 187 143 247 132 230 202 190 146 139 203 183 174 158 175 110 172 -9 145 172 182 208 191 258 115 141 120 234 242 283 210 239 111 132 236 199 309 190 116 95 256 192 127 138 119 163 150 251 246 94 141 257 110 155 157 109 165 249 155 190 133 193 104 143 133 205 246 244 148 182 166 194 156 184 247 141 196 246 200 119 156 254 205 166 158 162 255 189 127 342 176 196 203 184 156 190 147 244 194 144 -9 151 237 155 172 137 200 210 273 251 151 130 155 133 170 157 173 206 204 144 204 250 236 145 228 236 153 382 183 173 204 163 192 153 200 359 220 153 264 119 218 267 234 120 191 243 132 185 234 -9 192 145 179 109 269 195 184 139 196 149 159 117 212 191 150 158 175 308 219 155 249 190 187 173 260 144 237 274 231 112 244 167 176 293 241 175 270 155 268 220 280 199 253 185 275 112 267 104 278 224 265 108 292 323 233 242 294 162 202 189 237 298 172 278 243 178 177 278 260 188 215 152 167 153 106 287 194 201 250 180 309 245 311 218 133 133 244 161 322 159 257 170 182 158 204 216 264 202 232 282 223 182 234 180 308 143 239 258 150 320 285 199 233 168 136 180 372 211 201 197 233 188 296 186 199 298 311 144 176 168 265 131 154 191 196 208 177 272 300 274 202 196 153 246 202 209 284 135 249 286 201 116 278 180 198 250 175 165 111 169 405 167 204 253 239 203 217 176 -9 260 264 133 264 168 134 208 237 260 220 151 308 202 221 203 138 111 213 129 253 195 133 366 313 203 204 312 269 216 214 181 205 184 146 254 231 239 271 209 
708 81 Colombian Colombia AMERICA 120 128 124 129 142 230 140 112 182 98 134 120 148 227 250 229 175 165 218 194 175 143 247 128 224 184 188 144 139 199 183 172 148 173 100 166 -9 145 170 180 208 185 246 115 141 108 234 239 271 195 221 96 117 233 199 294 187 113 95 256 192 127 132 119 157 150 251 234 91 132 257 107 155 151 106 165 240 152 190 130 187 104 137 133 205 243 244 139 179 160 194 150 184 247 135 190 246 197 119 152 246 201 198 158 162 251 181 127 330 176 190 203 180 152 190 143 244 194 144 -9 151 237 155 164 137 200 202 273 247 147 126 151 133 166 153 157 202 204 120 204 242 228 145 228 228 149 382 183 173 200 147 192 117 192 355 204 153 264 111 218 259 230 112 187 243 132 177 234 -9 180 145 179 109 269 191 180 131 196 145 139 105 212 187 146 146 163 308 199 151 237 190 183 165 260 140 233 270 227 112 244 151 172 289 241 163 258 155 268 220 272 199 241 181 263 108 263 104 278 212 253 84 292 319 233 238 286 150 198 189 237 282 164 274 239 178 177 274 260 180 211 152 155 145 106 287 182 193 246 180 305 245 303 218 129 129 244 157 322 159 257 170 178 158 204 212 260 202 232 278 223 174 234 180 308 143 235 258 146 316 257 199 225 156 136 176 372 203 189 197 209 180 296 170 179 294 275 144 176 148 265 127 146 191 188 184 173 272 296 270 202 188 149 242 198 205 256 135 245 274 201 100 266 180 198 246 163 165 111 141 405 155 192 245 227 203 213 160 -9 252 264 125 256 164 130 208 233 256 204 151 304 202 185 203 134 107 203 124 249 195 129 350 309 203 204 308 249 216 198 181 205 184 146 254 227 227 267 205 
709 81 Colombian Colombia AMERICA 126 128 144 131 156 230 140 124 186 98 134 120 148 227 262 241 175 165 218 194 193 149 251 132 230 184 190 146 119 203 183 176 158 173 100 172 130 147 170 182 208 191 255 115 141 120 234 242 271 210 239 111 117 236 199 306 190 113 95 256 192 127 138 116 157 150 251 237 94 132 260 110 161 157 115 -9 240 155 190 130 193 104 143 139 205 -9 244 151 184 160 194 156 184 247 135 196 246 200 119 156 254 197 202 158 162 255 181 127 350 176 196 207 182 164 190 -9 244 206 144 192 151 237 155 172 137 216 206 305 247 151 126 155 133 170 153 173 202 204 144 204 242 228 145 -9 236 145 382 187 177 204 147 192 149 204 343 208 161 264 111 222 259 234 120 187 243 140 189 238 263 184 149 179 117 273 199 188 139 196 149 159 117 212 187 142 154 171 320 -9 155 245 190 191 169 256 144 245 278 227 120 244 151 172 297 241 175 274 139 268 220 280 195 249 189 271 104 267 108 278 224 257 108 292 323 245 238 294 150 202 197 237 290 168 274 243 178 189 286 260 188 219 160 167 153 98 287 178 193 242 184 309 249 311 222 133 133 248 157 322 159 257 170 182 162 204 216 260 206 232 278 223 174 234 180 308 173 239 266 150 320 285 199 261 164 136 172 376 215 189 201 209 192 296 186 191 294 303 144 188 160 -9 131 158 191 196 184 177 272 296 262 202 200 153 242 202 213 280 139 249 282 205 100 278 204 206 250 175 165 111 165 405 163 204 -9 235 205 225 172 135 256 268 137 256 172 -9 240 237 260 220 151 312 202 185 207 138 121 213 123 249 195 133 358 313 211 216 316 265 216 214 181 209 184 146 254 231 235 263 209 
709 81 Colombian Colombia AMERICA 126 128 124 129 156 226 140 112 182 96 130 120 148 217 250 229 165 165 218 194 191 143 249 130 228 184 190 144 119 199 183 172 156 171 102 166 130 145 166 180 208 188 246 115 141 105 225 242 271 195 221 96 117 230 196 294 187 113 95 256 192 127 132 113 157 141 251 234 91 126 260 107 155 157 112 -9 228 155 190 130 187 104 137 136 202 -9 244 139 179 160 179 150 184 235 135 190 246 200 119 152 254 197 198 158 162 251 181 127 338 168 190 203 180 160 190 -9 236 194 144 192 151 237 155 172 137 216 202 305 247 147 122 151 133 166 153 157 202 204 140 204 238 224 145 -9 228 145 370 183 173 200 147 188 117 192 343 204 141 264 111 218 255 234 112 187 229 140 177 234 259 180 149 175 117 269 191 184 139 184 145 147 109 210 187 142 146 171 320 -9 155 237 190 187 165 256 144 233 278 207 120 240 151 172 293 241 175 258 135 268 220 268 187 241 181 247 104 263 108 278 224 257 100 292 323 233 238 294 138 202 189 237 278 164 274 239 178 189 270 256 184 215 148 159 141 98 283 174 193 242 180 309 249 307 222 129 125 224 157 322 159 253 166 178 150 204 212 260 198 220 266 209 174 226 172 304 173 235 262 146 320 257 199 225 160 136 172 372 215 181 181 209 172 296 178 179 294 275 140 176 152 -9 131 154 187 184 184 165 268 292 258 198 188 149 242 202 213 268 135 249 274 201 100 254 204 202 246 171 137 111 141 405 159 200 -9 227 203 213 160 119 252 260 125 256 148 -9 208 233 256 204 151 308 202 185 207 126 111 203 123 249 183 133 346 305 203 204 312 265 212 206 177 205 176 142 250 231 235 259 205 
710 81 Colombian Colombia AMERICA 126 128 -9 129 156 234 140 124 186 98 130 120 148 227 250 229 175 165 218 194 193 149 245 132 228 202 204 146 139 199 183 176 158 175 102 172 -9 147 168 182 208 188 255 115 141 108 234 242 283 -9 221 111 117 236 199 306 187 113 95 256 192 127 132 113 163 150 251 246 94 141 263 107 161 157 112 165 240 155 190 133 193 113 146 139 202 246 244 139 182 166 194 150 184 247 135 196 246 200 119 156 254 201 -9 158 162 267 189 127 350 -9 196 207 180 160 190 143 236 194 144 192 151 237 155 172 137 216 206 305 247 151 126 155 141 166 161 169 202 204 140 216 254 228 145 228 236 145 382 183 177 204 163 192 157 196 359 216 161 264 115 222 259 234 120 187 243 140 177 238 263 192 153 175 117 273 199 184 139 200 157 159 117 214 191 150 154 171 320 229 -9 249 190 187 169 256 144 245 278 227 120 240 151 180 297 249 175 258 139 268 220 276 195 253 189 271 104 271 108 278 224 257 108 292 323 233 238 298 162 202 205 237 282 172 278 243 178 189 286 260 184 215 -9 159 153 98 287 182 193 246 184 -9 249 311 222 133 133 248 161 326 163 -9 166 182 162 204 216 264 206 232 282 209 182 226 180 304 173 255 266 150 320 285 199 229 164 136 184 372 215 189 201 209 172 296 182 191 302 275 140 176 164 269 131 154 187 192 212 177 272 -9 270 202 188 149 242 202 213 268 139 249 286 -9 100 278 204 206 -9 171 169 111 169 405 167 204 -9 -9 207 213 172 123 260 -9 137 256 172 134 240 233 260 204 167 312 202 185 207 138 111 205 124 249 195 133 350 313 203 204 316 265 216 206 -9 209 184 146 266 231 235 263 209 
710 81 Colombian Colombia AMERICA 126 128 -9 129 142 230 140 112 182 98 130 120 148 227 250 229 173 165 214 194 175 143 251 130 228 184 190 146 119 199 183 172 158 175 100 166 -9 145 166 180 208 185 249 115 141 105 234 242 271 -9 221 111 117 233 199 294 187 113 95 256 192 127 132 113 157 141 251 237 91 126 260 107 155 157 106 162 240 155 190 130 187 104 137 133 202 228 244 139 179 160 194 150 184 235 135 172 246 200 119 152 246 197 -9 158 162 255 181 127 350 -9 190 203 174 156 190 143 232 194 144 192 151 233 155 172 129 200 206 273 247 151 122 151 133 166 153 157 202 204 124 204 238 224 145 224 236 145 382 183 177 204 147 188 149 192 343 208 153 240 111 214 255 230 120 187 229 132 177 238 255 184 149 175 109 269 187 176 139 196 149 139 117 210 187 142 146 171 320 229 -9 237 190 183 165 256 144 233 266 207 112 240 151 172 293 241 163 258 139 260 220 276 183 249 185 263 104 263 108 278 224 257 108 292 323 233 238 294 138 194 197 233 278 164 274 243 178 189 282 260 180 211 -9 155 141 98 283 178 189 242 180 -9 249 287 222 129 125 248 157 322 159 -9 166 178 158 204 212 260 202 224 266 209 174 226 176 304 173 239 262 150 320 257 199 225 156 136 172 372 215 181 197 209 168 296 178 179 294 275 140 176 160 265 119 154 187 184 184 177 272 -9 258 202 188 149 242 202 201 268 135 245 282 -9 100 254 180 198 -9 163 137 111 141 405 159 200 -9 -9 203 213 160 119 252 -9 137 256 148 126 240 233 260 204 151 304 202 185 203 126 107 203 123 249 183 129 346 313 203 204 312 245 216 206 -9 205 180 146 250 227 227 263 209
792 81 Colombian Colombia AMERICA 126 128 -9 133 156 230 140 124 188 96 130 120 148 227 262 241 177 165 218 194 187 149 251 132 230 186 210 138 139 209 183 172 158 173 108 172 126 173 170 180 208 188 249 115 153 108 228 239 271 195 239 96 126 236 205 309 -9 113 95 241 195 127 144 119 163 156 239 246 91 132 260 110 155 157 115 165 240 155 190 133 190 104 137 133 205 246 244 139 184 166 206 156 -9 247 135 193 249 200 119 156 254 201 166 162 166 263 189 131 338 176 196 203 180 160 202 143 244 202 140 200 155 241 159 176 129 224 210 313 255 147 130 155 137 170 161 169 206 208 128 208 246 228 121 228 228 145 374 183 201 204 159 192 201 204 -9 212 165 264 119 214 267 238 116 183 229 136 195 242 263 192 153 187 109 281 195 188 143 200 153 159 121 212 187 158 126 171 320 225 155 241 198 183 173 260 152 245 274 207 120 240 151 188 297 257 171 274 151 264 228 276 199 253 189 275 108 263 104 282 224 257 108 300 327 233 242 298 162 198 193 237 298 164 278 239 182 177 282 264 188 215 156 167 149 106 287 182 197 246 184 301 237 311 222 133 125 248 161 322 159 257 166 182 162 204 216 264 202 224 278 209 174 230 180 304 143 239 262 146 324 289 203 -9 168 132 172 376 215 209 197 225 184 300 186 199 302 299 144 176 164 273 135 166 199 192 184 177 270 300 270 206 188 149 242 202 209 280 135 249 282 -9 116 274 208 194 242 175 -9 111 161 405 163 204 257 243 205 221 172 131 264 -9 125 256 148 134 240 237 260 204 151 312 202 221 203 142 121 213 129 253 191 129 366 309 215 216 320 269 216 218 173 209 188 150 262 235 235 267 225 
792 81 Colombian Colombia AMERICA 126 124 -9 129 142 228 140 112 186 96 130 120 148 219 256 241 175 165 218 194 187 143 245 132 228 184 186 138 119 201 183 172 158 173 98 166 126 143 166 180 208 185 249 115 153 108 228 236 271 195 221 96 117 233 196 294 -9 104 95 238 192 127 138 116 163 153 239 246 91 132 257 107 155 157 106 165 228 155 190 130 178 104 134 133 205 246 244 139 184 160 197 150 -9 247 135 172 249 197 119 140 246 197 198 158 162 251 181 127 338 168 190 195 178 156 190 143 240 194 140 188 151 237 155 176 129 224 206 281 251 143 126 155 137 170 161 169 202 204 128 208 238 228 121 224 224 133 370 183 177 204 159 188 157 200 -9 204 161 256 119 214 255 230 116 183 225 128 189 238 259 180 145 179 109 269 195 176 131 196 145 147 105 210 179 142 126 171 308 199 151 237 194 183 157 260 140 245 274 207 112 236 151 180 293 241 163 274 151 260 224 268 195 253 189 263 104 263 104 274 212 257 100 292 323 233 242 298 138 194 189 233 294 164 270 235 178 177 278 260 180 211 148 159 141 98 283 178 193 246 160 297 237 307 222 133 125 240 149 322 155 253 162 178 158 204 212 264 194 220 274 209 174 230 176 300 143 235 262 146 320 289 195 -9 164 132 172 368 211 201 197 209 164 296 182 179 294 299 140 176 148 269 131 158 191 176 184 173 264 292 266 202 188 149 242 202 209 252 135 241 274 -9 100 266 204 174 242 163 -9 111 161 405 159 192 249 227 205 217 172 123 260 -9 125 256 148 126 216 233 260 204 151 304 202 221 199 126 119 213 123 245 191 129 362 309 203 216 316 265 216 206 173 205 184 146 258 227 231 263 217 
793 81 Colombian Colombia AMERICA 126 124 -9 135 156 230 140 118 182 108 142 114 148 217 258 233 173 165 218 198 187 149 251 132 224 200 188 146 139 207 183 176 162 173 110 172 130 147 170 180 208 188 255 115 147 108 228 -9 274 -9 224 102 129 236 208 294 -9 116 95 241 192 127 -9 119 163 156 260 246 -9 135 266 107 158 157 112 -9 240 155 190 130 193 104 146 136 205 246 244 139 184 166 197 150 190 247 135 193 252 200 119 152 254 197 202 162 174 255 189 127 350 172 190 207 180 168 206 143 244 198 144 192 151 237 155 172 -9 228 214 313 251 151 134 155 137 170 157 181 206 204 128 220 246 236 145 228 236 153 378 183 177 204 155 188 157 204 359 204 -9 264 115 222 263 238 120 183 237 140 193 242 255 192 157 187 109 277 195 184 143 200 153 147 117 218 191 154 146 171 320 219 163 241 190 187 173 256 148 237 270 215 120 240 163 180 297 249 175 274 155 268 220 276 195 257 185 267 108 271 104 278 224 261 108 292 323 249 242 290 166 194 209 233 290 168 274 239 178 177 282 -9 188 211 164 163 149 98 291 194 193 -9 180 309 249 307 214 133 133 244 169 322 159 253 170 182 158 208 216 268 198 232 286 223 202 234 180 308 143 251 266 142 324 289 199 257 164 140 184 372 207 189 197 221 192 300 186 199 294 303 140 196 172 269 127 162 -9 196 184 177 272 296 258 198 188 153 242 198 209 256 151 249 282 -9 100 278 200 206 254 163 157 111 141 405 159 208 253 235 201 217 176 147 260 -9 125 256 160 130 248 -9 260 204 151 304 198 217 199 134 121 205 129 245 191 129 358 305 211 212 316 245 212 210 -9 -9 188 146 262 231 239 263 205 
793 81 Colombian Colombia AMERICA 120 122 -9 129 156 226 140 112 180 98 142 114 148 217 258 231 173 165 218 194 175 149 243 128 224 184 188 134 119 205 183 172 158 163 98 166 126 147 168 180 208 185 246 115 141 108 225 -9 274 -9 221 96 126 233 196 294 -9 113 95 238 192 127 -9 116 163 153 251 237 -9 123 260 107 152 157 109 -9 228 155 190 127 193 104 137 133 205 246 241 139 179 160 194 150 184 238 132 172 246 197 113 140 254 197 198 158 170 247 185 127 326 168 188 199 168 164 190 139 232 194 140 192 151 237 151 172 -9 200 206 273 247 147 110 155 133 166 146 173 198 204 124 204 238 224 141 224 228 149 370 183 177 204 147 188 153 196 347 204 -9 248 115 214 259 234 116 183 231 124 193 234 255 180 153 183 109 273 191 172 139 196 153 135 105 214 187 146 146 171 320 199 151 241 190 187 173 256 140 237 270 211 112 240 151 176 289 245 171 274 155 264 216 268 195 249 181 255 104 263 104 278 216 253 84 292 323 237 230 286 162 190 181 233 282 164 274 223 178 177 278 -9 180 207 156 155 145 98 287 194 185 -9 180 305 233 303 210 117 125 244 169 318 155 253 154 178 154 204 216 260 198 220 278 217 170 230 180 300 143 235 262 138 320 257 199 229 164 136 176 368 203 185 185 209 172 292 182 179 294 299 136 188 160 269 123 158 -9 192 184 173 264 296 254 194 188 149 242 194 201 256 135 249 282 -9 100 254 200 202 242 159 137 111 141 405 155 192 245 231 199 201 160 127 252 -9 121 256 152 126 240 -9 260 204 151 304 196 185 191 134 107 199 129 233 181 117 350 305 203 180 316 245 212 206 -9 -9 180 146 254 227 231 263 201 
827 81 Colombian Colombia AMERICA 126 128 146 129 156 228 150 124 182 98 142 114 148 227 258 229 177 167 218 194 187 143 249 132 228 184 192 146 119 207 183 176 158 173 110 172 126 173 170 182 208 185 255 115 141 120 234 239 274 -9 239 111 132 236 199 294 190 113 95 259 192 127 138 119 163 156 251 246 94 135 263 110 158 157 115 -9 228 155 190 133 193 104 146 136 205 246 -9 151 184 169 194 150 190 238 135 193 246 200 119 156 254 201 202 158 162 259 185 131 334 176 194 203 172 160 202 143 244 198 144 192 155 241 159 180 141 200 206 309 247 147 126 155 137 170 157 173 214 212 144 208 250 232 145 228 236 145 378 183 181 204 163 192 161 204 359 216 149 264 115 222 259 234 120 187 239 120 185 234 259 192 157 175 109 281 195 184 143 -9 157 151 117 212 191 146 126 175 320 199 159 245 186 187 173 260 148 245 274 231 124 244 151 180 293 249 171 274 159 -9 228 272 199 245 181 267 104 267 108 290 224 265 108 296 319 233 238 298 166 206 193 233 302 172 278 239 178 189 278 260 188 207 160 159 145 106 287 182 193 250 188 -9 249 311 218 133 125 248 169 322 167 257 170 182 162 208 216 264 206 232 282 223 174 230 184 304 143 239 266 146 320 289 203 229 168 136 172 372 211 189 197 221 188 296 182 199 298 303 144 176 164 289 131 166 203 200 188 169 264 296 262 198 196 153 246 202 209 280 135 245 282 201 104 286 204 198 246 163 153 111 169 405 167 200 -9 231 205 217 172 123 252 -9 137 256 164 134 240 233 260 204 171 304 206 221 207 126 119 203 124 249 195 133 370 309 211 180 312 265 216 210 -9 213 184 142 258 231 235 271 205 
827 81 Colombian Colombia AMERICA 126 124 144 129 142 226 140 112 182 96 134 114 148 217 258 229 173 165 218 194 183 143 243 128 228 184 188 144 119 207 183 172 158 173 100 172 120 145 168 174 208 185 255 115 141 105 234 239 271 -9 239 96 117 230 196 294 190 113 95 259 192 121 132 119 163 150 251 246 91 135 260 101 155 157 106 -9 228 155 190 130 193 98 134 133 202 246 -9 139 182 166 194 150 184 238 135 190 246 197 119 140 246 197 166 158 162 255 181 127 330 168 192 203 168 152 190 143 240 194 144 192 151 241 155 172 137 200 206 273 247 147 122 151 137 170 153 157 202 204 140 204 242 232 137 224 228 133 374 183 177 204 147 192 157 196 359 204 141 244 115 218 259 234 112 175 239 120 185 234 255 180 153 175 109 277 187 180 139 -9 145 143 117 212 191 142 126 171 320 199 151 237 186 187 169 244 144 237 266 207 112 236 151 180 293 241 171 270 151 -9 220 268 191 241 181 251 104 267 108 278 220 257 108 292 319 233 238 294 162 202 189 233 298 168 274 239 178 189 270 256 180 207 156 155 141 98 287 178 193 246 180 -9 245 307 214 121 125 244 161 322 163 257 166 182 162 204 212 260 198 212 282 209 170 226 184 304 143 239 266 146 320 257 199 225 160 136 168 372 203 173 181 209 172 288 182 183 294 303 136 176 164 269 119 158 195 192 184 169 260 292 254 194 188 153 242 202 209 268 135 245 282 201 100 278 204 198 242 163 137 111 161 405 159 196 -9 227 201 213 172 119 252 -9 121 256 164 134 240 233 256 204 151 304 202 185 203 126 107 203 123 249 183 133 366 305 203 180 308 265 216 206 -9 205 176 138 250 227 231 259 205 
970 81 Colombian Colombia AMERICA 126 128 148 135 156 228 140 112 -9 98 142 120 148 227 258 233 173 165 218 194 193 149 249 132 224 184 188 146 139 207 183 180 158 173 100 172 130 173 170 180 208 191 246 115 147 120 234 242 274 210 224 96 126 233 208 309 -9 -9 95 238 192 130 141 116 163 156 266 246 91 132 260 110 158 157 115 162 228 155 190 133 193 104 137 136 205 246 244 142 184 166 197 159 190 247 135 193 246 200 119 140 254 201 202 158 174 255 189 127 322 176 190 207 174 164 206 143 240 198 144 192 159 237 159 172 141 228 214 313 247 155 126 155 137 170 157 181 202 208 124 208 246 236 145 228 236 149 378 187 181 204 147 192 157 204 359 220 153 264 119 222 263 238 116 183 237 144 201 242 255 192 157 187 117 277 195 180 143 200 157 171 109 218 187 154 150 175 320 219 151 245 190 187 173 256 152 245 274 243 112 240 151 176 289 245 171 274 155 272 216 -9 195 249 189 275 108 271 104 278 -9 253 108 292 323 237 246 290 166 194 209 233 290 168 274 239 178 189 282 260 188 215 156 163 149 98 291 194 193 246 180 -9 237 307 214 141 133 248 -9 322 163 253 166 182 158 208 216 264 202 224 286 223 170 234 180 304 173 251 262 142 324 289 203 229 164 140 184 372 211 185 189 233 192 300 186 195 298 307 144 196 160 269 131 158 207 200 212 177 272 296 262 202 188 149 242 202 209 256 151 253 282 201 116 278 208 206 258 -9 137 111 161 405 159 208 253 235 201 217 160 147 252 264 125 256 172 130 248 241 260 204 151 308 202 221 199 134 121 205 129 253 181 133 358 305 211 216 316 245 216 210 181 209 184 146 262 231 239 271 205 
970 81 Colombian Colombia AMERICA 120 122 144 129 142 226 140 112 -9 96 130 114 148 217 258 233 163 165 218 194 175 145 243 128 204 184 188 146 139 199 183 176 158 163 98 166 130 147 168 174 208 185 246 115 141 108 225 239 274 195 221 96 126 233 199 294 -9 -9 95 238 192 127 132 113 163 156 260 246 79 123 260 107 158 151 112 156 228 152 190 127 187 104 137 133 205 240 244 139 182 160 194 150 184 247 135 172 246 197 113 140 246 197 202 158 162 251 185 119 318 172 190 203 168 160 190 139 232 198 140 192 151 233 151 172 133 224 210 277 247 147 110 151 133 170 153 157 198 204 124 204 242 232 121 228 228 149 378 183 177 204 147 188 153 192 351 204 153 256 116 218 259 238 116 183 235 140 193 238 255 192 153 175 109 277 191 172 139 200 153 147 105 212 187 142 146 171 320 199 151 241 190 187 157 244 148 237 270 211 112 240 151 176 289 241 167 274 155 264 216 -9 195 245 181 267 104 267 104 262 -9 253 84 288 319 233 230 286 138 194 193 233 274 164 274 235 178 177 278 260 180 211 152 159 149 98 283 194 189 242 180 -9 233 307 210 133 129 244 -9 322 155 253 154 178 154 208 212 260 198 220 278 209 170 234 172 300 143 239 258 142 324 289 199 229 160 136 172 368 207 181 185 209 172 296 182 179 294 303 140 176 148 269 123 146 187 196 184 177 268 296 258 198 188 149 242 194 201 256 135 249 282 197 100 266 208 182 242 -9 137 111 141 405 155 200 245 231 199 213 160 123 252 264 121 256 160 126 244 237 260 204 151 304 198 185 191 134 119 205 125 233 181 117 342 285 211 180 312 245 212 210 177 205 180 138 258 227 235 263 205 
854 86 Maya Mexico AMERICA 120 130 142 135 156 -9 140 124 186 98 130 120 148 217 264 241 175 167 220 198 191 -9 247 -9 226 184 204 148 119 -9 183 -9 158 173 98 166 130 -9 168 180 212 185 252 115 156 108 237 245 277 -9 230 111 129 236 205 -9 -9 116 95 241 195 133 144 113 163 159 263 234 91 132 260 110 158 157 115 165 228 155 190 136 187 110 146 133 214 246 244 142 179 166 194 150 184 247 132 -9 246 200 119 156 254 197 202 166 162 247 181 139 342 180 196 203 180 152 190 151 244 194 144 -9 155 237 167 176 137 224 206 269 255 155 122 155 137 170 157 169 202 212 140 216 246 228 137 228 232 149 378 187 193 204 159 200 173 192 355 212 157 260 115 218 263 234 120 187 -9 136 205 242 255 188 157 179 117 273 191 180 143 204 149 151 121 212 195 154 146 175 320 225 155 249 194 187 173 260 152 237 274 227 120 236 159 184 293 241 175 274 151 264 224 276 191 253 185 267 108 263 104 278 228 265 -9 296 331 245 242 294 174 202 189 233 -9 168 278 -9 178 189 282 260 180 215 -9 163 145 110 291 202 193 254 180 313 241 311 -9 133 133 248 153 322 159 249 170 178 162 204 220 264 198 224 286 223 174 234 180 312 173 247 266 -9 328 293 207 257 164 -9 184 372 211 193 197 233 176 296 186 191 298 311 140 176 164 265 131 158 191 188 212 177 272 296 266 202 -9 149 246 198 209 280 135 245 286 209 100 282 208 202 250 163 161 111 165 405 167 200 249 235 209 221 180 143 260 276 133 256 168 138 -9 237 260 224 163 308 202 221 203 138 121 205 129 249 195 133 370 309 215 216 312 241 216 202 181 209 184 150 258 243 239 263 -9 
854 86 Maya Mexico AMERICA 120 124 124 129 152 -9 138 112 186 98 130 114 148 217 258 233 147 165 218 194 177 -9 249 -9 222 184 188 146 119 -9 183 -9 154 173 94 166 120 -9 164 174 208 185 249 115 141 108 225 224 271 -9 221 111 117 233 205 -9 -9 116 95 241 186 127 132 113 160 156 251 234 88 132 260 107 155 151 112 162 228 152 190 130 187 104 137 133 205 243 244 142 179 160 194 150 184 247 126 -9 246 197 119 156 246 197 202 158 162 247 181 131 330 172 190 199 180 152 190 143 240 194 144 -9 155 237 159 172 129 208 206 261 251 151 110 151 133 146 153 169 198 204 128 208 238 228 121 228 228 145 374 183 181 204 147 188 157 192 347 204 153 244 115 214 263 234 112 187 -9 132 201 238 251 180 153 175 109 273 191 180 135 200 149 143 121 208 191 154 138 171 312 223 155 233 194 187 173 244 140 233 274 223 116 236 151 180 293 241 171 258 151 260 224 276 187 253 181 263 104 263 100 274 216 257 -9 288 323 233 238 294 162 190 181 233 -9 164 266 -9 178 173 278 260 180 201 -9 155 145 98 287 178 193 254 176 305 237 303 -9 133 125 240 153 322 155 249 170 178 154 204 220 264 198 216 278 219 170 226 172 304 169 239 262 -9 320 289 203 229 164 -9 172 372 211 181 193 221 172 296 182 187 298 307 140 176 144 265 119 158 191 184 184 169 264 292 262 198 -9 149 234 190 201 264 135 241 282 197 100 266 208 182 246 163 137 111 157 405 155 200 245 223 207 213 176 131 260 272 129 256 168 134 -9 237 256 204 155 304 196 221 195 138 107 205 123 249 181 117 362 301 203 212 312 241 212 202 181 209 180 138 258 231 231 259 -9
855 86 Maya Mexico AMERICA 126 -9 124 129 164 234 140 112 186 98 142 120 148 217 258 231 163 165 218 198 187 151 249 132 230 184 188 146 119 207 183 176 158 173 100 166 120 147 172 182 212 188 249 115 153 108 234 242 271 -9 239 96 117 236 205 294 190 116 95 256 192 133 138 122 163 156 263 246 91 135 257 107 158 157 109 165 228 152 202 133 193 104 146 136 -9 243 244 148 179 175 197 150 187 238 138 190 246 200 119 140 246 201 198 158 170 259 189 127 326 176 190 203 182 160 206 143 244 198 152 192 155 233 -9 176 141 228 206 277 247 147 126 155 133 170 153 169 210 208 144 216 254 240 -9 -9 232 141 382 183 189 204 159 188 157 196 351 216 161 264 119 214 263 234 120 183 229 144 209 238 259 192 157 179 109 277 187 184 131 200 161 159 109 216 195 142 150 171 320 199 155 249 198 187 177 248 140 237 278 227 124 248 151 188 289 241 171 274 143 268 224 276 199 253 185 267 104 271 108 270 216 269 108 292 323 245 234 306 162 202 189 237 294 172 282 231 178 -9 282 260 188 219 164 159 145 102 287 178 193 246 180 305 241 311 222 137 125 240 169 322 159 257 170 178 158 216 -9 260 214 220 278 209 174 234 184 304 143 239 270 150 324 -9 199 261 168 136 176 -9 211 197 193 233 180 300 194 179 -9 307 144 200 164 273 123 162 195 192 208 177 272 296 266 202 204 153 242 206 209 268 135 245 286 201 100 270 208 202 242 167 165 111 149 405 163 204 249 231 209 217 176 139 268 268 137 256 160 134 244 237 260 220 171 308 202 225 203 134 121 213 125 249 183 133 362 305 -9 204 316 269 212 214 181 213 188 142 262 231 231 267 221 
855 86 Maya Mexico AMERICA 120 -9 124 129 156 230 138 112 186 98 130 120 148 217 258 229 163 163 218 194 175 147 243 132 228 184 188 134 119 199 183 176 148 167 100 166 120 145 170 182 208 185 246 115 141 108 231 224 265 -9 221 96 117 227 205 294 181 116 95 241 189 118 132 116 160 150 260 237 91 132 257 107 155 157 106 165 228 152 190 130 187 104 134 133 -9 243 244 142 179 169 179 150 184 235 126 190 246 200 113 140 246 201 198 158 162 255 181 123 326 172 190 203 174 156 198 139 240 194 140 188 155 233 -9 172 141 200 206 273 243 147 126 151 133 166 153 169 202 208 124 216 238 228 -9 -9 232 133 382 183 181 204 147 188 153 192 347 204 141 240 111 210 255 234 112 175 231 140 185 234 259 184 157 179 105 277 187 176 131 196 157 143 109 210 191 142 150 171 316 199 151 237 190 187 173 240 140 233 274 211 108 244 151 176 289 241 163 258 143 260 224 272 183 253 185 267 104 263 104 270 216 257 100 292 323 237 230 290 146 194 189 233 278 168 266 231 170 -9 278 260 188 215 156 159 141 98 287 174 189 242 160 305 237 303 214 125 125 224 153 322 159 253 162 170 154 212 -9 252 198 220 278 209 170 230 172 304 143 235 266 142 320 -9 199 229 164 132 172 -9 203 181 193 233 168 296 178 179 -9 303 140 176 160 269 119 158 191 192 196 177 264 292 258 202 188 149 242 194 205 252 135 245 282 197 100 254 204 198 236 163 137 111 149 405 163 200 245 227 205 213 176 135 260 268 125 256 156 130 196 229 256 204 155 308 202 221 199 118 111 201 123 245 181 117 346 305 -9 204 308 265 212 198 173 205 184 138 258 227 227 255 213 
856 86 Maya Mexico AMERICA 126 130 124 135 156 234 146 114 188 98 130 120 148 227 258 233 173 165 218 194 193 149 249 136 230 186 194 150 119 201 183 180 162 165 102 172 120 145 172 174 208 188 249 115 153 126 234 239 271 201 221 120 117 236 208 294 -9 113 95 241 195 127 144 116 163 150 266 246 94 129 260 107 155 157 115 162 240 152 -9 133 193 104 137 136 -9 246 244 148 184 169 -9 156 184 247 135 193 249 200 119 152 254 205 202 166 162 259 185 131 342 176 196 207 194 160 202 143 244 202 156 188 151 241 155 176 133 212 210 -9 259 151 126 151 133 178 165 165 206 216 140 208 246 232 129 228 236 153 382 187 177 212 147 192 185 200 359 220 161 264 119 222 263 238 120 183 -9 140 197 242 259 180 157 183 109 277 195 180 143 196 153 143 125 212 195 150 154 179 320 217 155 249 190 187 173 256 148 233 282 231 120 240 167 180 293 241 175 278 155 268 224 276 195 253 185 271 108 271 108 274 224 269 108 296 327 249 238 294 162 198 197 233 302 168 278 239 182 185 278 -9 200 215 160 159 145 98 -9 194 193 250 180 301 249 311 214 133 125 256 169 326 163 249 170 182 158 216 216 264 202 228 286 209 174 230 180 304 143 251 266 154 324 289 199 229 168 136 176 -9 215 201 193 229 172 300 186 191 298 303 144 196 164 277 127 162 191 196 212 165 264 296 266 198 204 149 242 198 209 272 155 249 286 201 112 266 212 202 250 175 165 111 165 405 163 200 249 231 205 225 -9 139 264 264 137 284 168 138 208 241 260 216 155 304 202 229 203 134 121 201 125 249 187 133 370 313 203 216 312 261 216 210 -9 201 184 146 258 235 235 267 209 
856 86 Maya Mexico AMERICA 126 128 124 129 142 234 138 112 186 96 130 114 146 217 258 229 165 165 216 190 191 145 245 134 204 184 188 146 119 199 183 176 158 165 94 166 120 143 170 174 208 185 249 115 141 105 228 239 271 198 221 96 117 236 196 291 -9 113 95 241 192 127 132 116 160 150 251 234 91 123 257 107 155 157 115 162 240 152 -9 130 193 98 137 133 -9 246 244 139 179 166 -9 150 184 235 126 172 249 200 119 152 246 197 198 166 162 251 181 123 338 172 196 191 182 156 190 139 240 198 140 188 151 233 155 164 133 208 206 -9 247 143 110 147 129 170 157 161 202 212 128 204 238 208 121 228 228 149 370 183 177 200 147 192 153 192 343 204 157 244 111 214 259 234 112 183 -9 128 193 242 259 180 149 179 109 277 187 176 139 196 149 139 117 210 191 142 142 175 308 209 151 245 190 179 169 240 148 233 274 227 116 240 151 176 289 241 171 258 139 264 212 276 195 253 185 263 104 263 104 270 220 253 100 288 323 233 230 286 154 194 193 233 290 164 278 239 178 173 278 -9 184 215 140 155 141 98 -9 182 189 246 180 301 245 303 214 121 125 248 153 322 159 245 170 178 158 208 216 260 198 220 278 209 174 230 172 300 143 239 262 146 320 285 199 229 156 136 172 -9 203 185 181 209 160 292 178 175 298 299 140 176 152 261 123 158 191 192 212 177 268 296 258 198 204 149 242 194 201 256 135 249 282 197 100 266 204 198 238 163 153 111 165 405 163 192 245 227 205 213 -9 131 264 260 133 256 160 134 196 237 244 204 151 304 196 217 203 118 119 199 125 245 181 133 358 309 203 204 308 241 212 202 -9 201 180 146 258 231 227 267 205 
857 86 Maya Mexico AMERICA 126 128 124 129 142 234 138 112 182 98 142 120 148 227 258 233 173 165 218 194 187 149 255 140 228 200 200 146 119 205 183 176 162 175 104 166 132 173 172 -9 212 185 -9 115 141 108 234 239 277 207 239 96 129 233 208 294 -9 113 95 241 195 127 141 119 166 156 251 246 91 132 260 107 158 157 115 165 249 155 -9 133 190 104 137 136 205 243 -9 148 184 166 194 153 184 247 135 -9 249 200 122 156 254 201 202 158 170 259 181 131 342 176 192 203 194 156 190 143 244 198 152 -9 155 241 155 180 141 228 210 309 255 151 114 155 133 170 157 177 202 208 144 204 254 232 141 228 228 149 378 187 173 204 147 188 181 196 359 216 157 264 119 214 263 234 120 187 243 128 185 234 -9 196 157 179 109 277 195 180 139 204 157 155 117 216 191 158 146 175 316 225 159 249 190 195 173 260 160 233 282 215 120 236 159 180 297 241 187 270 151 -9 228 276 195 253 185 263 104 267 108 282 224 257 108 296 323 245 242 298 174 202 205 237 306 168 274 239 178 185 282 260 184 219 160 159 145 98 287 186 197 242 180 301 245 307 -9 133 125 248 157 322 167 253 170 182 158 208 216 264 202 224 278 223 182 238 184 304 143 263 270 154 320 293 203 257 -9 136 176 372 211 193 197 221 176 304 186 191 302 275 -9 196 160 269 123 158 187 192 208 173 268 324 274 202 200 149 246 202 209 280 135 249 286 205 116 270 208 206 238 175 173 111 161 409 167 200 257 227 213 221 172 143 252 272 129 264 160 134 240 241 260 216 167 312 202 209 199 134 119 205 131 249 183 129 374 317 211 216 312 265 216 202 181 -9 184 146 266 235 235 267 233 
857 86 Maya Mexico AMERICA 126 128 124 129 142 234 138 112 180 96 130 120 148 227 258 231 165 165 218 194 187 143 249 136 226 186 200 142 119 199 174 172 158 171 94 166 120 143 166 -9 208 182 -9 115 141 108 234 239 271 195 221 96 117 230 205 294 -9 104 95 241 195 127 132 116 166 153 239 237 79 132 257 107 155 157 106 156 249 152 -9 133 178 98 137 133 193 228 -9 142 179 163 191 150 184 247 135 -9 246 197 119 152 246 201 198 158 162 247 181 127 326 168 190 195 182 156 190 139 232 194 140 -9 151 241 155 172 141 220 206 265 251 147 110 155 133 146 153 157 194 204 140 204 238 228 121 224 228 145 374 183 173 200 147 188 153 196 355 212 153 240 111 214 259 230 116 167 225 120 177 234 -9 192 153 175 109 277 195 176 131 192 149 151 109 212 191 146 146 171 308 211 155 237 190 187 173 240 132 233 274 207 112 236 159 176 289 241 175 270 147 -9 212 272 195 249 185 263 104 263 104 258 216 257 100 288 323 233 234 298 170 190 189 233 294 164 274 239 178 173 282 260 184 211 156 155 141 98 287 186 193 242 180 301 237 303 -9 117 125 244 157 322 163 253 162 174 154 204 212 260 198 224 274 209 178 226 180 304 143 235 266 142 320 289 199 233 -9 136 172 372 207 185 185 209 176 296 186 179 298 275 -9 176 148 269 119 158 187 188 188 169 272 320 262 198 196 141 246 190 209 276 135 249 274 201 100 254 204 174 236 163 149 111 149 409 167 200 253 227 207 213 172 131 252 272 121 256 156 134 240 241 256 204 167 304 202 185 199 134 111 199 125 241 181 129 362 305 211 180 308 249 216 202 181 -9 184 138 266 231 231 255 209 
858 86 Maya Mexico AMERICA 126 128 144 129 142 234 146 112 186 98 136 120 148 227 260 241 173 165 218 198 187 149 243 134 228 200 200 142 141 199 183 186 158 171 110 172 128 173 172 182 212 188 249 115 141 108 234 239 277 207 239 96 126 236 199 309 190 116 95 241 192 127 132 119 166 156 266 237 94 123 260 107 155 157 115 165 240 152 202 130 178 107 146 136 205 246 244 151 182 160 203 156 184 247 135 196 246 200 122 156 246 197 198 166 162 255 181 127 342 176 190 203 180 164 190 147 244 206 152 188 155 241 -9 180 141 228 206 277 247 155 126 151 149 170 153 165 210 212 140 208 246 232 141 -9 236 133 382 187 197 204 155 196 201 208 355 212 161 260 115 218 263 234 120 187 235 132 201 242 255 192 153 183 117 273 191 184 143 196 161 163 117 214 191 162 146 163 324 219 155 245 198 195 169 260 144 233 278 211 128 240 167 188 301 241 175 274 155 264 220 276 187 253 185 255 116 263 104 270 220 269 108 304 323 241 242 290 162 198 213 237 298 172 278 235 182 189 278 260 180 219 168 159 145 98 295 194 197 242 180 -9 237 303 222 133 129 244 169 326 163 261 170 182 158 216 216 264 198 224 286 209 178 234 176 304 173 239 266 150 324 -9 199 233 168 136 188 372 219 205 197 209 176 292 186 187 302 275 144 176 160 297 127 158 199 196 212 165 268 300 266 202 204 153 246 206 -9 276 151 257 282 209 100 278 204 198 242 163 173 119 165 405 167 200 249 235 207 217 184 135 272 272 121 264 164 142 240 241 260 204 171 312 202 217 203 134 107 205 129 249 181 117 366 313 211 192 308 249 216 206 177 213 184 138 262 231 235 267 205 
858 86 Maya Mexico AMERICA 126 124 124 129 142 228 138 112 182 96 132 114 148 217 258 231 173 165 218 194 175 145 243 128 204 200 190 134 141 199 183 180 158 165 94 166 120 147 168 182 208 188 246 115 141 105 234 239 265 204 221 96 117 233 196 294 190 116 95 238 192 127 132 113 163 147 263 237 91 123 257 107 155 157 112 156 228 152 190 130 178 104 134 136 190 237 244 142 179 160 194 150 181 235 126 190 246 200 119 152 246 197 198 166 162 255 181 127 330 172 190 199 178 156 190 143 240 198 140 188 155 241 -9 172 141 220 206 273 247 147 110 151 137 170 145 157 202 212 120 204 238 228 121 -9 236 133 382 187 177 204 147 192 161 200 355 212 157 240 111 214 259 230 116 183 225 128 181 238 243 180 145 179 113 273 183 176 131 196 145 151 109 208 191 154 146 163 316 199 151 241 198 187 169 244 140 233 270 211 112 236 159 176 297 241 171 258 151 260 220 268 187 253 181 247 104 263 104 262 212 257 84 296 319 241 238 286 146 194 209 233 286 164 278 231 178 177 278 260 180 205 160 159 141 98 291 186 193 242 180 -9 237 287 214 129 125 240 153 322 159 245 166 178 154 208 212 264 194 216 278 209 178 230 176 304 173 235 262 146 320 -9 199 229 160 132 172 372 211 201 185 209 176 292 182 179 298 275 144 176 160 269 123 158 183 196 196 177 268 296 262 202 188 149 242 198 -9 276 139 249 282 201 100 270 200 182 242 163 153 115 165 405 163 192 245 227 205 213 172 119 260 268 121 256 148 126 236 233 252 204 155 304 192 185 199 118 107 203 125 241 181 117 354 309 191 188 308 209 212 202 173 201 184 138 254 231 231 255 205 
859 86 Maya Mexico AMERICA 126 128 144 139 142 234 140 116 186 98 136 120 146 227 258 229 173 165 220 198 187 149 243 140 228 186 204 140 119 207 183 180 154 173 104 172 -9 145 172 180 212 188 249 115 141 120 234 242 271 -9 239 96 129 236 199 294 187 113 95 241 192 127 144 113 160 156 263 246 91 132 260 110 155 157 112 162 228 155 190 133 193 104 143 136 205 255 244 154 185 160 197 150 196 238 132 196 246 200 119 160 246 205 166 158 162 259 189 127 342 180 192 203 180 160 206 143 240 198 144 188 155 241 159 180 141 220 206 309 255 151 122 155 137 166 169 157 206 208 140 212 238 232 121 228 232 133 378 183 181 204 159 188 157 200 347 216 161 264 116 214 263 234 116 175 233 140 185 246 259 188 153 183 109 281 195 180 147 196 153 159 113 214 191 162 154 171 324 219 155 249 198 187 173 260 144 249 278 227 116 244 151 188 293 269 191 274 151 268 219 276 199 249 189 267 108 267 108 278 220 269 100 296 323 241 238 294 170 202 -9 233 302 172 282 239 178 181 286 260 -9 219 164 155 145 106 287 198 189 250 184 305 241 303 226 129 129 248 157 326 163 257 170 178 158 212 220 268 206 220 278 213 174 230 176 300 -9 239 266 162 316 289 199 233 180 136 176 372 203 205 201 233 184 300 190 191 298 299 144 176 164 273 131 158 179 196 184 169 268 -9 266 202 204 153 246 206 209 252 135 253 274 205 100 266 204 198 250 163 153 119 165 417 163 204 249 -9 213 217 176 143 260 272 133 256 160 134 244 241 260 224 159 312 204 225 203 146 119 205 129 249 195 129 370 293 211 216 312 265 220 202 181 213 184 146 262 243 235 259 237 
859 86 Maya Mexico AMERICA 126 114 144 135 142 228 140 112 186 98 130 114 146 217 258 229 163 165 218 194 187 143 243 134 228 184 190 138 119 199 183 174 154 163 100 166 -9 145 170 174 208 185 246 115 141 108 234 224 271 -9 239 96 117 236 196 294 187 104 95 241 192 127 132 113 157 147 251 237 88 126 257 107 155 157 112 156 228 155 190 130 178 98 134 133 202 246 244 139 179 154 194 150 187 238 126 190 246 197 113 140 246 201 202 158 162 255 185 119 322 176 190 203 178 156 190 135 240 194 144 184 143 233 155 172 133 216 206 269 251 143 122 155 133 146 157 157 202 208 132 204 234 208 121 224 228 133 370 183 173 204 159 188 153 196 347 204 153 260 115 214 255 234 116 175 225 136 181 234 259 188 153 179 109 273 191 180 131 196 149 151 109 212 187 154 146 163 320 199 155 245 190 187 169 256 140 233 274 211 112 240 147 184 289 237 171 274 151 268 208 268 187 249 181 255 104 263 104 266 220 253 100 288 323 241 234 290 146 198 -9 233 290 164 278 239 174 173 278 260 -9 207 144 155 141 98 287 174 189 246 180 301 237 303 218 109 125 244 153 322 159 245 162 178 154 208 204 264 198 220 274 209 170 226 172 292 -9 235 262 142 316 289 199 225 168 136 176 372 203 185 181 209 180 296 174 179 294 275 140 176 148 269 131 158 159 196 184 169 264 -9 254 202 188 149 246 198 205 252 131 249 262 201 100 266 200 194 246 163 149 111 161 405 159 200 245 -9 209 213 168 135 252 260 129 256 156 130 244 237 260 204 151 304 196 225 195 118 119 199 127 245 187 117 358 293 203 216 304 265 212 202 173 205 176 146 246 227 227 259 209 
860 86 Maya Mexico AMERICA 128 128 136 135 142 234 142 128 186 100 142 120 156 227 260 233 173 171 218 196 187 -9 247 134 226 184 188 146 139 -9 183 180 154 175 100 166 120 147 170 174 208 185 252 124 141 108 234 239 277 213 236 96 138 233 199 309 187 116 101 241 192 133 138 131 163 141 251 249 91 132 263 116 158 160 115 165 249 155 196 136 190 104 146 136 205 243 244 148 184 166 194 156 190 247 132 199 249 200 119 152 254 197 202 166 178 259 193 131 -9 168 194 199 178 168 190 143 244 198 148 192 155 237 155 176 141 228 210 305 251 151 118 159 149 170 153 181 206 212 124 212 254 228 129 228 240 145 386 187 177 208 147 188 153 208 355 216 157 264 115 218 259 234 120 175 231 140 205 242 255 192 149 179 109 277 199 176 143 196 161 151 117 214 199 162 150 171 316 213 155 249 194 187 177 260 144 237 274 227 124 244 163 172 289 257 175 274 159 268 224 276 191 253 189 267 108 267 108 278 220 269 100 300 323 237 234 294 166 194 -9 233 282 172 274 239 178 185 282 260 184 219 156 163 153 100 291 198 197 250 184 309 237 303 226 121 125 224 157 338 163 253 166 182 158 212 216 268 206 228 278 213 178 226 180 300 173 255 270 146 324 293 203 261 168 140 176 376 211 197 189 233 176 300 186 191 298 307 140 176 168 289 131 158 191 192 216 177 276 300 290 206 192 149 246 194 209 276 151 245 286 201 100 270 200 186 246 163 169 111 161 405 167 200 261 239 215 217 176 139 252 268 141 256 164 134 176 237 256 220 151 308 202 229 203 126 121 213 125 249 195 133 350 -9 211 216 312 237 212 206 173 209 184 146 266 227 235 263 233 
860 86 Maya Mexico AMERICA 126 124 124 129 142 230 142 112 182 96 132 120 146 223 258 229 169 165 218 194 175 -9 243 128 218 184 188 146 139 -9 183 180 154 165 98 166 120 147 166 174 212 185 249 115 141 105 231 224 274 207 221 96 132 233 196 294 184 107 95 238 192 121 132 113 160 141 251 237 91 126 260 107 155 160 106 165 249 140 190 133 187 98 131 136 205 240 241 148 179 166 185 156 184 247 126 172 246 197 113 148 250 197 198 158 162 247 181 131 -9 168 194 191 168 156 190 143 240 194 148 188 151 237 155 172 137 200 204 269 247 147 110 151 137 170 153 157 206 196 124 204 246 228 121 228 228 145 370 183 173 204 147 188 129 200 351 204 145 264 115 214 259 234 116 171 225 132 185 234 255 192 149 179 109 273 195 176 139 196 149 143 117 212 175 150 142 163 308 203 151 245 194 183 169 252 140 237 274 211 112 244 163 172 289 241 175 258 155 264 216 272 191 245 185 251 104 263 104 266 212 257 100 296 323 221 234 290 162 174 -9 233 282 172 270 223 174 185 282 260 180 219 144 159 141 98 287 174 189 242 176 301 233 299 214 117 125 224 153 318 163 249 162 178 154 204 204 260 198 224 282 209 170 226 172 292 161 251 266 142 320 289 199 229 164 136 176 368 207 185 185 233 160 292 182 175 294 279 140 176 164 265 127 158 187 184 184 177 268 292 266 202 188 149 230 194 201 256 151 245 274 201 100 270 180 186 240 159 141 111 161 405 163 192 253 235 207 217 172 139 252 268 133 256 156 126 176 233 256 204 147 300 196 225 203 118 111 197 125 237 183 133 350 -9 191 204 308 209 212 202 173 201 184 138 238 227 235 251 217 
861 86 Maya Mexico AMERICA 126 128 142 129 156 -9 146 126 186 98 130 118 148 227 264 233 173 165 218 -9 183 149 247 144 228 200 192 146 139 203 183 176 158 -9 100 172 120 147 168 -9 208 191 249 115 150 108 231 242 274 207 221 111 129 236 205 303 187 116 98 256 192 127 138 119 163 159 266 237 91 132 266 116 155 157 112 165 249 158 205 133 190 101 140 136 205 246 244 139 179 154 -9 153 190 247 129 193 252 200 122 148 246 201 202 166 170 259 185 127 346 172 192 203 194 164 202 143 244 198 152 188 159 241 155 180 137 220 210 273 259 159 130 155 -9 170 153 173 206 208 148 216 250 232 145 -9 232 141 370 187 181 -9 159 196 157 200 355 212 157 244 119 218 259 234 120 175 243 140 181 234 -9 184 153 183 109 281 195 184 139 200 157 155 113 214 199 154 142 175 320 219 159 245 198 195 173 256 148 237 274 227 120 240 151 188 289 245 175 274 151 264 228 280 191 253 185 267 108 271 108 278 212 269 104 292 331 237 242 294 150 194 213 233 -9 168 278 239 178 189 278 272 184 211 160 159 145 108 287 194 193 246 180 317 245 307 222 133 129 244 157 326 163 261 162 174 158 212 216 264 202 220 282 231 -9 234 172 300 157 235 266 150 328 289 203 257 168 140 188 376 203 201 185 233 184 -9 186 195 306 307 -9 176 168 289 131 150 195 196 212 177 264 296 262 206 188 149 246 210 201 284 139 249 282 201 116 274 204 194 242 163 149 115 169 405 167 200 249 235 203 217 -9 139 272 272 137 264 172 146 240 233 256 204 171 308 202 217 207 134 111 201 127 253 195 129 374 -9 211 204 312 253 220 206 -9 -9 180 146 254 231 235 259 237 
861 86 Maya Mexico AMERICA 120 124 124 127 156 -9 146 124 186 98 130 114 146 217 258 229 165 165 218 -9 175 143 247 132 204 184 188 134 121 199 174 174 158 -9 96 166 120 145 166 -9 208 188 246 115 150 108 225 242 271 195 221 96 117 236 196 288 184 104 89 241 192 121 132 113 163 147 251 234 91 129 260 110 155 157 112 162 228 158 190 127 178 101 131 133 202 228 244 139 179 148 -9 153 190 247 126 181 249 200 119 140 246 197 198 158 170 251 181 123 346 168 188 199 174 152 202 135 236 198 144 184 155 241 155 172 137 200 206 269 247 155 114 151 -9 170 149 161 202 208 124 204 238 228 141 -9 232 133 370 183 177 -9 147 192 153 196 335 212 153 244 119 214 251 234 112 175 225 132 181 234 -9 184 153 179 109 273 195 176 139 196 153 135 109 212 191 142 118 171 320 199 155 245 198 187 169 236 144 225 274 219 116 236 151 184 289 241 171 270 143 260 224 276 187 237 181 251 108 267 104 262 200 253 100 288 319 237 238 290 142 194 185 233 -9 164 270 223 178 177 270 260 180 211 160 155 141 98 283 182 177 242 180 305 241 303 210 125 109 240 149 322 163 245 158 170 150 212 212 260 198 216 270 223 -9 230 172 292 143 235 258 138 324 277 203 233 160 128 172 372 203 189 181 205 172 -9 186 183 302 307 -9 176 148 265 123 146 191 196 172 173 264 292 258 202 188 149 246 194 201 252 135 249 274 201 116 266 200 182 242 139 137 111 161 405 163 192 245 227 199 209 -9 135 264 272 121 256 152 126 236 229 256 204 171 304 192 185 199 134 111 201 127 245 181 129 354 -9 203 204 304 209 216 202 -9 -9 180 138 246 231 227 255 217 
862 86 Maya Mexico AMERICA 122 130 124 137 156 234 140 116 186 100 132 122 148 217 260 233 173 165 -9 -9 189 145 243 136 226 184 210 146 141 199 183 172 158 171 104 166 128 173 168 180 212 185 249 115 150 108 237 239 274 213 221 96 126 233 196 291 190 116 98 241 192 127 144 116 163 159 260 246 91 132 260 113 164 157 112 165 252 155 202 133 187 104 143 133 205 246 244 151 182 160 194 150 184 238 135 193 -9 200 119 156 254 201 198 178 162 263 185 135 342 176 194 203 178 168 202 147 244 194 152 192 155 241 155 184 141 232 214 281 247 147 126 155 149 170 161 173 206 208 128 204 262 232 121 228 228 145 374 187 197 204 147 192 161 204 371 216 157 260 123 214 267 234 120 183 243 140 177 234 255 188 149 183 109 277 187 184 143 200 161 151 109 208 191 158 146 175 320 231 155 245 190 187 177 252 144 237 274 223 120 240 167 176 297 241 187 274 155 272 220 276 191 245 189 263 108 271 108 278 220 257 108 296 323 237 242 294 -9 194 189 233 278 -9 274 239 182 185 282 264 196 211 168 159 145 102 291 182 197 246 184 309 237 307 222 133 125 248 169 326 159 261 170 182 154 208 216 264 202 228 282 209 194 238 176 308 177 255 262 154 328 293 219 229 164 140 176 372 215 197 197 221 180 300 186 179 302 275 140 176 160 269 131 154 183 192 212 181 264 304 266 202 204 149 246 198 213 276 151 253 282 201 100 270 208 202 246 163 165 111 165 405 163 200 249 235 207 217 -9 135 260 264 125 264 160 142 248 237 260 220 159 308 202 221 203 138 119 213 125 245 181 117 346 321 203 216 308 265 212 206 173 213 180 150 266 231 231 259 217 
862 86 Maya Mexico AMERICA 120 128 124 129 142 228 140 116 182 98 130 120 146 217 258 229 169 165 -9 -9 187 145 247 134 204 184 188 134 119 199 183 172 158 165 104 166 120 171 168 174 208 185 246 115 141 108 225 239 271 198 221 96 117 230 196 291 190 116 95 241 192 127 141 113 163 156 251 237 88 126 257 101 161 157 112 165 228 152 190 130 178 104 143 127 205 228 241 142 179 154 194 150 184 235 126 172 -9 200 119 140 246 197 194 158 162 255 181 127 326 172 190 203 178 164 190 143 244 194 148 192 143 241 151 176 137 200 206 273 247 147 122 155 137 166 157 157 202 192 124 204 246 228 121 212 224 133 374 183 193 204 147 184 141 204 343 204 157 240 119 210 259 230 116 175 225 132 177 234 255 180 145 183 109 269 187 180 143 196 161 143 109 208 191 154 142 171 320 219 151 241 190 187 165 252 140 233 274 211 116 236 151 176 289 241 171 274 143 264 216 272 191 241 185 251 108 267 104 270 200 253 104 292 323 237 230 290 -9 194 185 233 274 -9 266 231 178 181 278 256 180 211 164 159 141 102 287 182 181 242 160 309 237 307 210 117 125 244 149 322 159 245 166 182 150 208 212 260 198 224 266 209 174 226 172 304 173 235 262 146 320 257 203 229 164 128 172 364 203 181 193 213 172 288 182 179 294 275 140 176 160 265 119 154 159 188 196 165 264 300 254 202 200 149 246 194 197 252 139 249 274 201 100 270 204 198 242 163 137 111 141 417 159 200 245 227 203 205 -9 131 256 248 121 256 156 134 240 229 252 204 151 304 202 185 199 118 111 201 125 241 181 117 342 309 203 180 304 209 212 202 173 201 180 142 254 227 231 251 209 
863 86 Maya Mexico AMERICA 126 126 146 131 144 234 146 124 186 98 130 120 148 227 260 233 179 165 218 196 187 147 243 134 226 200 204 142 119 207 183 180 158 175 108 166 126 147 164 182 208 191 246 115 156 108 -9 242 277 -9 221 111 129 236 199 294 190 116 98 -9 195 127 147 116 163 156 251 246 94 132 260 116 155 157 115 165 228 155 190 133 193 104 131 136 205 243 244 139 179 166 200 156 184 247 135 190 246 197 119 160 246 197 198 166 170 251 189 131 350 168 194 199 180 168 206 147 244 198 152 200 155 245 159 180 141 232 206 269 259 151 122 151 145 170 153 161 202 212 128 204 238 232 141 228 236 145 382 183 193 208 147 188 193 200 355 212 157 264 115 218 263 234 120 183 243 128 185 242 255 192 157 179 117 277 195 188 139 200 145 159 117 212 191 158 146 171 316 219 155 249 190 195 173 252 144 249 278 227 128 240 167 176 297 241 175 278 155 268 224 280 195 261 185 271 104 267 112 282 220 257 108 296 319 241 234 302 170 194 221 241 286 172 278 239 178 189 282 264 184 219 156 159 149 106 291 198 189 242 180 301 241 307 226 133 133 244 153 326 163 257 170 182 158 212 220 264 198 224 278 223 198 230 184 308 153 263 270 142 320 293 207 261 160 136 180 376 219 189 197 209 192 300 190 187 302 303 140 176 164 269 131 158 191 196 188 177 268 296 262 202 196 157 246 202 213 276 -9 249 282 201 100 266 204 198 242 163 173 111 153 409 167 200 245 235 215 213 172 139 272 268 137 264 164 134 244 237 260 208 171 312 202 185 203 134 121 205 129 257 191 129 354 297 203 216 308 265 216 206 181 217 188 146 266 239 235 271 237 
863 86 Maya Mexico AMERICA 126 126 124 127 142 234 138 116 182 96 130 120 148 227 258 229 173 165 214 194 175 143 243 132 204 184 188 138 119 195 183 174 154 175 94 166 120 145 164 180 208 185 246 115 150 105 -9 230 274 -9 221 96 117 230 196 294 187 104 95 -9 192 121 135 113 163 150 251 237 91 129 260 107 155 151 115 156 228 155 187 121 178 104 125 133 205 237 244 139 179 160 194 150 184 238 126 187 246 197 119 156 246 197 198 162 162 247 181 123 346 168 192 199 176 156 198 147 240 194 148 188 147 237 151 164 141 224 206 265 255 131 118 151 137 170 149 157 198 212 128 204 234 228 121 220 228 133 378 183 181 200 147 184 161 192 343 204 153 264 115 214 263 230 116 183 235 120 177 242 251 192 141 171 109 273 187 176 139 196 145 159 113 210 191 154 146 163 312 199 155 245 190 187 169 240 132 225 278 223 116 236 155 172 289 241 171 270 151 264 220 276 195 253 185 263 104 263 104 262 212 253 100 292 319 241 230 286 150 194 177 233 274 164 274 235 174 173 278 260 180 199 156 159 141 98 283 178 173 242 160 297 237 287 214 125 125 236 145 322 163 245 162 178 158 208 212 264 198 220 278 223 178 226 172 304 143 251 266 138 320 289 199 229 160 136 172 368 211 173 193 209 168 288 186 179 294 303 136 176 152 265 123 146 187 192 184 169 264 292 262 198 188 149 242 194 209 252 -9 245 278 201 100 258 180 174 242 163 149 111 141 409 159 200 237 231 209 205 172 119 252 264 133 256 160 130 200 233 252 204 151 304 202 185 199 118 111 203 123 249 183 117 342 285 203 216 308 241 216 206 177 213 184 142 262 239 227 271 205 
864 86 Maya Mexico AMERICA 126 128 124 137 142 230 138 124 186 98 142 120 148 217 260 233 173 165 218 -9 193 147 251 134 232 208 192 148 141 207 183 180 158 165 106 174 128 145 172 180 208 188 249 124 153 108 237 242 277 210 239 111 117 233 196 297 190 116 95 241 195 133 144 113 166 162 251 246 91 129 266 107 155 157 121 165 240 152 202 130 193 104 -9 133 205 246 244 -9 179 166 197 150 184 241 135 193 249 200 122 156 254 201 198 158 162 251 185 135 338 176 196 211 180 164 206 143 240 198 144 192 159 241 163 176 141 224 206 277 255 159 122 155 149 170 165 157 202 208 136 204 246 232 141 224 240 149 382 183 197 204 147 192 149 204 359 216 157 244 116 214 259 238 120 183 231 140 177 246 255 192 157 187 113 277 187 180 143 196 157 151 121 208 195 158 146 171 324 223 155 245 194 195 173 260 152 233 278 211 116 240 167 184 293 241 187 274 155 264 220 276 195 253 189 271 108 267 108 278 224 269 112 296 327 245 246 302 -9 194 189 233 302 172 274 231 182 185 282 256 184 219 160 159 141 108 291 194 193 250 180 301 249 315 226 133 129 236 169 322 163 253 170 182 158 212 216 264 202 228 282 223 194 230 180 304 173 251 266 158 320 -9 215 257 164 136 176 376 211 193 197 225 172 300 186 179 306 303 140 176 156 293 127 158 187 192 212 177 272 324 262 202 208 153 246 206 -9 268 151 249 274 209 112 274 208 194 242 175 149 111 165 405 171 204 249 235 211 217 172 131 260 268 129 256 164 138 200 237 -9 220 171 308 206 221 199 134 111 203 129 249 181 133 370 313 211 216 324 265 212 206 181 205 188 142 254 243 235 275 229 
864 86 Maya Mexico AMERICA 126 128 124 129 142 228 138 112 186 98 130 120 148 217 258 229 173 165 214 -9 191 143 243 128 204 186 188 144 119 207 183 172 158 165 98 166 120 145 172 180 208 182 249 115 141 108 231 239 274 201 221 96 117 230 196 291 190 113 86 241 192 127 144 113 160 156 251 246 91 126 260 107 146 157 112 162 240 152 190 130 190 98 -9 133 205 243 244 -9 179 166 194 150 184 235 126 193 249 200 119 156 246 197 198 158 162 247 181 119 326 176 190 203 174 152 190 139 240 198 144 184 143 241 151 164 129 200 206 269 251 155 122 155 137 166 153 157 202 204 128 204 242 228 129 224 228 145 374 183 173 200 147 188 149 188 351 212 157 240 111 214 255 234 112 175 225 120 177 234 255 192 149 175 109 277 187 176 139 196 153 151 109 208 191 158 130 171 312 199 155 245 194 183 173 252 140 233 278 211 116 236 151 176 289 241 171 270 143 260 212 276 191 249 185 255 108 267 108 250 212 257 96 292 319 237 242 286 -9 194 181 233 294 172 270 223 174 177 278 256 180 211 152 155 137 102 283 174 189 250 180 301 225 311 218 133 129 224 153 322 163 245 166 178 150 212 204 264 202 224 270 209 174 226 180 292 143 235 258 134 320 -9 199 233 164 136 172 372 203 189 181 209 172 296 182 179 302 275 140 176 148 293 123 154 183 192 196 169 272 296 258 198 200 149 242 194 -9 256 135 249 274 209 100 254 204 194 236 163 137 111 161 405 163 200 249 235 205 217 172 127 252 264 125 256 156 134 176 233 -9 204 151 304 198 221 195 134 111 199 125 241 181 129 362 301 211 216 308 209 212 202 181 201 184 142 250 243 235 251 221 
865 86 Maya Mexico AMERICA 126 124 146 135 156 228 152 112 186 98 130 120 150 217 258 229 165 165 218 194 191 145 245 132 226 188 204 148 141 207 183 176 158 173 104 176 128 147 168 174 212 191 249 115 153 126 -9 242 274 -9 239 111 132 236 205 294 190 -9 95 253 192 133 144 119 -9 159 251 246 88 126 266 110 155 157 118 165 240 155 199 133 193 98 131 136 205 246 -9 148 179 160 -9 153 184 247 126 193 246 200 122 156 246 205 -9 166 166 247 189 127 338 180 190 207 180 156 206 151 248 194 152 192 151 241 155 180 137 200 210 -9 255 155 126 155 133 178 153 173 214 212 124 216 250 232 141 228 240 149 -9 187 193 208 147 188 153 204 -9 216 161 248 -9 214 259 234 116 175 231 132 185 234 259 188 157 179 109 -9 187 180 139 204 149 159 121 214 195 162 150 171 320 223 -9 249 190 195 177 256 156 249 -9 219 116 244 171 188 297 241 191 274 151 -9 228 276 199 253 185 267 108 263 108 278 220 269 100 296 323 249 242 294 162 194 193 233 302 164 278 235 186 181 286 260 196 215 160 155 145 110 291 198 193 242 180 317 237 307 222 133 129 244 169 326 163 249 170 182 158 212 216 268 -9 224 286 213 182 -9 184 304 -9 239 266 -9 332 289 199 261 164 136 180 372 211 181 185 221 176 296 186 195 302 315 144 -9 -9 269 123 158 183 192 208 165 268 300 298 202 208 -9 246 202 209 284 135 245 -9 205 116 270 208 202 -9 163 149 119 165 417 163 204 249 235 203 221 172 131 260 272 133 264 164 134 248 241 -9 204 151 312 202 225 199 134 117 205 129 253 195 117 370 309 203 216 320 265 220 210 181 209 184 150 258 235 231 267 225 
865 86 Maya Mexico AMERICA 120 114 124 133 142 226 140 112 186 98 130 120 148 217 258 229 163 165 218 188 191 143 243 132 204 184 200 146 119 199 183 174 158 171 94 166 120 143 164 174 212 188 249 115 150 108 -9 239 271 -9 221 96 117 236 202 291 187 -9 86 241 192 127 138 113 -9 147 239 246 79 126 260 107 155 157 106 165 228 152 190 133 187 98 131 133 205 246 -9 148 179 160 -9 150 184 247 126 193 246 200 122 156 246 205 -9 162 162 247 185 119 326 168 190 207 158 152 202 151 240 194 144 188 151 241 151 176 133 200 206 -9 247 151 126 155 133 166 153 157 198 204 124 204 238 228 129 220 228 145 -9 183 173 200 147 188 153 196 -9 212 157 240 -9 214 251 230 116 175 231 132 177 234 255 180 153 175 109 -9 187 180 135 196 149 147 109 208 191 154 122 163 308 199 -9 245 190 187 169 240 140 233 -9 211 108 236 155 176 289 225 167 274 151 -9 224 276 195 253 185 263 104 263 100 266 212 265 100 296 319 241 234 286 146 190 189 229 294 164 274 231 186 173 270 256 184 215 144 155 145 100 279 194 173 242 180 301 237 303 214 125 125 240 149 322 159 245 170 182 158 204 212 264 -9 224 266 209 170 -9 176 292 -9 239 266 -9 324 285 199 261 160 128 176 372 203 177 181 209 172 292 178 191 298 303 140 -9 -9 265 123 158 159 184 196 165 264 296 266 202 200 -9 246 202 201 264 135 241 -9 197 100 266 204 182 -9 163 137 115 161 405 143 192 245 231 197 217 168 131 252 268 129 256 164 130 200 237 -9 204 151 308 196 221 195 130 111 199 127 249 195 117 362 293 203 188 308 241 212 206 173 205 184 146 258 231 227 255 225
866 86 Maya Mexico AMERICA 126 128 146 131 156 234 146 124 186 98 142 120 148 227 260 241 173 167 220 -9 193 145 249 136 228 200 204 142 141 199 183 186 158 173 106 172 120 173 172 182 212 188 246 115 141 108 237 239 265 210 239 96 126 236 205 297 190 116 95 256 192 127 138 122 163 159 263 237 94 129 263 113 155 157 118 165 252 152 190 130 187 104 146 136 205 246 244 148 182 160 200 150 190 247 126 190 246 200 119 152 246 201 206 174 162 255 181 127 342 176 190 203 182 168 202 147 240 198 144 192 155 241 159 172 141 228 206 273 247 155 126 155 137 170 161 165 210 212 124 208 246 232 141 224 236 133 382 187 197 204 155 192 161 208 355 212 161 260 119 218 263 234 116 183 235 128 201 238 259 180 153 183 113 281 187 188 143 204 161 163 117 212 191 158 146 175 324 229 155 241 -9 195 173 256 140 233 278 211 112 240 159 176 297 241 187 274 155 268 220 276 187 253 185 263 116 267 108 278 220 257 108 304 323 241 242 290 170 198 209 233 298 164 278 235 182 185 282 264 180 219 168 163 145 98 291 194 197 246 184 313 241 307 222 129 129 248 153 326 159 261 170 182 154 216 216 264 198 216 282 209 178 234 176 308 173 239 266 146 320 293 203 241 168 136 172 372 219 201 197 209 176 292 186 187 298 299 144 -9 164 269 127 162 199 196 196 165 268 -9 262 206 204 -9 246 198 217 288 139 257 282 201 100 278 204 198 246 163 153 119 165 405 -9 -9 249 239 205 217 -9 131 272 268 121 256 164 142 240 241 -9 208 171 312 202 217 203 134 111 205 129 253 181 129 366 317 211 192 308 269 216 206 181 205 184 138 262 235 235 267 205 
866 86 Maya Mexico AMERICA 120 124 124 131 142 230 146 112 182 98 136 114 148 217 258 235 173 165 218 -9 187 143 243 128 204 184 200 134 119 199 183 176 158 165 94 166 120 145 170 180 212 185 246 115 141 105 234 239 265 207 221 96 117 236 196 294 190 116 95 238 192 127 132 113 157 156 251 237 91 123 257 107 155 151 112 165 228 152 190 130 178 104 143 136 205 237 241 142 179 160 194 150 184 247 126 172 246 200 119 140 246 197 198 166 162 255 181 119 338 172 190 199 178 164 190 135 240 194 140 188 143 241 155 168 141 216 206 273 247 151 122 151 137 146 153 157 210 192 120 204 238 232 121 224 224 133 378 187 173 204 147 188 157 200 351 204 161 244 115 218 259 230 116 175 225 120 181 234 243 180 145 175 109 273 183 176 131 196 153 143 109 208 191 154 146 163 324 199 151 237 -9 187 169 244 132 225 274 211 112 236 155 176 293 241 175 258 147 260 220 276 187 245 181 247 108 263 104 270 216 253 100 296 323 237 234 286 146 194 205 233 278 164 270 235 178 177 278 260 180 211 144 159 141 98 283 186 189 242 180 309 237 303 222 117 125 244 153 322 155 245 170 178 154 208 216 264 198 208 278 209 170 226 176 304 173 235 262 138 312 285 199 233 164 132 172 372 211 201 197 209 176 292 186 179 294 275 140 -9 160 265 123 158 163 188 184 181 264 -9 262 202 188 -9 246 194 201 276 135 249 282 197 100 270 200 190 242 163 153 111 165 405 -9 -9 245 227 205 213 -9 119 272 268 121 256 152 134 236 237 -9 204 155 308 192 185 199 134 107 203 125 241 181 117 346 309 211 180 308 209 216 202 173 201 180 138 262 231 231 259 205 
867 86 Maya Mexico AMERICA 126 130 146 129 156 -9 150 116 186 98 140 120 150 217 260 229 173 165 220 -9 187 149 -9 146 224 -9 206 138 141 207 183 176 158 165 106 172 128 171 170 182 212 188 249 115 150 108 237 -9 274 213 239 96 126 236 196 294 190 116 98 244 192 127 141 116 163 159 260 237 91 132 257 113 164 157 112 165 252 152 202 133 187 104 143 133 205 243 244 148 182 160 200 150 184 235 126 190 -9 200 -9 156 246 201 198 162 162 263 189 135 -9 176 190 203 -9 164 190 147 -9 198 152 192 155 241 155 184 141 236 206 281 247 151 126 155 137 170 161 173 210 212 128 216 262 232 121 228 244 149 378 187 193 204 147 192 161 208 355 216 161 260 123 218 267 230 120 175 243 140 181 234 255 192 157 183 113 281 187 180 143 196 161 163 117 214 195 158 154 -9 324 219 155 249 194 195 169 252 144 237 274 223 120 -9 167 176 289 241 187 274 155 264 220 276 191 253 189 263 108 267 112 278 220 257 104 296 323 237 246 290 170 194 205 233 278 168 270 243 182 185 294 264 192 215 -9 159 153 102 287 194 197 246 180 309 245 307 222 121 125 244 -9 326 163 261 166 182 154 216 216 264 202 228 286 223 194 238 184 304 173 255 266 158 328 293 203 229 164 140 172 372 215 201 197 213 180 296 186 187 302 275 140 200 164 269 127 154 183 196 196 165 264 304 266 206 204 153 246 206 217 280 139 253 282 201 100 270 208 202 242 163 153 111 165 405 159 200 249 231 205 213 -9 131 272 268 125 264 160 134 240 233 260 224 159 304 202 217 203 118 119 213 125 245 181 133 346 -9 211 216 316 249 216 206 173 201 184 142 266 231 231 -9 217 
867 86 Maya Mexico AMERICA 120 128 124 129 154 -9 140 112 182 96 132 120 148 217 258 229 173 165 218 -9 175 145 -9 136 204 -9 188 134 119 199 183 172 158 165 104 166 128 147 168 180 208 185 246 115 141 105 234 -9 265 210 221 96 117 230 196 291 190 116 95 241 192 121 132 113 163 156 251 237 91 126 257 107 155 154 112 162 240 152 190 130 187 104 143 127 205 228 241 142 182 160 194 150 184 235 126 172 -9 200 -9 152 246 197 198 158 162 255 185 131 -9 168 188 203 -9 160 190 135 -9 194 148 192 143 241 155 176 137 232 206 269 247 147 122 151 137 150 149 169 206 208 128 204 250 228 121 224 224 145 374 183 173 204 147 188 161 204 343 216 157 260 119 210 259 230 116 175 225 132 177 234 243 180 145 175 109 269 187 180 131 196 157 143 109 208 191 142 146 -9 320 199 151 241 190 187 165 240 132 225 274 211 116 -9 151 172 289 241 175 258 147 260 216 276 187 241 185 263 104 263 108 266 200 253 100 288 319 233 230 286 170 194 189 229 278 164 266 231 178 173 278 260 180 211 -9 151 145 98 287 182 197 242 160 305 237 307 218 117 125 240 -9 322 159 253 166 182 150 208 212 264 198 220 282 209 178 226 172 304 173 235 262 154 328 257 199 229 164 132 172 372 203 197 189 209 176 288 186 187 294 275 136 176 160 265 119 154 159 192 196 173 264 296 258 202 188 149 246 198 197 280 135 249 282 197 100 254 208 198 242 147 137 111 141 405 159 192 245 227 203 205 -9 119 256 264 121 256 148 134 236 229 252 204 151 304 202 185 195 118 111 203 125 245 181 117 346 -9 203 180 308 209 212 206 173 201 180 138 258 231 231 -9 205 
868 86 Maya Mexico AMERICA 126 128 124 135 156 234 152 112 186 100 136 120 168 217 264 241 173 165 224 -9 189 149 247 142 226 200 206 144 119 207 183 180 162 173 100 174 120 143 170 180 212 188 252 121 141 120 234 242 274 213 236 96 129 236 196 309 190 113 95 256 192 127 132 122 163 156 266 246 91 135 263 110 164 157 112 165 240 155 190 133 193 113 143 133 205 246 247 142 179 160 194 153 190 247 135 193 252 200 119 156 254 205 166 158 166 263 193 131 338 176 196 203 180 168 206 147 244 194 144 196 155 241 159 176 141 220 210 273 247 147 122 155 137 174 157 169 202 208 124 216 254 232 137 228 236 149 390 187 177 204 147 188 157 200 355 216 161 260 115 222 263 234 120 175 231 140 201 238 259 192 161 187 113 277 187 184 131 204 157 155 109 212 195 158 150 175 320 219 155 245 190 187 173 240 148 233 274 223 120 240 167 176 297 245 187 278 151 272 220 272 199 249 189 263 112 267 108 262 220 269 104 300 323 245 234 290 150 202 213 241 298 172 278 239 182 173 282 264 -9 215 168 163 141 110 291 198 197 246 188 313 245 315 214 125 125 236 153 322 167 253 166 182 154 208 216 268 202 224 282 223 178 234 176 308 173 239 266 154 328 297 207 261 172 136 192 372 207 189 185 229 176 300 182 191 298 307 144 196 164 265 131 158 183 192 208 165 264 -9 266 206 188 149 246 206 205 268 139 253 282 201 108 270 208 202 246 175 137 111 165 405 163 200 253 -9 213 213 -9 139 264 268 125 268 168 130 248 237 260 204 151 304 196 185 203 142 119 207 129 249 195 117 350 289 211 212 312 237 216 210 177 209 180 138 254 227 231 267 237 
868 86 Maya Mexico AMERICA 126 128 124 129 142 234 140 112 182 96 130 120 148 217 262 229 173 165 218 -9 187 147 247 132 204 184 188 134 119 199 183 174 148 161 96 172 120 143 168 174 208 185 246 115 141 108 231 239 271 213 221 96 126 233 196 306 190 107 95 241 189 127 132 119 163 150 263 234 79 126 260 107 155 157 109 156 228 155 187 127 193 104 137 133 205 243 244 142 179 160 194 150 184 247 126 181 249 200 119 152 246 201 198 158 162 255 181 119 326 176 190 203 178 160 190 143 240 194 144 188 155 233 155 176 137 200 206 273 247 147 118 155 133 166 146 161 198 208 124 212 250 228 121 212 236 141 378 183 177 200 147 188 157 192 343 212 157 240 111 214 259 230 112 175 225 140 189 234 255 172 153 183 105 273 183 180 131 196 149 147 105 208 191 154 126 171 320 199 155 245 190 179 169 240 148 233 274 207 116 236 151 176 297 241 171 258 147 268 220 268 199 241 185 263 104 263 108 254 216 257 84 296 323 241 234 290 146 198 193 237 282 164 270 235 178 169 278 260 -9 215 160 155 141 106 291 186 173 246 160 301 241 307 210 121 125 236 153 322 159 253 162 178 154 204 212 260 198 224 278 209 174 234 172 292 143 235 266 142 320 289 203 229 168 128 172 368 203 185 181 209 168 300 182 179 298 303 140 176 152 265 127 154 179 188 208 173 264 -9 266 202 188 149 234 194 197 252 135 249 282 201 100 270 200 198 246 163 137 111 161 405 163 196 225 -9 207 205 -9 119 264 264 125 256 156 126 244 229 260 204 151 304 196 185 203 134 117 203 125 241 181 117 366 285 191 208 312 209 212 206 173 209 180 138 250 223 231 263 217 
869 86 Maya Mexico AMERICA 126 130 124 129 156 234 146 116 186 98 142 120 148 225 258 233 173 165 218 194 189 145 249 134 204 -9 204 146 139 207 183 176 154 165 100 172 132 145 168 180 212 188 249 115 150 120 234 239 274 195 236 111 138 236 205 294 187 107 98 256 189 127 141 119 163 156 251 237 91 129 260 107 158 157 115 165 234 155 190 133 196 104 137 136 205 243 -9 148 185 163 194 150 184 247 138 193 249 200 119 -9 -9 205 202 166 174 251 201 123 342 180 194 203 178 160 206 143 244 198 148 188 151 241 159 172 129 220 206 -9 247 151 126 155 153 170 153 177 202 208 144 212 250 229 145 228 232 145 382 187 181 208 147 -9 -9 200 347 216 161 264 119 222 259 238 120 183 235 136 193 238 -9 192 153 187 109 281 199 180 143 204 153 147 117 214 195 142 146 171 320 219 159 241 198 187 169 240 144 233 282 215 120 240 159 188 293 241 171 274 159 -9 220 276 195 253 185 259 108 267 108 286 220 257 108 300 323 245 234 294 162 198 181 233 302 172 278 239 178 189 286 264 188 215 156 159 141 106 287 198 193 250 -9 305 241 315 222 125 129 244 173 326 167 249 170 178 162 216 220 260 198 224 282 223 178 -9 184 -9 173 255 266 162 320 289 215 261 160 128 180 372 211 189 197 213 176 304 190 179 298 303 140 192 164 273 -9 158 199 192 208 173 272 292 290 210 200 153 250 202 201 272 151 249 282 217 112 274 204 194 246 179 153 111 161 405 167 204 253 247 205 217 172 135 264 260 129 264 164 134 244 245 260 -9 167 308 202 185 203 142 111 205 129 253 195 117 370 -9 191 180 308 269 212 210 177 209 188 138 258 227 235 267 209 
869 86 Maya Mexico AMERICA 126 128 124 129 142 228 140 112 182 98 130 120 148 217 258 231 165 165 218 190 175 143 243 134 204 -9 188 146 119 199 183 176 154 161 100 166 132 145 168 174 208 182 246 115 141 108 231 239 274 195 221 96 126 230 196 288 187 107 86 256 189 121 132 113 160 141 239 234 91 126 260 107 155 157 112 165 225 155 190 130 196 98 137 133 205 228 -9 142 179 160 194 150 184 241 126 190 246 200 113 -9 -9 197 198 158 162 247 185 119 334 168 190 203 178 152 198 143 240 198 144 188 151 237 151 172 129 220 206 -9 247 151 126 151 153 170 149 157 202 204 124 204 234 208 141 212 228 145 378 183 177 204 147 -9 -9 196 347 204 161 248 111 218 259 234 116 183 225 128 177 234 -9 188 153 179 109 277 187 176 139 196 149 143 105 210 191 142 122 163 320 205 155 237 198 183 169 236 144 233 270 207 116 236 151 176 289 241 171 270 147 -9 216 276 191 241 181 251 104 263 104 262 216 257 100 296 319 233 230 294 146 186 181 233 278 168 274 223 178 173 278 260 180 211 144 159 141 98 283 182 185 250 -9 301 237 299 218 125 125 224 157 322 155 249 166 174 154 212 216 260 198 220 266 209 178 -9 172 -9 173 235 262 134 320 289 207 229 160 128 176 368 207 181 185 209 172 288 178 179 294 303 140 176 164 265 -9 158 195 188 196 173 268 292 258 202 196 153 230 186 197 272 143 249 274 201 100 270 200 174 242 163 137 111 141 405 163 192 249 235 205 213 160 127 260 256 121 256 156 130 244 237 260 -9 167 308 196 185 199 118 111 203 123 245 181 117 346 -9 191 168 308 237 212 206 173 205 184 138 254 227 227 263 205 
870 86 Maya Mexico AMERICA 128 128 148 137 142 234 138 112 186 98 136 114 150 227 264 233 173 -9 218 194 191 143 245 140 234 186 188 144 139 207 183 180 158 173 112 166 120 145 172 182 208 185 252 -9 156 108 234 242 280 201 221 111 117 236 208 306 190 113 101 259 195 127 144 119 166 153 251 237 91 132 263 107 155 157 121 162 240 155 190 133 193 104 146 133 205 228 247 148 179 166 197 153 184 247 126 196 249 200 119 160 250 201 202 166 170 259 189 127 338 168 192 207 180 160 202 143 248 -9 152 192 155 241 155 180 137 224 206 309 -9 147 114 155 133 170 153 169 202 208 128 208 246 236 121 228 244 145 378 183 177 204 155 200 157 196 355 212 -9 260 119 218 263 238 120 183 243 140 193 238 255 188 153 179 109 281 191 184 131 200 157 159 117 218 191 154 158 171 324 211 155 237 190 187 177 240 152 233 278 231 124 240 167 188 297 249 187 274 151 264 220 -9 195 249 181 271 104 263 108 262 -9 257 104 308 331 241 246 298 170 198 185 241 306 168 274 247 174 177 282 264 188 219 156 155 141 106 287 198 193 -9 180 305 237 311 210 125 125 248 157 326 163 253 170 178 154 208 220 264 198 220 282 223 178 234 180 304 173 239 270 154 324 289 207 233 168 140 184 380 207 189 193 221 172 300 182 187 302 303 144 -9 152 289 123 158 159 192 212 177 268 300 266 202 208 -9 -9 202 209 268 151 253 282 201 104 254 204 -9 250 -9 149 119 161 -9 167 -9 249 239 205 217 -9 131 260 276 125 264 164 134 244 233 -9 220 159 312 202 213 207 -9 121 199 129 253 195 129 374 313 211 216 312 265 216 210 181 213 184 146 262 231 231 267 233 
870 86 Maya Mexico AMERICA 126 124 124 129 142 234 138 112 182 98 130 114 148 217 262 229 165 -9 218 186 191 143 243 134 232 184 188 138 119 199 174 176 154 165 100 166 120 145 172 180 212 182 246 -9 141 108 225 236 271 195 221 96 117 236 199 294 187 113 86 256 195 127 132 113 157 150 251 234 91 129 260 107 155 151 115 156 228 152 190 130 190 104 137 133 205 228 244 148 179 160 194 150 184 247 126 190 246 200 119 156 246 197 202 162 162 255 181 127 334 168 188 203 180 156 190 139 244 -9 148 192 151 237 155 164 129 200 200 309 -9 147 114 151 133 170 149 165 202 204 128 204 242 228 121 228 232 141 374 183 173 200 147 192 153 192 355 212 -9 244 116 214 263 230 116 175 231 132 185 234 255 180 149 179 109 273 191 180 131 200 145 147 117 212 187 142 150 163 320 199 151 237 190 183 173 240 144 233 274 207 116 236 159 176 297 241 171 270 147 264 220 -9 187 245 181 263 104 263 108 258 -9 253 96 292 319 237 234 286 162 194 185 233 298 164 266 231 174 173 278 260 180 211 148 155 141 98 283 194 189 -9 160 297 229 307 210 117 125 224 157 322 155 249 166 178 150 208 216 264 198 220 278 209 178 230 172 292 169 235 266 142 320 289 199 229 160 128 176 372 203 185 181 209 164 296 178 183 298 275 140 -9 148 289 119 158 159 192 212 173 264 292 266 198 200 -9 -9 198 205 252 135 249 282 197 100 254 180 -9 246 -9 137 115 141 -9 167 -9 249 235 201 205 -9 131 252 268 125 264 160 130 244 229 -9 204 151 304 192 205 203 -9 117 199 124 249 181 117 366 305 211 212 312 265 216 206 177 213 172 138 254 227 227 259 205 
871 86 Maya Mexico AMERICA 128 128 148 129 154 228 140 116 186 98 130 120 148 225 258 233 177 165 218 198 193 147 247 140 222 200 188 138 137 205 183 172 154 169 108 172 -9 145 170 180 212 188 249 115 150 120 234 239 277 207 221 111 138 236 205 309 187 116 98 244 195 127 144 119 163 150 266 240 88 129 263 107 158 157 115 165 228 158 190 130 187 104 134 136 205 249 244 151 179 160 197 156 196 253 135 199 246 200 128 152 246 201 166 162 174 255 185 123 334 176 196 199 180 160 202 143 240 194 144 188 155 241 155 172 137 240 206 281 251 151 122 163 133 170 165 181 210 208 124 212 246 236 121 228 236 153 374 183 181 204 155 188 185 208 355 216 157 240 120 218 263 234 120 175 243 132 201 238 259 180 153 187 117 281 195 184 139 200 157 147 113 212 191 146 154 171 312 225 155 245 190 211 173 260 144 245 278 227 112 236 163 184 297 241 167 262 163 264 -9 276 183 249 185 271 112 267 108 274 216 257 100 296 -9 245 238 294 162 194 189 233 -9 168 278 239 178 181 286 264 188 215 164 159 157 106 291 202 193 242 184 305 241 303 214 129 -9 244 169 326 167 249 170 182 158 212 220 264 198 220 -9 223 174 238 176 304 173 239 266 146 320 293 207 229 176 136 176 376 211 -9 201 229 176 304 186 179 302 307 140 -9 164 289 131 162 163 200 212 173 272 300 294 202 188 -9 234 194 209 268 143 249 282 201 116 266 204 194 242 167 165 111 165 405 163 196 249 235 207 217 176 139 260 268 125 256 172 134 256 241 -9 204 155 308 202 225 203 134 121 201 125 249 195 117 370 305 211 180 316 265 216 202 181 209 184 150 258 235 231 255 229 
871 86 Maya Mexico AMERICA 126 124 124 125 142 226 140 112 182 98 130 120 148 217 250 229 147 165 218 194 175 141 243 132 218 184 188 136 119 201 183 172 154 161 102 166 -9 143 168 174 212 185 246 115 150 108 234 239 271 207 221 96 117 218 196 309 184 113 95 235 189 121 132 113 163 150 239 237 79 126 260 107 158 157 115 162 225 152 190 130 187 104 131 136 202 237 244 148 179 160 179 150 193 241 126 193 246 200 119 152 246 197 198 158 162 247 181 119 322 172 194 191 168 156 198 135 240 194 140 188 155 237 151 172 133 216 206 273 247 147 122 151 133 146 157 173 198 204 124 204 238 232 121 228 232 133 370 183 173 192 147 188 117 196 351 208 157 240 119 214 263 234 116 175 229 132 171 234 255 172 153 179 117 277 191 176 131 192 149 143 113 208 191 142 146 163 308 215 151 245 190 187 169 256 136 233 270 223 112 236 159 172 289 225 167 258 151 264 -9 276 183 245 177 247 108 263 100 250 216 257 96 296 -9 237 234 294 146 186 181 233 -9 164 274 239 178 177 278 260 180 211 144 159 145 106 287 194 189 242 176 301 241 303 210 121 -9 240 149 322 163 249 170 182 154 204 212 260 198 220 -9 223 170 226 168 304 173 235 258 142 320 285 199 217 168 124 172 372 203 -9 197 209 172 292 178 179 294 275 140 -9 164 265 123 154 159 184 212 169 268 300 266 202 188 -9 230 194 205 260 139 245 282 197 100 254 180 194 236 139 149 111 149 405 159 192 225 231 205 213 172 127 256 268 125 256 152 130 200 237 -9 204 151 304 202 185 203 118 119 199 125 245 183 117 354 305 191 180 300 237 216 198 181 201 184 142 250 227 231 255 205 
872 86 Maya Mexico AMERICA 122 126 124 135 142 240 140 112 186 98 130 120 148 225 260 233 163 165 218 194 187 147 253 140 230 186 200 134 139 203 183 186 158 177 106 166 130 175 168 180 212 188 249 115 156 120 225 242 277 -9 239 96 126 236 199 306 190 116 95 256 195 127 138 113 163 -9 263 249 94 135 263 113 164 157 109 165 240 152 202 133 193 107 143 133 205 246 238 148 184 160 194 153 184 247 135 172 246 200 119 160 246 201 202 166 170 255 185 127 338 180 196 203 178 164 202 143 244 194 144 196 155 241 159 176 141 224 210 309 255 151 122 155 156 166 157 173 206 208 128 208 246 228 141 228 232 145 382 183 193 204 155 192 153 196 359 216 161 260 116 218 263 234 120 183 243 136 197 242 259 192 157 183 113 273 195 184 147 196 157 159 121 206 191 154 150 175 320 225 159 245 198 183 177 256 152 233 278 219 116 244 167 176 297 241 175 274 155 268 224 280 195 253 189 267 104 267 108 278 220 257 112 296 331 241 238 302 170 194 209 233 274 168 274 239 186 193 282 264 184 215 156 159 149 -9 291 178 193 250 184 301 237 311 226 137 125 244 161 322 163 253 170 182 158 212 216 268 202 224 286 209 194 234 180 304 173 255 -9 142 324 289 207 233 168 136 180 372 211 193 189 225 184 300 182 183 298 307 144 196 168 269 131 158 191 192 196 169 272 300 -9 202 204 149 246 198 201 280 139 249 282 205 112 274 204 206 242 163 173 119 173 417 175 200 249 239 215 213 172 135 256 272 137 256 164 142 244 233 260 204 151 312 198 185 203 134 119 207 129 249 187 117 350 309 211 216 316 265 216 206 181 205 188 142 254 231 235 267 221 
872 86 Maya Mexico AMERICA 120 114 124 131 142 226 138 112 180 96 130 114 148 217 258 229 147 165 218 194 185 133 233 132 204 184 188 134 119 199 183 176 158 175 104 166 120 147 168 174 208 185 249 115 141 108 225 242 271 -9 221 96 123 230 196 288 190 113 89 238 192 121 132 113 160 -9 251 246 91 123 260 107 155 157 109 162 234 152 190 130 187 104 137 133 205 237 227 139 179 160 179 150 184 247 126 172 246 200 119 152 246 197 202 158 162 247 181 123 322 172 192 195 172 160 202 139 240 194 144 180 147 237 159 172 133 200 206 265 247 147 122 151 149 166 145 157 202 208 124 204 246 224 129 224 228 133 378 183 177 204 147 188 117 192 351 212 157 244 111 214 263 230 116 179 225 128 185 238 255 180 157 179 109 269 191 180 131 188 149 147 105 206 191 142 138 171 316 199 155 245 194 179 177 244 140 233 274 219 112 240 155 172 289 241 167 270 143 268 224 272 187 249 185 263 104 263 108 266 212 253 108 292 319 233 234 290 166 194 189 233 270 164 270 231 178 185 278 260 184 215 144 159 141 -9 287 174 193 242 180 297 237 307 210 121 121 244 153 322 159 249 166 178 150 204 204 264 202 220 278 209 194 226 172 304 143 251 -9 142 316 289 199 233 164 136 172 372 211 185 189 213 160 296 182 183 294 299 144 176 164 265 119 150 191 192 196 169 264 292 -9 194 192 149 242 198 197 256 135 245 270 201 100 266 200 198 242 163 169 115 161 405 163 200 249 231 209 205 156 135 252 252 121 256 160 126 200 233 252 204 151 304 196 185 191 134 111 199 127 245 183 117 374 305 191 204 312 209 212 206 173 205 188 142 250 227 231 267 205 
873 86 Maya Mexico AMERICA 126 128 124 139 156 -9 140 112 190 98 132 120 148 227 258 235 173 165 220 -9 193 149 251 134 230 200 192 148 139 207 183 180 158 175 102 166 130 167 168 180 212 188 249 115 150 108 234 242 271 210 239 111 126 236 202 294 190 116 89 241 192 130 141 113 166 156 251 246 91 126 260 110 155 157 -9 165 240 152 190 133 -9 104 137 136 205 246 227 145 179 166 200 156 184 250 135 196 246 200 119 156 246 205 202 166 166 259 185 135 346 176 194 207 178 156 202 151 244 194 152 192 155 241 167 176 141 220 210 313 247 151 126 -9 153 170 153 173 214 -9 140 216 250 228 145 228 236 145 374 183 197 204 163 188 161 192 355 224 157 248 107 222 263 234 116 187 243 140 177 242 255 192 157 179 121 281 195 184 143 208 153 159 121 218 191 158 150 171 316 219 167 245 198 183 173 252 140 233 274 227 116 244 159 180 293 245 175 274 151 264 224 276 -9 253 185 267 108 267 104 274 220 269 108 296 327 237 242 298 146 194 189 237 306 164 278 239 182 173 286 260 180 215 160 163 157 106 287 194 193 250 180 301 241 311 222 129 125 248 157 326 163 257 170 182 158 208 212 268 202 232 286 223 174 230 184 308 169 235 262 158 316 293 203 261 168 132 176 376 207 185 189 221 176 288 186 191 298 307 144 196 164 -9 131 162 191 192 208 165 272 296 302 202 204 153 246 202 213 276 135 249 282 201 116 270 204 198 246 163 149 119 165 405 163 204 249 239 211 217 172 131 256 268 137 256 168 134 248 245 260 220 151 -9 202 229 203 138 119 205 129 245 187 129 374 309 211 216 312 265 216 202 173 217 192 146 258 231 231 267 209 
873 86 Maya Mexico AMERICA 120 128 124 129 142 -9 138 112 182 96 130 120 148 227 258 229 163 163 218 -9 187 145 243 132 228 200 188 144 139 199 183 172 158 173 94 166 120 145 168 174 208 185 249 115 141 108 234 239 271 195 221 96 117 230 196 291 190 113 86 241 192 121 138 113 166 156 251 237 91 126 260 110 155 157 -9 165 228 140 190 133 -9 104 137 133 205 243 227 142 179 160 194 150 184 247 126 172 246 200 119 140 246 197 202 166 162 255 185 119 338 168 190 199 178 156 202 143 244 190 140 188 155 241 151 172 137 200 210 269 247 151 118 -9 133 170 145 169 202 -9 128 204 246 228 121 224 236 133 374 183 173 204 159 188 153 192 351 212 153 244 97 210 259 230 116 183 243 128 177 238 255 188 149 179 109 281 195 180 139 196 149 151 113 212 191 154 150 171 308 215 155 237 198 183 173 248 140 225 266 211 116 236 147 176 293 241 171 270 151 260 220 268 -9 245 181 263 104 263 100 266 216 257 104 296 323 233 234 290 146 194 185 233 282 164 274 239 178 173 282 260 180 203 144 159 145 106 287 178 177 250 180 301 237 307 210 125 125 244 149 322 159 245 166 174 150 208 212 264 198 216 278 209 170 226 180 304 157 235 258 146 316 293 199 233 164 128 176 372 203 181 185 213 164 288 178 179 298 303 140 176 148 -9 123 158 183 188 184 169 268 292 262 202 200 141 246 202 213 256 135 249 274 197 100 270 180 182 242 163 149 111 141 405 159 204 245 227 209 205 172 123 252 264 133 256 164 134 240 229 256 220 151 -9 196 225 203 134 107 199 129 245 181 117 350 305 203 216 312 249 212 202 173 205 180 146 258 231 231 263 209 
874 86 Maya Mexico AMERICA 126 126 142 135 158 228 152 116 186 98 130 120 148 223 258 233 175 -9 220 198 193 143 249 134 228 186 188 148 141 205 183 180 158 173 106 176 128 145 170 180 212 188 249 115 150 -9 225 239 -9 210 221 111 117 236 208 306 187 116 95 256 192 127 144 119 163 159 251 246 91 132 266 110 155 157 115 165 240 152 190 136 -9 104 146 133 214 246 244 148 182 160 194 153 190 247 141 196 246 200 122 156 254 205 -9 166 166 259 181 131 338 -9 198 207 180 156 206 151 248 202 144 200 155 -9 151 176 129 224 206 313 251 151 126 -9 -9 170 161 173 198 204 140 216 250 -9 129 228 232 145 382 187 181 204 163 200 153 196 355 224 -9 240 115 222 255 234 124 183 243 140 205 238 259 180 -9 179 109 273 195 184 135 208 149 147 121 214 191 158 146 171 324 219 155 249 -9 187 177 240 140 249 274 227 116 244 159 188 293 241 175 274 151 264 224 -9 195 257 185 271 108 267 104 278 -9 265 108 300 323 249 246 294 170 202 193 233 286 174 278 239 186 189 282 264 188 215 156 163 145 110 287 194 193 -9 188 317 253 307 222 125 125 244 169 322 163 -9 170 178 154 208 220 264 198 224 286 223 174 234 184 304 169 247 266 146 328 293 207 229 164 132 180 372 211 181 197 221 184 -9 186 191 298 315 140 176 164 -9 127 158 191 192 -9 177 272 324 302 202 -9 149 242 198 213 276 151 245 274 -9 100 270 208 198 242 -9 153 111 165 417 167 -9 253 235 207 221 180 131 256 -9 137 256 168 134 236 241 260 224 151 308 202 225 203 138 111 205 129 249 181 133 354 317 203 212 312 241 216 210 181 205 184 -9 254 243 235 271 -9 
874 86 Maya Mexico AMERICA 120 124 124 129 142 226 138 112 186 96 130 120 148 217 258 229 163 -9 218 194 183 143 249 132 222 184 188 144 119 199 183 176 154 171 98 166 128 145 166 174 208 185 246 115 141 -9 225 224 -9 207 221 96 117 230 196 294 187 113 86 238 186 127 132 113 163 153 239 237 88 132 260 101 155 157 112 156 240 152 190 130 -9 104 137 133 205 243 244 145 179 160 179 150 184 247 135 193 246 197 119 156 246 205 -9 166 162 247 181 131 326 -9 190 199 180 152 190 151 244 198 144 196 155 -9 151 172 129 200 206 269 247 147 110 -9 -9 170 153 157 198 204 128 204 242 -9 121 228 228 145 378 183 173 204 147 188 153 192 355 216 -9 240 111 214 251 234 120 175 235 132 185 234 255 180 -9 179 109 269 187 184 131 196 149 143 109 212 191 154 138 171 308 199 151 245 -9 183 177 240 132 233 274 215 116 240 151 176 289 241 167 274 147 260 220 -9 191 245 181 267 104 263 104 278 -9 253 96 288 319 245 230 294 146 194 189 229 270 164 274 235 178 173 278 260 180 215 144 159 141 98 283 178 193 -9 180 309 237 303 222 125 125 240 153 322 159 -9 170 178 154 204 212 264 198 216 286 209 170 226 172 304 169 235 262 138 320 285 203 225 164 128 172 372 211 177 185 209 164 -9 186 191 298 275 140 176 144 -9 123 158 183 184 -9 177 264 296 266 202 -9 141 234 190 209 256 135 241 262 -9 100 258 204 198 242 -9 149 111 161 405 163 -9 249 231 205 221 176 131 252 -9 133 256 152 134 200 233 260 216 151 308 196 185 203 130 107 199 127 245 181 133 354 297 203 208 304 241 212 202 173 201 180 -9 250 231 231 267 -9
875 86 Maya Mexico AMERICA 126 130 140 129 156 234 138 120 188 98 130 120 148 227 258 241 165 165 222 194 191 -9 249 136 226 -9 190 144 139 -9 -9 180 158 -9 106 172 120 147 176 182 212 188 246 115 144 108 234 242 274 195 -9 111 129 236 208 306 187 116 95 241 192 133 138 119 166 156 -9 237 91 129 263 110 155 157 115 165 228 152 190 133 -9 -9 146 -9 205 246 247 142 184 -9 200 156 184 247 135 193 252 200 119 156 -9 201 202 166 162 255 185 135 -9 176 196 207 180 160 202 143 244 194 140 200 155 -9 155 184 -9 228 210 313 259 151 130 151 -9 170 161 157 206 212 140 216 250 232 137 228 240 145 382 187 181 204 159 188 161 204 351 208 157 264 119 218 263 234 116 -9 243 140 177 242 255 192 157 179 109 285 195 180 143 196 153 159 113 214 191 162 138 175 324 231 155 245 194 187 173 -9 144 233 274 223 112 -9 167 192 293 249 187 274 155 268 224 268 191 257 185 255 108 263 108 290 220 261 108 300 327 249 242 294 166 198 197 233 -9 170 -9 235 178 189 282 264 200 219 156 159 149 106 287 182 197 254 188 305 241 311 222 129 129 244 157 330 163 253 170 178 158 208 212 264 202 220 282 213 170 226 172 -9 173 239 -9 174 320 293 -9 261 164 140 184 376 219 201 197 229 176 296 186 179 298 307 140 -9 168 289 127 158 195 200 212 177 268 304 274 206 200 -9 246 206 213 264 139 253 282 201 100 278 204 194 246 167 169 119 141 409 167 -9 253 231 207 217 180 139 260 272 133 268 172 158 220 237 -9 216 163 312 202 221 199 134 121 203 125 253 187 133 374 -9 211 204 320 265 220 210 181 205 184 146 250 227 235 263 233 
875 86 Maya Mexico AMERICA 120 128 128 129 142 228 136 116 182 96 130 114 148 217 258 229 163 165 218 190 187 -9 245 132 204 -9 188 136 119 -9 -9 176 158 -9 100 172 120 145 170 174 208 188 246 115 141 105 225 242 274 195 -9 96 117 230 199 291 184 113 95 238 192 127 132 116 163 147 -9 237 88 126 260 110 155 157 112 162 228 152 190 130 -9 -9 137 -9 202 246 244 139 179 -9 179 150 184 238 126 190 246 200 119 152 -9 197 198 166 162 255 185 119 -9 172 194 195 178 152 190 143 236 190 140 188 151 -9 151 176 -9 224 206 269 247 143 118 151 -9 170 161 157 202 196 136 204 242 232 121 224 236 133 378 183 173 204 147 188 145 192 343 204 149 244 115 210 259 234 116 -9 239 140 177 234 255 188 149 175 109 269 187 172 139 196 153 143 109 200 183 146 126 171 308 219 155 233 194 183 169 -9 132 225 270 207 108 -9 159 188 293 225 175 258 143 264 220 264 187 253 181 251 104 263 108 278 208 253 84 296 327 237 238 294 146 186 189 229 -9 164 -9 231 178 177 270 260 184 211 140 155 149 100 271 174 189 246 180 301 241 307 214 121 129 236 153 322 163 249 166 178 150 208 212 264 198 212 282 209 158 226 172 -9 169 235 -9 142 316 285 -9 229 160 128 172 364 203 189 189 221 172 296 170 179 298 295 140 -9 164 289 123 154 155 196 212 177 268 296 262 202 188 -9 246 190 209 252 135 245 274 197 100 254 200 186 246 139 169 111 141 405 159 -9 245 227 205 213 172 127 252 260 125 256 164 146 204 233 -9 204 155 312 196 213 191 134 119 203 123 245 183 117 370 -9 211 180 320 265 212 210 181 201 184 142 250 227 235 255 205 
876 86 Maya Mexico AMERICA 126 124 142 129 156 230 146 124 186 98 142 120 148 225 264 233 173 167 218 196 185 143 247 134 204 184 204 138 119 209 183 184 158 175 102 172 120 145 170 180 212 182 249 115 150 108 231 242 271 195 236 111 129 239 205 300 190 107 101 256 192 127 141 122 166 153 251 249 91 126 263 113 158 157 115 165 249 152 -9 133 196 113 137 139 205 246 244 148 179 166 194 159 184 247 135 184 249 200 128 148 254 201 166 166 174 251 197 127 346 172 188 195 182 160 206 143 244 202 152 196 159 241 159 180 137 224 210 281 259 159 126 155 148 170 157 165 206 204 132 220 254 216 141 228 -9 149 382 187 177 204 159 188 157 200 355 216 165 256 123 222 259 238 120 183 243 128 193 246 259 180 161 183 113 281 -9 184 135 200 153 159 117 214 191 158 142 171 328 215 151 241 202 187 169 252 148 237 274 227 112 244 -9 184 293 241 191 262 155 268 216 272 195 261 185 263 104 267 108 282 220 269 108 300 323 241 234 302 162 198 205 233 294 172 274 239 174 193 282 260 184 219 156 159 157 108 287 202 193 246 184 313 241 315 218 133 125 248 169 326 163 261 170 174 158 208 220 260 202 220 282 223 178 234 180 304 165 259 266 146 320 293 203 233 160 136 172 376 207 201 201 209 176 296 182 191 306 307 144 188 168 273 131 158 195 192 212 173 268 300 290 202 204 153 242 202 213 280 135 253 282 201 116 286 208 198 246 163 165 111 165 417 167 200 249 235 213 217 172 131 272 268 141 256 160 154 244 245 260 204 167 304 202 217 207 146 125 203 129 249 181 129 362 305 203 204 316 209 220 202 181 209 188 146 262 231 235 271 205 
876 86 Maya Mexico AMERICA 120 116 124 129 142 226 136 120 182 98 136 120 146 217 262 229 163 165 218 194 175 141 243 132 204 184 200 134 119 203 183 180 154 165 92 166 120 145 168 176 208 182 249 115 150 108 225 242 271 195 221 96 126 230 196 288 187 104 95 256 192 127 138 119 163 150 251 237 76 123 260 113 155 157 112 162 228 152 -9 130 193 104 131 133 202 243 227 142 179 148 194 150 184 241 126 181 246 194 119 140 254 201 198 166 162 251 185 123 322 168 188 191 178 152 202 143 240 198 140 188 147 229 155 164 133 200 206 269 247 147 122 151 133 166 153 157 202 204 124 208 254 208 121 224 -9 133 374 183 177 204 147 184 153 196 351 204 153 244 119 210 259 234 116 175 229 120 177 234 255 172 129 179 109 269 -9 176 135 196 153 143 113 210 187 150 142 171 320 199 147 237 190 187 165 244 132 237 270 207 112 240 -9 176 293 241 167 258 155 264 204 268 191 249 185 263 104 263 108 266 216 269 100 292 319 233 230 290 146 198 181 229 282 164 274 223 174 185 282 256 180 207 148 159 149 98 283 198 189 242 160 305 233 307 214 133 109 244 149 322 163 249 162 170 154 204 216 260 198 220 270 209 174 230 172 304 143 255 258 142 320 285 199 217 160 136 172 368 203 189 193 209 172 292 170 179 298 275 140 176 164 265 115 158 191 188 184 169 264 300 266 198 188 149 238 194 201 252 135 249 262 197 100 266 196 194 242 163 137 111 165 405 163 200 249 231 207 217 172 127 260 264 121 256 148 138 240 237 260 204 155 304 200 209 203 146 111 203 125 245 181 117 350 297 191 204 308 209 212 198 173 205 184 142 258 227 235 247 205 
877 86 Maya Mexico AMERICA 126 128 142 131 158 234 150 116 186 98 132 120 148 223 262 241 163 165 218 -9 193 145 255 140 226 200 190 146 137 199 189 176 154 173 108 166 -9 147 168 182 212 185 249 118 153 -9 234 239 271 -9 221 111 129 236 205 294 187 -9 95 256 192 127 132 113 166 159 260 234 94 129 260 113 155 166 121 165 234 152 190 133 -9 104 146 -9 -9 246 244 142 184 163 194 150 184 244 135 193 252 200 119 156 246 201 206 158 162 263 189 127 318 176 190 203 184 164 206 147 244 198 144 192 155 -9 159 172 141 224 206 277 247 147 126 151 149 166 157 173 202 212 128 208 242 232 145 224 232 149 378 187 193 204 155 188 157 200 355 212 161 244 115 218 263 234 124 183 243 140 207 234 259 188 153 179 109 277 195 180 143 204 161 159 113 214 191 142 146 175 320 227 155 245 190 183 177 256 144 237 278 223 120 244 163 184 297 241 171 258 151 268 220 276 195 257 185 267 112 267 108 286 220 261 108 300 323 245 234 294 -9 194 209 237 278 174 274 235 182 173 282 264 184 219 160 163 141 98 291 186 189 246 180 -9 237 307 222 125 125 244 169 322 163 273 170 182 154 212 216 260 202 240 282 227 174 234 180 304 169 251 266 146 316 293 199 261 164 136 176 372 211 193 -9 221 176 304 186 195 302 307 140 192 168 -9 123 158 199 192 212 181 272 300 266 202 188 149 246 206 213 276 143 249 282 197 100 274 204 194 246 163 165 115 165 405 167 204 257 247 213 217 172 135 264 276 137 268 168 138 236 241 260 224 171 312 202 209 199 138 119 205 125 249 187 133 346 297 211 216 316 241 220 210 181 209 184 150 -9 231 231 263 205 
877 86 Maya Mexico AMERICA 120 124 124 129 142 228 138 116 182 98 130 120 148 217 258 233 163 163 216 -9 191 143 251 134 204 184 186 144 119 199 183 176 148 171 94 166 -9 145 166 180 208 182 246 115 150 -9 231 230 271 -9 221 96 117 233 196 291 187 -9 95 256 189 127 126 113 157 150 251 234 91 126 254 110 155 157 112 165 228 152 190 133 -9 98 131 -9 -9 243 227 139 182 160 194 150 184 238 126 193 246 197 113 152 246 197 202 158 162 255 185 127 318 168 188 203 176 156 202 139 240 194 144 188 151 -9 151 172 129 224 202 273 247 143 126 147 137 166 153 157 198 196 124 204 242 228 121 224 228 145 374 187 173 200 147 188 153 192 355 212 153 240 115 210 259 234 120 183 239 120 185 230 255 180 149 179 109 269 187 180 143 196 149 147 105 200 191 142 146 163 320 219 155 241 190 183 165 244 132 233 274 219 108 240 151 180 289 241 167 258 151 264 216 276 187 253 185 263 104 263 108 278 216 257 100 292 319 233 230 290 -9 194 209 229 274 164 274 235 178 173 278 260 180 211 152 159 141 98 287 178 185 242 180 -9 237 299 210 125 125 244 153 322 159 245 170 178 150 204 212 260 202 224 282 209 170 226 172 304 143 235 258 142 316 289 199 257 164 128 172 368 203 189 -9 209 168 296 178 179 302 303 140 176 164 -9 119 154 159 188 212 177 268 292 258 202 188 145 242 202 205 252 135 249 282 197 100 270 180 186 242 163 165 111 141 405 167 196 249 235 207 209 156 127 260 264 129 256 168 138 208 229 260 208 151 308 198 209 199 126 111 203 125 249 181 117 342 293 211 204 312 241 216 206 173 201 180 146 -9 227 227 255 205 
878 86 Maya Mexico AMERICA 126 128 124 131 156 230 140 120 186 98 142 120 148 227 262 233 165 167 218 -9 187 147 247 136 228 184 188 138 119 207 189 184 154 165 100 172 130 169 170 182 212 182 252 115 141 -9 231 242 277 -9 221 111 129 239 208 294 193 116 98 256 192 127 144 122 163 156 251 -9 91 135 263 110 155 157 115 162 228 155 205 133 -9 104 146 133 205 246 244 142 184 169 194 150 184 247 126 196 249 200 128 148 254 205 202 166 174 251 197 127 346 172 190 195 178 164 202 143 244 202 152 196 155 241 159 172 141 240 206 281 255 147 122 155 148 170 157 165 202 208 124 212 254 -9 141 224 236 149 382 183 181 204 159 188 157 204 359 216 -9 256 119 222 263 238 120 187 243 140 193 246 255 188 153 183 113 281 195 184 135 200 153 159 113 214 191 158 142 175 328 219 155 245 202 187 173 256 152 237 274 211 120 244 167 184 297 241 191 -9 -9 264 216 276 191 261 185 263 104 -9 108 282 220 273 108 296 323 233 242 302 -9 198 181 233 306 178 274 239 178 189 282 268 184 219 148 159 157 106 287 202 193 -9 184 313 241 311 222 133 125 244 153 322 163 -9 170 178 158 208 216 264 202 224 286 223 194 234 -9 304 165 255 262 162 324 293 203 233 164 140 172 376 207 197 201 209 168 300 182 183 306 303 140 -9 168 -9 135 158 195 196 212 173 268 296 290 202 200 -9 242 194 209 260 151 253 282 201 100 286 208 194 246 163 153 111 165 417 171 200 249 235 207 217 172 131 272 268 129 256 152 154 240 245 -9 204 167 304 202 209 203 146 125 205 129 249 -9 129 354 309 203 204 316 265 216 214 181 209 184 146 -9 239 235 263 205 
878 86 Maya Mexico AMERICA 120 124 124 129 142 226 140 118 186 96 130 120 148 217 258 229 147 165 218 -9 175 143 243 132 204 184 188 134 119 203 183 180 148 161 92 166 130 145 162 180 208 182 252 115 141 -9 231 242 274 -9 221 96 126 230 196 288 190 104 95 256 192 121 138 119 160 147 251 -9 76 126 260 107 155 157 109 162 228 152 202 127 -9 104 137 133 202 243 227 142 179 148 179 150 184 238 126 193 246 194 119 140 246 201 198 158 170 251 185 123 322 168 188 191 178 160 190 143 240 198 144 184 147 233 155 164 121 220 206 269 247 147 122 151 133 166 149 157 202 204 124 212 254 -9 121 220 236 145 374 183 177 200 147 184 153 200 351 212 -9 240 119 222 259 238 116 175 243 120 177 242 255 172 145 179 109 269 187 176 131 196 153 151 105 210 187 150 142 171 320 199 147 241 190 183 165 252 148 225 270 207 112 240 163 176 293 241 167 -9 -9 264 204 272 191 245 185 263 104 -9 108 266 216 257 100 296 319 233 234 286 -9 198 181 233 286 164 274 223 174 185 282 260 180 215 144 155 141 98 283 198 189 -9 176 305 241 303 218 117 121 244 149 322 163 -9 162 170 154 204 216 260 198 220 282 223 174 230 -9 304 143 239 258 142 320 289 199 217 160 136 172 372 203 189 185 209 160 292 170 179 298 303 140 -9 148 -9 135 154 191 192 184 169 264 292 266 198 188 -9 230 194 197 252 135 249 274 197 100 270 200 182 242 163 153 111 161 405 167 200 249 227 207 217 156 127 260 264 121 256 148 138 200 241 -9 204 155 304 200 185 203 126 111 203 129 245 -9 129 374 297 191 184 300 237 212 198 181 205 180 142 -9 231 235 247 205 
1037 87 Pima Mexico AMERICA 126 128 142 133 142 234 150 122 190 98 130 120 148 217 264 233 173 165 218 196 193 145 247 134 232 -9 188 146 119 205 183 182 154 173 100 172 130 145 168 182 212 191 -9 115 150 120 240 239 274 195 -9 96 117 236 199 306 184 116 95 241 -9 136 144 -9 166 150 266 246 91 135 260 107 155 157 109 168 234 152 190 130 190 104 146 133 205 246 244 148 179 -9 200 156 190 247 126 199 249 200 119 156 254 201 202 166 170 259 185 135 346 176 194 207 180 168 202 143 248 202 -9 196 155 237 155 176 137 216 210 273 255 151 126 155 137 174 157 173 206 208 140 212 238 232 121 224 236 149 382 183 173 208 159 188 157 200 351 212 157 268 115 218 259 238 120 183 -9 140 181 238 251 180 153 179 113 277 199 188 131 200 157 159 117 212 191 142 142 171 324 215 159 249 -9 183 177 252 148 237 282 -9 124 240 163 184 293 257 187 274 155 268 224 280 199 253 185 263 112 267 108 278 220 257 108 296 323 245 242 298 182 198 193 237 -9 164 274 235 174 193 274 268 180 215 156 159 141 110 291 178 193 246 180 313 237 315 226 129 125 240 153 330 163 257 174 178 154 212 220 264 198 220 278 -9 178 230 184 304 165 259 -9 146 324 293 203 265 -9 136 184 -9 207 177 193 213 176 296 182 179 -9 303 140 192 164 273 127 158 207 192 184 173 272 296 266 198 204 149 250 202 209 -9 135 249 286 201 100 266 204 198 246 163 149 115 165 417 167 200 253 235 211 217 176 131 252 272 137 256 160 150 240 241 264 204 171 -9 202 221 203 134 111 205 125 -9 181 117 -9 313 -9 216 316 265 216 206 -9 -9 188 146 258 231 231 271 217 
1037 87 Pima Mexico AMERICA 126 128 124 129 142 234 146 112 186 96 130 120 148 217 260 233 163 165 218 194 177 143 247 134 224 -9 188 144 119 205 183 178 154 173 94 166 120 145 168 180 208 185 -9 115 141 108 237 239 271 195 -9 96 117 233 196 297 184 116 95 238 -9 118 132 -9 163 141 266 246 91 132 257 101 155 157 106 156 228 152 190 130 178 104 146 133 202 240 241 139 179 -9 197 153 190 241 126 193 246 197 119 152 246 197 194 162 162 259 185 119 326 176 190 203 174 164 198 135 244 194 -9 184 151 237 151 172 137 200 206 269 247 151 118 155 133 150 153 157 206 208 124 204 238 228 121 224 236 145 378 183 173 204 147 184 153 188 351 204 153 244 115 214 259 234 116 183 -9 120 177 234 251 180 153 179 109 277 183 180 131 196 153 155 117 210 191 142 138 163 324 199 155 249 -9 183 169 244 144 225 274 -9 112 240 155 176 293 249 167 266 143 260 216 272 191 253 185 251 104 263 104 258 212 257 104 296 319 233 238 298 162 194 189 233 -9 164 270 235 174 173 274 264 180 215 156 159 141 100 283 178 189 246 180 301 237 307 214 125 125 224 149 326 159 253 166 178 146 204 216 260 198 212 278 -9 170 226 180 292 143 235 -9 138 320 281 199 229 -9 132 172 -9 203 177 193 209 160 292 174 179 -9 275 136 176 156 273 123 158 183 188 184 173 268 296 242 194 196 149 234 190 209 -9 135 245 282 197 100 254 200 186 242 159 149 111 165 405 163 196 241 231 203 201 176 123 252 260 137 256 148 134 240 237 256 204 151 -9 198 185 199 126 111 205 113 -9 181 117 -9 305 -9 212 312 265 212 198 -9 -9 180 146 258 231 227 259 205 
1038 87 Pima Mexico AMERICA 126 128 152 137 142 232 150 124 188 98 130 120 148 217 258 241 173 169 -9 194 175 -9 247 134 224 184 206 138 119 207 183 182 154 169 100 172 120 145 168 180 212 188 261 115 156 129 240 239 271 216 221 96 117 236 196 297 190 116 107 241 192 133 138 113 163 156 266 246 94 126 263 107 155 157 115 162 240 152 190 130 -9 104 134 136 205 246 244 148 182 169 194 156 184 247 126 193 261 200 119 156 246 201 202 162 170 263 189 123 338 176 188 203 184 168 202 139 -9 194 160 196 155 241 159 176 145 224 206 273 247 151 122 155 137 170 157 157 206 212 128 208 238 244 145 232 240 145 386 183 173 -9 147 188 157 200 359 220 157 264 123 222 259 234 120 183 -9 140 -9 242 259 192 153 183 129 273 199 184 143 200 157 151 117 212 191 154 146 175 324 215 159 245 194 183 169 244 148 249 274 215 124 244 155 184 297 241 175 274 147 268 220 280 195 253 185 263 108 267 108 -9 224 257 100 292 323 233 230 294 170 194 189 233 -9 164 278 235 190 189 -9 260 180 215 152 159 153 112 291 182 201 246 180 301 241 315 222 125 129 244 153 326 159 257 166 178 162 212 -9 264 202 228 278 223 194 226 172 -9 173 255 266 158 316 293 207 265 164 140 172 372 211 177 197 229 172 292 182 187 298 303 140 188 156 289 -9 162 195 196 212 181 268 324 274 202 204 153 250 202 209 272 135 249 286 201 100 -9 204 198 246 175 153 111 165 409 171 200 253 227 211 217 160 119 260 260 137 256 168 146 248 233 260 204 159 -9 198 225 203 138 121 205 125 245 183 117 346 305 211 216 320 265 216 206 181 205 192 146 258 231 231 259 217 
1038 87 Pima Mexico AMERICA 120 124 124 129 142 226 150 112 182 96 130 120 148 217 258 231 173 165 -9 188 175 -9 243 134 204 184 188 138 119 199 183 182 148 169 94 172 120 145 168 174 212 185 249 115 141 108 234 224 271 195 221 96 117 233 196 294 187 113 98 238 192 127 132 113 163 150 260 246 91 120 257 107 155 157 106 162 234 152 190 130 -9 104 131 133 202 243 241 148 179 160 179 156 184 247 126 181 249 200 119 152 246 201 194 158 162 259 185 119 326 176 188 203 180 156 202 139 -9 194 144 192 151 241 151 172 141 200 202 269 247 151 118 151 133 150 149 157 206 204 128 208 238 228 141 220 224 133 374 183 173 -9 147 188 157 196 347 212 149 260 115 222 259 230 120 175 -9 128 -9 234 255 172 153 179 109 269 187 180 131 196 149 147 117 210 191 142 126 171 308 199 151 245 190 183 169 240 140 237 274 215 112 236 151 176 289 241 171 266 147 260 216 276 195 249 181 251 104 267 104 -9 212 257 100 280 319 233 226 286 154 186 189 233 -9 160 274 223 190 173 -9 256 180 207 140 159 141 100 287 178 193 246 176 301 237 303 218 125 125 244 153 322 155 253 166 170 158 208 -9 264 198 220 278 217 174 226 172 -9 173 239 266 138 316 293 207 229 160 136 172 372 203 177 181 213 160 292 174 179 294 275 140 176 152 269 -9 154 191 192 188 173 264 300 266 202 188 149 242 190 201 260 135 245 282 197 100 -9 180 186 246 163 153 111 141 405 163 192 253 227 203 213 160 119 260 260 129 256 160 134 180 233 252 204 151 -9 198 217 199 134 121 205 125 233 181 117 338 305 203 180 316 241 216 198 181 201 184 138 254 231 227 259 217 
1039 87 Pima Mexico AMERICA 126 128 124 133 142 234 150 124 190 96 130 120 148 217 260 241 173 165 218 196 -9 -9 247 134 -9 184 206 146 119 -9 183 182 154 173 100 172 120 145 168 182 212 188 249 115 150 108 240 239 271 195 221 96 117 236 202 306 187 116 98 241 192 127 144 -9 163 156 266 246 91 132 -9 107 155 157 109 168 234 152 190 130 190 104 146 133 -9 252 244 148 182 160 200 156 190 247 126 199 249 200 119 156 246 201 202 166 -9 259 185 135 346 176 190 203 184 168 202 139 248 202 160 196 155 241 159 176 145 200 206 273 247 151 126 155 137 174 153 -9 206 212 140 208 238 228 141 232 236 149 386 183 173 208 159 188 157 200 351 -9 157 268 115 222 259 234 120 183 -9 140 209 242 255 180 153 179 129 277 199 188 131 200 157 159 117 212 191 142 142 171 324 199 155 249 190 183 169 244 144 237 274 -9 124 244 155 184 293 257 175 274 155 268 220 276 195 253 185 263 112 267 108 -9 212 257 108 296 323 233 238 298 170 198 193 237 286 164 274 235 190 193 274 264 180 215 156 159 141 112 291 178 193 246 180 301 241 315 226 125 125 244 -9 330 159 253 174 178 162 212 220 264 202 220 278 223 -9 -9 180 292 173 255 266 158 324 293 207 265 -9 136 172 -9 211 177 193 213 176 296 182 187 -9 303 140 176 164 273 127 162 207 196 188 181 272 324 274 202 204 153 250 190 209 272 135 245 286 201 100 270 204 186 246 163 153 111 165 405 171 196 253 231 203 217 176 123 260 260 137 256 168 134 248 237 260 204 171 304 202 217 199 138 121 205 -9 -9 181 117 354 305 203 216 316 265 216 198 181 -9 188 146 258 231 231 259 217 
1039 87 Pima Mexico AMERICA 120 124 124 129 142 226 150 112 182 96 130 120 148 217 258 233 173 165 218 194 -9 -9 247 134 -9 184 188 138 119 -9 183 178 154 169 94 166 120 145 168 180 208 185 249 115 141 108 240 239 271 195 221 96 117 233 196 297 184 113 95 238 192 118 132 -9 163 141 266 246 91 126 -9 107 155 157 106 162 234 152 190 130 178 104 134 133 -9 243 241 148 179 148 179 153 184 241 126 193 249 200 119 156 246 197 194 162 -9 259 185 123 326 176 188 203 174 164 202 135 248 194 144 196 151 237 151 172 137 200 202 269 247 151 122 151 137 150 149 -9 194 208 128 204 238 228 121 224 224 145 378 183 173 200 147 184 157 200 347 -9 157 260 115 218 259 230 116 183 -9 128 177 238 251 172 153 179 113 269 183 180 131 200 157 147 117 210 191 142 126 163 308 199 151 245 190 183 169 240 140 237 274 -9 112 240 155 176 289 241 167 266 147 260 216 272 191 253 185 251 104 263 108 -9 212 257 100 280 319 233 226 294 162 186 189 233 270 160 274 235 174 173 274 260 180 215 140 159 141 110 291 178 193 246 180 301 237 303 218 125 125 224 -9 326 159 253 166 178 154 208 220 264 198 212 278 217 -9 -9 172 292 165 235 266 146 316 293 203 229 -9 132 172 -9 203 177 181 213 160 292 174 179 -9 303 140 176 152 269 119 158 191 188 184 173 268 296 242 194 204 149 250 190 201 268 135 245 286 197 100 254 200 186 246 159 149 111 141 405 163 192 241 227 203 217 160 119 252 260 129 256 148 134 240 233 256 204 151 304 198 185 199 134 111 205 -9 -9 181 117 338 305 203 212 316 241 208 198 173 -9 184 138 258 231 227 259 217 
1040 87 Pima Mexico AMERICA 126 128 142 137 142 234 150 124 190 98 130 120 148 217 264 241 173 169 218 194 -9 147 247 134 232 200 206 146 119 207 183 182 154 173 94 172 130 145 168 182 212 191 261 115 156 129 237 239 274 195 221 96 -9 236 196 306 187 116 98 241 192 136 144 116 163 150 -9 246 94 132 263 107 155 157 109 168 240 152 190 130 -9 104 146 136 205 252 -9 148 179 169 200 156 -9 247 126 199 249 200 119 156 246 201 194 166 170 263 185 119 326 176 194 207 184 164 202 143 244 202 148 196 155 241 155 176 145 224 210 273 255 151 118 155 -9 170 157 157 206 212 128 208 238 228 141 224 240 149 386 183 -9 204 147 188 157 200 359 220 157 268 115 222 259 234 120 183 -9 140 209 238 259 180 153 183 113 277 199 184 131 200 157 159 117 212 191 154 138 175 324 215 -9 249 190 183 177 252 148 249 274 223 124 244 163 184 297 249 171 274 147 -9 224 280 195 253 185 263 104 267 104 262 224 257 104 296 323 245 238 298 162 194 193 233 298 164 274 235 190 193 274 264 180 215 156 159 153 100 291 178 193 246 180 313 237 315 226 129 129 244 153 330 163 257 174 178 158 212 220 264 198 228 278 223 178 226 180 -9 173 239 270 158 324 293 207 -9 164 140 184 372 203 177 193 213 176 292 174 179 298 303 140 192 164 273 127 158 207 192 188 181 272 300 274 202 196 149 250 202 209 276 135 249 286 201 100 270 200 186 -9 163 -9 111 165 409 163 200 253 235 211 217 176 131 260 272 137 256 160 146 248 241 264 204 159 304 198 225 203 134 121 205 125 249 181 117 366 305 211 216 320 265 216 206 181 209 192 146 258 231 231 259 217 
1040 87 Pima Mexico AMERICA 126 124 124 133 142 232 146 112 182 96 130 120 148 217 258 233 173 165 218 188 -9 143 247 134 224 184 188 138 119 205 183 178 154 169 94 172 120 145 168 174 212 188 249 115 141 108 234 239 271 195 221 96 -9 233 196 294 184 116 95 241 192 127 132 113 163 150 -9 246 91 120 257 101 155 157 106 162 228 152 190 130 -9 104 134 133 202 246 -9 139 179 148 179 153 -9 247 126 181 246 200 119 152 246 197 194 158 170 259 185 119 326 176 188 203 174 156 198 139 244 194 144 196 151 237 151 176 137 200 206 273 247 151 118 151 -9 150 149 157 194 208 124 204 238 228 121 220 236 133 378 183 -9 200 147 188 157 200 351 204 149 264 115 218 259 230 120 183 -9 140 181 234 251 172 153 179 109 273 199 180 131 196 153 151 117 210 191 142 126 171 324 199 -9 245 190 183 169 240 144 225 274 215 112 240 151 184 293 241 167 266 143 -9 216 276 191 253 181 263 104 263 104 258 220 257 100 292 323 233 230 286 154 186 189 233 278 164 270 235 174 173 274 256 180 207 152 159 141 100 283 178 189 246 176 301 237 307 222 125 125 224 153 322 155 257 166 170 154 204 216 264 198 220 278 223 174 226 172 -9 143 235 266 146 316 293 199 -9 160 132 172 368 203 177 181 209 160 292 174 179 294 303 136 188 152 269 119 154 191 192 184 173 268 296 266 198 188 149 250 190 209 272 135 245 282 201 100 266 180 186 -9 163 -9 111 165 405 163 200 241 227 203 213 160 119 252 260 137 256 160 134 240 233 252 204 151 304 198 221 199 126 111 205 113 233 181 117 346 305 211 180 312 241 216 198 181 205 188 138 254 231 227 259 217
1041 87 Pima Mexico AMERICA 126 124 124 129 142 234 150 112 182 98 130 120 148 217 264 235 173 167 218 196 187 147 249 140 230 186 190 146 139 207 183 180 158 169 102 166 130 173 172 176 212 185 249 115 153 108 234 245 271 195 -9 111 117 236 196 306 196 -9 98 256 192 133 138 113 166 156 266 246 -9 126 257 110 158 157 115 -9 240 152 190 133 193 104 140 136 202 246 244 139 184 -9 200 156 190 247 126 193 246 200 119 156 246 201 206 162 162 251 181 131 338 176 -9 203 180 156 190 143 244 198 160 192 155 241 159 172 -9 224 206 273 251 151 126 155 149 170 161 161 202 208 144 216 242 232 145 228 240 145 378 183 177 204 159 192 157 200 375 212 153 244 119 218 259 234 112 183 229 136 185 238 259 192 153 179 117 269 187 -9 143 -9 145 147 105 212 195 158 142 175 324 235 159 245 194 183 173 260 144 237 274 227 124 244 155 176 297 249 175 274 151 264 224 276 187 261 185 271 108 267 104 278 220 273 100 -9 323 233 234 286 162 206 209 241 286 172 278 235 178 189 282 -9 184 215 160 163 153 100 291 194 197 242 184 -9 241 311 226 133 125 244 -9 322 163 245 170 182 154 204 -9 264 202 220 286 223 178 234 180 300 -9 255 266 146 320 289 203 261 164 136 172 380 207 193 197 209 172 296 186 187 302 307 148 176 164 273 131 158 199 196 184 173 268 300 270 202 192 149 242 202 209 272 135 249 278 209 116 270 204 202 246 163 153 111 165 409 163 200 -9 239 209 225 176 139 260 -9 121 256 164 134 244 245 260 224 171 312 202 185 207 134 111 205 123 241 183 129 354 313 211 220 316 261 216 206 177 205 188 146 262 227 235 271 225 
1041 87 Pima Mexico AMERICA 126 124 124 129 142 234 140 112 180 96 130 120 148 217 258 233 171 165 218 194 187 145 243 134 204 184 190 134 119 199 174 176 158 165 96 166 120 147 170 174 212 182 246 115 141 105 225 224 271 195 -9 96 117 233 196 297 190 -9 95 238 192 127 132 113 163 150 266 234 -9 123 257 101 155 151 112 -9 234 152 190 130 190 104 137 133 202 243 244 139 179 -9 197 150 184 241 126 193 246 200 119 152 246 201 202 158 162 247 181 127 334 176 -9 195 180 156 190 139 240 194 140 188 151 237 155 172 -9 216 206 273 247 151 110 151 145 166 157 157 198 196 140 208 238 232 121 220 228 141 374 183 169 204 147 188 153 188 359 212 153 240 115 214 259 234 112 183 225 132 173 234 259 188 153 175 113 265 187 -9 131 -9 145 147 105 206 187 154 138 163 308 221 159 245 190 183 173 252 140 233 274 211 116 236 147 176 293 241 171 274 147 260 224 272 187 253 181 267 108 263 104 258 220 269 100 -9 319 233 230 282 158 198 209 233 278 164 270 235 178 177 278 -9 180 215 152 159 149 100 283 178 189 226 184 -9 237 303 218 133 125 244 -9 322 159 245 166 170 154 204 -9 260 198 212 278 221 170 230 176 292 -9 235 266 142 320 289 199 229 160 132 172 376 203 189 189 209 172 292 182 179 298 307 144 176 152 269 131 146 191 196 184 169 264 296 270 190 188 145 242 190 209 256 135 249 274 201 100 266 180 198 246 163 153 111 141 405 163 200 -9 227 207 217 168 119 256 -9 121 256 160 134 220 237 252 204 155 304 198 185 203 118 111 199 121 241 181 117 346 305 203 216 312 241 216 202 173 205 188 146 262 223 231 259 217 
1042 87 Pima Mexico AMERICA 126 124 152 129 142 234 150 124 182 98 130 120 148 217 258 -9 173 167 218 196 187 145 249 140 -9 186 190 -9 -9 199 183 176 158 165 104 166 126 145 172 174 208 185 258 115 156 120 240 245 271 216 239 96 117 233 208 306 190 116 95 256 195 133 144 116 163 156 -9 234 91 135 260 110 158 157 115 165 240 152 190 130 193 104 140 133 205 246 244 148 179 169 200 156 184 -9 135 193 246 200 119 156 254 201 206 158 162 251 181 131 338 176 -9 195 180 156 202 143 244 198 160 192 155 237 155 172 145 216 206 273 255 151 126 155 149 170 157 -9 202 208 140 216 254 232 145 224 -9 141 386 183 173 204 159 192 157 -9 359 212 153 260 119 214 259 234 116 187 -9 136 193 242 263 192 153 175 113 277 -9 188 143 200 149 163 -9 210 195 154 150 175 324 -9 159 245 190 183 181 252 144 233 274 -9 124 244 159 -9 297 245 175 274 151 264 228 276 187 261 185 267 108 267 -9 -9 224 273 108 296 319 241 238 298 162 206 209 241 278 172 278 235 178 193 282 268 180 215 164 163 149 100 287 182 197 226 184 301 241 303 226 133 125 244 153 322 163 257 166 182 154 204 212 264 198 224 286 221 178 234 -9 308 177 -9 266 142 320 293 203 261 160 136 172 -9 211 201 197 209 -9 296 186 187 -9 307 148 176 152 -9 131 154 199 196 212 173 264 300 270 202 192 149 242 202 209 272 135 249 286 209 116 282 180 202 246 175 -9 115 165 409 163 204 249 227 209 225 168 123 260 272 129 256 164 138 244 237 260 204 171 -9 202 185 207 134 121 205 -9 245 187 133 346 313 211 220 320 265 216 206 181 -9 188 146 262 239 231 271 225 
1042 87 Pima Mexico AMERICA 126 124 124 129 142 230 150 112 180 96 130 120 148 217 250 -9 173 163 218 196 175 145 243 132 -9 186 188 -9 -9 199 183 172 154 165 102 166 120 147 164 174 212 185 246 115 153 105 234 245 271 195 221 96 117 233 196 291 190 113 95 238 192 127 138 113 160 150 -9 234 79 123 257 107 155 151 109 156 234 152 190 130 190 104 134 133 202 243 244 139 179 160 194 156 184 -9 126 181 246 200 119 152 246 201 202 158 162 247 181 127 334 176 -9 195 174 156 190 143 244 194 140 188 151 237 151 164 145 216 206 273 247 151 110 151 137 150 157 -9 198 208 128 208 242 232 121 220 -9 133 374 183 169 200 147 192 153 -9 355 212 153 244 115 214 259 234 112 183 -9 128 185 238 259 192 153 175 105 265 -9 180 131 200 145 147 -9 206 191 142 142 171 308 -9 159 245 190 183 173 240 140 233 274 -9 124 244 147 -9 293 241 175 274 147 260 224 276 187 253 181 259 104 267 -9 -9 220 269 100 288 319 233 234 282 162 194 189 233 278 164 270 223 174 177 278 260 176 207 160 159 141 100 283 178 189 226 184 301 237 303 214 133 125 244 153 322 159 245 166 170 154 204 204 260 198 220 278 209 170 230 -9 300 169 -9 266 142 320 289 199 261 160 132 172 -9 207 189 189 209 -9 292 182 183 -9 307 136 176 148 -9 123 146 195 192 184 169 264 300 270 202 188 145 242 190 201 256 135 249 278 201 100 266 180 186 246 163 -9 111 165 405 159 200 245 227 205 213 160 119 256 268 121 256 148 134 244 233 252 204 159 -9 198 185 207 118 111 205 -9 241 181 117 346 313 211 216 316 241 216 206 173 -9 184 146 250 223 227 251 205 
1043 87 Pima Mexico AMERICA 126 128 146 135 142 234 142 112 182 98 130 120 148 217 258 -9 173 167 -9 198 191 149 249 134 228 184 208 146 -9 207 183 176 154 173 100 172 130 147 172 182 212 188 249 115 150 120 234 245 271 216 239 96 117 233 196 297 190 116 95 241 192 136 141 122 166 156 263 246 91 132 266 113 155 157 115 165 234 152 190 130 -9 104 137 133 205 243 247 148 179 160 194 156 184 253 126 193 246 200 119 152 254 201 202 182 170 251 185 127 338 176 200 207 180 160 202 147 244 194 148 192 155 249 163 176 141 216 210 273 255 147 126 155 137 170 165 161 206 208 128 216 258 244 121 224 244 145 378 183 173 208 159 192 157 200 351 212 161 260 123 218 263 238 120 187 -9 132 201 238 259 192 153 179 121 273 195 180 131 200 157 155 121 212 191 142 146 175 324 215 -9 245 190 183 181 260 148 233 282 231 124 244 163 188 297 249 175 274 151 268 224 276 187 249 185 267 112 267 104 278 224 273 108 -9 327 245 246 298 158 206 209 233 314 172 278 235 190 177 278 268 188 219 160 159 149 110 291 178 197 242 184 309 -9 303 226 133 129 244 157 326 159 261 166 182 154 204 220 264 202 224 282 209 -9 234 180 304 169 251 266 158 320 293 207 229 164 136 184 376 211 193 181 209 176 296 186 183 298 307 144 176 164 273 131 154 199 188 212 173 272 300 274 202 200 153 246 -9 201 272 135 249 278 201 100 282 204 198 246 175 173 115 165 405 171 196 253 231 211 225 168 -9 256 268 125 256 156 150 244 233 260 204 155 308 202 225 203 134 111 205 125 249 183 129 382 305 211 216 320 265 216 206 181 213 188 146 254 231 235 267 237 
1043 87 Pima Mexico AMERICA 126 120 124 129 142 232 142 112 180 98 130 120 148 217 258 -9 163 165 -9 196 187 143 243 132 204 184 190 142 -9 199 183 172 154 165 98 166 126 145 168 174 208 185 249 115 141 108 225 245 271 201 221 96 117 233 196 291 184 116 95 238 192 127 132 113 163 150 251 234 91 132 263 107 155 151 109 162 234 152 190 130 -9 104 137 130 205 243 241 139 179 160 179 156 184 247 126 172 246 200 119 140 246 201 194 158 170 247 185 119 334 176 194 207 178 156 190 139 244 194 144 184 151 237 159 176 137 200 206 273 247 147 118 155 133 150 161 157 202 208 128 208 238 232 121 224 228 145 374 183 169 204 147 188 153 196 347 204 153 240 116 214 259 234 116 183 -9 128 185 234 251 192 153 175 109 269 187 176 131 188 149 139 121 210 191 142 126 171 308 199 -9 245 190 183 169 252 144 233 282 211 124 244 155 188 289 241 171 274 147 260 220 272 183 249 181 259 108 263 104 258 216 257 100 -9 319 245 242 294 158 186 189 233 274 164 270 223 178 173 274 264 176 215 140 155 141 100 287 178 197 226 184 301 -9 303 214 129 125 224 153 322 159 257 166 182 150 204 212 264 198 224 282 209 -9 230 172 292 143 239 266 158 316 289 199 225 160 132 172 372 207 193 181 209 172 292 186 179 298 275 140 176 164 273 123 154 195 188 212 169 268 292 262 198 188 149 246 -9 201 268 135 249 274 201 100 270 200 198 246 163 149 111 149 405 167 192 241 227 203 213 164 -9 252 264 121 256 152 138 240 233 256 204 151 304 198 221 199 130 111 199 125 245 181 117 342 293 203 212 308 241 212 206 181 205 184 146 250 227 227 259 217 
1044 87 Pima Mexico AMERICA 126 128 124 129 142 234 150 112 182 98 130 120 148 217 264 235 173 165 218 196 175 147 247 134 228 184 208 146 119 207 183 180 154 173 110 166 130 173 170 182 208 191 255 115 153 120 237 245 271 201 -9 96 126 233 208 306 190 -9 95 241 192 133 132 116 166 156 266 246 91 132 263 110 155 157 115 -9 234 152 190 130 193 110 146 136 205 246 244 148 184 -9 -9 156 190 247 135 181 249 200 119 140 254 201 -9 182 162 255 185 127 338 176 -9 207 180 160 202 147 244 194 148 188 159 241 159 176 141 224 210 273 251 151 110 151 137 170 165 157 202 208 128 216 242 244 121 228 240 145 382 183 177 204 147 188 153 204 355 224 153 260 115 222 259 230 116 187 235 136 185 242 259 180 153 183 117 277 195 -9 131 200 149 151 117 212 191 154 142 171 324 235 -9 245 190 183 169 260 152 233 274 231 124 240 163 188 297 241 171 274 147 272 220 276 183 261 189 259 112 267 108 278 224 273 104 296 323 245 242 298 166 194 209 245 278 168 278 235 190 193 278 268 180 215 148 159 149 110 291 182 201 246 184 305 237 303 214 129 125 244 153 326 163 257 170 182 158 212 220 264 202 224 286 223 174 226 180 308 173 235 266 158 324 293 207 261 168 136 172 376 211 193 189 229 172 300 186 191 302 311 144 176 152 277 135 150 195 196 188 173 272 324 266 206 200 153 246 202 201 284 135 249 -9 209 100 282 204 198 -9 163 173 111 169 409 171 200 253 227 207 221 160 139 260 268 121 256 164 150 240 233 252 224 167 312 198 217 203 138 121 205 125 249 195 117 346 313 211 216 320 265 216 206 181 213 188 146 258 231 231 267 221 
1044 87 Pima Mexico AMERICA 126 124 124 129 142 232 150 112 182 98 130 114 148 217 258 233 165 163 218 196 175 143 243 132 228 184 186 146 119 199 174 176 154 173 98 166 120 147 166 180 212 191 249 115 150 108 225 239 271 195 -9 96 117 230 208 291 184 -9 95 238 192 127 132 113 163 150 266 234 91 132 257 107 155 151 106 -9 234 152 190 130 193 104 137 133 202 243 241 148 179 -9 -9 150 184 235 126 181 249 197 119 140 254 197 -9 158 162 247 181 119 334 176 -9 203 174 160 190 139 240 190 140 184 155 237 151 176 133 200 210 269 247 151 110 147 137 166 157 157 202 208 128 208 238 224 121 216 224 133 378 183 169 204 147 188 153 200 355 212 153 240 115 214 259 230 112 175 225 132 181 242 259 180 153 179 109 273 191 -9 131 192 149 139 105 212 191 142 138 171 320 215 -9 245 190 183 165 244 152 233 270 211 108 236 147 188 289 241 171 274 143 260 220 276 183 253 181 251 104 267 104 278 212 257 100 296 319 237 238 286 166 186 189 241 278 164 274 223 174 173 274 264 180 207 140 159 141 106 279 178 197 242 180 301 237 303 210 129 125 244 153 322 163 245 166 170 154 204 220 264 202 220 278 209 174 222 180 300 173 235 266 150 320 289 199 229 164 136 172 372 203 193 181 213 160 292 186 179 298 303 140 176 152 269 123 146 191 192 188 173 264 300 258 202 196 149 246 190 201 272 135 249 -9 197 100 266 180 186 -9 163 173 111 165 405 167 192 241 227 205 221 160 131 256 268 121 256 152 134 204 233 252 220 151 304 198 213 203 134 111 205 121 245 183 117 346 305 203 180 316 265 216 202 173 205 184 138 258 227 231 251 221
1045 87 Pima Mexico AMERICA 126 128 124 135 142 234 150 112 182 98 130 120 148 217 258 235 173 165 220 196 187 143 249 134 228 184 208 146 139 207 183 176 154 173 110 172 130 147 172 182 -9 191 249 115 150 120 237 245 271 201 239 96 117 233 208 291 184 116 95 241 192 136 141 -9 166 150 266 246 91 132 266 113 155 157 115 165 234 152 190 130 193 104 137 133 205 243 247 148 184 160 197 156 184 247 135 181 249 200 119 152 254 201 194 182 170 255 185 127 338 176 194 207 180 160 202 147 244 194 148 184 159 249 159 176 141 216 210 273 255 151 118 155 137 166 165 161 206 208 128 208 258 232 121 228 228 145 382 183 177 208 159 192 153 204 355 224 161 260 123 -9 259 234 116 183 -9 132 185 242 259 -9 153 183 109 277 191 180 131 200 149 151 121 212 191 142 146 175 320 215 151 245 190 183 169 260 152 233 282 231 124 244 163 188 297 249 175 274 147 260 220 276 183 261 189 259 112 267 108 278 224 257 108 296 327 245 246 298 166 206 189 245 278 172 278 223 190 193 278 264 188 219 148 159 149 110 291 182 201 242 184 301 237 303 226 129 125 244 157 326 163 257 170 182 154 204 -9 264 202 224 286 223 174 234 180 300 169 239 266 158 324 293 199 261 -9 136 172 376 211 193 181 229 176 292 186 191 298 307 144 176 164 277 135 154 195 196 212 177 272 324 274 206 200 153 246 202 201 284 135 249 274 201 100 270 204 198 246 163 149 111 165 405 171 192 253 231 211 221 164 139 260 268 125 256 152 150 240 233 256 224 167 304 202 225 203 134 121 205 125 249 183 129 346 313 211 216 320 265 216 206 181 -9 188 146 258 231 235 267 221 
1045 87 Pima Mexico AMERICA 126 124 124 129 142 234 142 112 182 98 130 120 148 217 258 233 163 163 218 196 175 143 247 134 228 184 186 142 119 199 183 176 154 173 98 166 120 147 170 182 -9 188 249 115 141 120 234 245 271 201 221 96 117 233 196 291 184 116 95 241 192 127 132 -9 163 150 251 234 91 132 257 110 155 151 115 162 234 152 190 130 190 104 137 133 205 243 241 139 179 160 179 156 184 247 126 172 246 200 119 140 246 197 190 158 162 251 181 119 334 176 194 207 178 160 190 139 244 190 140 184 155 237 151 176 141 200 210 273 251 147 110 151 133 150 161 157 202 208 128 208 238 224 121 224 224 133 374 183 173 204 147 188 153 196 351 204 153 260 115 -9 259 230 116 175 -9 132 185 234 251 -9 153 175 109 273 187 180 131 188 149 139 105 212 191 142 138 171 308 199 151 245 190 183 165 252 148 233 270 211 124 240 155 188 297 241 171 274 143 260 220 276 183 249 185 259 112 263 104 278 216 257 104 296 323 245 238 294 158 186 189 233 274 168 274 223 190 177 274 264 180 207 140 159 141 110 291 178 197 242 184 301 237 303 214 129 125 244 153 322 159 257 166 182 150 204 -9 264 202 220 282 209 174 226 180 292 169 235 266 158 320 289 199 229 -9 132 172 372 207 193 181 209 172 292 186 183 298 303 140 176 152 273 123 150 191 188 188 173 264 292 266 202 200 153 246 202 201 272 135 249 274 197 100 266 200 198 232 163 149 111 165 405 167 192 241 227 207 213 160 119 256 264 121 256 152 150 204 233 252 204 155 304 198 213 203 130 111 205 125 245 181 117 342 305 203 212 316 241 212 202 173 -9 184 146 250 227 231 251 217 
1046 87 Pima Mexico AMERICA 126 128 146 135 142 232 150 112 182 98 130 120 148 217 258 235 165 167 218 196 187 149 249 134 228 184 208 -9 119 207 183 176 154 173 98 166 130 173 172 182 212 191 249 115 150 120 234 245 271 216 221 96 126 233 208 306 190 116 95 241 192 136 141 122 163 156 266 234 91 132 266 107 155 157 -9 165 234 152 190 130 193 104 146 136 205 246 247 148 184 160 194 156 184 247 135 181 249 200 119 140 254 201 194 182 170 251 185 127 334 176 -9 207 178 160 190 147 244 194 148 192 159 249 163 176 141 224 210 273 255 151 118 155 137 170 161 161 202 208 128 216 242 244 121 224 240 145 378 183 173 204 159 192 153 204 355 212 161 240 116 214 259 238 116 183 -9 132 185 242 259 192 153 183 121 -9 195 180 131 192 149 155 121 212 191 154 142 175 324 235 159 245 190 183 181 260 152 233 282 231 124 244 155 188 297 249 171 274 147 272 220 276 187 253 181 267 112 267 108 278 -9 273 100 300 319 245 242 298 166 186 209 245 314 164 278 235 190 177 274 268 180 219 160 159 149 110 287 178 201 246 184 301 237 303 226 133 129 244 153 322 163 -9 166 182 158 212 220 264 202 224 286 209 174 234 180 308 173 -9 266 158 324 293 207 229 164 136 172 376 211 193 181 213 176 300 186 191 302 307 144 176 164 273 135 154 199 196 212 173 272 300 274 202 200 153 246 190 201 284 135 249 278 209 100 282 200 198 246 175 173 115 169 405 -9 200 241 231 207 221 164 131 256 268 125 256 164 150 244 233 256 220 167 -9 202 221 203 134 111 205 125 249 183 129 382 -9 211 216 320 265 216 206 181 205 188 146 258 231 231 259 221 
1046 87 Pima Mexico AMERICA 126 128 124 129 142 232 142 112 182 98 130 114 148 217 258 235 163 163 218 196 175 143 243 132 228 184 208 -9 119 207 183 176 154 165 98 166 126 145 166 180 208 185 249 115 141 108 225 239 271 201 221 96 117 230 196 291 184 116 95 241 192 133 132 116 163 156 251 234 91 132 263 107 155 151 -9 165 234 152 190 130 190 104 137 133 205 243 241 139 179 160 179 156 184 235 126 172 246 197 119 140 246 197 190 158 162 247 185 119 334 176 -9 207 174 160 190 139 244 190 144 184 155 237 159 176 133 216 210 269 251 147 110 147 133 170 157 157 202 208 128 208 238 232 121 216 228 133 378 183 169 204 147 188 153 200 351 204 153 240 116 214 259 230 112 175 -9 132 185 238 259 180 153 175 117 -9 187 180 131 188 149 139 105 212 191 142 126 171 308 215 151 245 190 183 165 244 148 233 270 231 124 236 147 188 289 241 171 274 143 268 220 272 183 249 181 251 104 263 104 258 -9 257 100 296 319 237 238 294 158 186 189 233 278 164 274 223 174 173 274 268 176 215 140 155 141 100 279 178 201 226 180 301 237 303 214 129 125 224 153 322 159 -9 166 182 154 204 220 264 198 220 282 209 174 222 180 304 169 -9 266 158 320 289 199 229 160 132 172 372 211 193 181 209 172 296 186 179 298 303 144 176 152 269 123 146 195 188 188 169 268 292 258 202 188 149 246 190 201 272 135 249 274 201 100 270 180 186 246 163 173 111 165 405 -9 192 241 227 203 213 160 131 256 264 121 256 152 138 240 233 252 204 151 -9 198 213 199 130 111 199 121 245 183 117 346 -9 211 212 320 241 212 202 173 205 188 146 250 227 227 251 217 
1047 87 Pima Mexico AMERICA 126 128 124 131 142 234 140 112 182 98 130 120 148 227 258 233 173 165 220 198 191 149 249 132 204 208 208 138 141 207 183 180 158 169 112 166 120 147 170 180 212 188 255 115 150 120 234 245 271 201 221 96 117 233 208 297 190 116 95 241 192 133 141 122 166 156 266 246 91 135 260 110 155 157 109 -9 234 152 190 133 190 104 137 136 202 243 244 148 179 160 200 153 184 253 135 190 252 200 119 156 254 201 202 166 166 263 189 123 338 176 196 207 180 160 190 147 244 202 152 188 155 241 159 176 141 240 210 273 251 155 126 159 149 166 157 157 206 212 128 220 250 228 121 228 236 145 382 187 173 204 159 192 157 212 355 212 161 260 115 222 263 234 120 183 243 -9 185 238 259 192 153 179 113 -9 195 180 131 200 149 151 121 212 191 158 138 171 324 215 155 245 190 187 169 260 144 237 274 231 124 248 163 184 297 225 171 278 151 268 220 -9 207 261 185 267 108 267 108 278 -9 277 108 296 327 245 238 286 146 210 209 233 278 164 270 235 178 193 278 264 180 219 156 163 149 106 287 194 197 246 184 -9 237 303 214 133 125 248 157 326 159 249 170 178 158 216 -9 264 198 -9 290 217 178 226 176 300 -9 255 266 158 320 293 203 229 164 136 184 372 219 189 189 237 176 300 186 183 298 303 140 176 164 289 131 158 199 196 184 173 272 296 262 202 200 149 250 190 209 284 139 249 286 201 116 278 208 198 250 -9 153 111 161 405 163 204 249 227 205 213 176 139 252 268 129 256 172 138 240 241 260 208 171 308 202 225 203 134 119 213 125 249 195 129 346 313 211 212 316 265 216 210 177 205 192 146 262 235 231 271 237 
1047 87 Pima Mexico AMERICA 120 128 124 129 142 232 138 112 182 98 130 114 148 217 258 231 147 165 218 194 187 145 247 128 204 200 188 138 119 205 174 176 148 165 94 166 120 145 170 174 208 188 249 115 141 108 234 239 271 195 221 96 117 233 199 294 184 116 95 238 192 127 138 113 163 150 266 234 91 126 257 107 155 151 106 -9 234 152 190 130 178 104 137 130 202 228 244 148 179 160 179 150 184 247 126 172 246 197 119 156 246 197 194 162 162 259 181 119 334 176 194 203 178 152 190 147 244 194 140 184 151 241 151 172 133 224 206 273 247 147 118 159 133 150 157 157 206 208 128 216 238 224 121 224 228 145 382 179 169 204 159 192 153 200 347 212 157 240 111 218 259 234 112 175 235 -9 181 234 251 180 145 179 109 -9 191 180 131 188 145 139 121 208 191 142 138 163 320 215 151 237 190 183 169 236 140 233 270 219 124 244 151 172 297 225 167 274 143 260 220 -9 195 249 185 259 104 263 104 278 -9 273 108 288 323 245 230 282 146 206 189 233 278 164 270 231 170 177 278 260 180 215 152 159 141 104 287 174 193 242 180 -9 237 303 214 125 125 224 153 326 159 245 166 170 150 204 -9 260 198 -9 286 209 170 226 172 300 -9 239 266 158 320 293 199 225 164 128 172 372 207 185 181 233 172 296 174 179 298 303 140 176 152 273 119 154 195 192 184 173 264 296 258 198 200 149 234 190 201 256 135 249 282 201 100 270 208 190 246 -9 137 111 141 405 159 192 245 223 205 201 168 119 252 260 121 256 152 134 240 229 252 204 159 308 198 185 199 130 111 205 125 249 195 117 346 309 203 204 316 241 212 206 173 201 188 146 250 231 231 251 221 
1048 87 Pima Mexico AMERICA 126 -9 144 137 142 232 150 124 188 -9 130 120 148 217 258 231 173 169 -9 196 175 147 247 132 224 184 206 146 147 207 183 182 158 169 -9 172 120 147 170 174 212 188 258 115 141 129 240 245 277 195 239 96 117 233 208 297 190 -9 98 241 192 133 144 -9 163 156 266 246 91 132 263 107 155 157 115 162 240 152 190 130 190 104 143 136 205 243 247 148 182 169 -9 156 190 244 135 181 249 200 119 156 254 201 202 162 170 263 181 131 338 176 200 203 184 168 206 143 248 194 140 196 155 241 151 176 137 232 206 305 255 151 126 159 149 166 157 157 206 212 128 208 238 224 -9 224 240 145 378 183 173 204 163 188 157 196 359 224 153 260 119 218 259 234 120 183 233 128 185 242 259 192 153 183 129 273 199 180 143 208 157 151 117 212 191 154 146 175 324 219 155 245 190 183 169 244 148 233 274 215 124 244 159 184 297 241 175 274 147 260 220 280 195 253 189 251 104 267 108 286 224 273 100 296 323 237 230 298 170 194 189 -9 314 172 278 239 190 -9 278 -9 184 207 160 159 153 110 291 182 201 246 184 309 237 315 222 129 129 244 -9 322 159 257 174 178 158 208 -9 264 198 224 278 223 194 226 184 308 -9 255 266 158 320 293 207 261 -9 136 -9 -9 203 193 -9 229 160 292 186 187 -9 303 140 188 156 277 123 162 203 196 188 181 264 324 266 202 200 153 250 206 209 272 135 249 -9 201 100 282 204 198 250 175 173 115 165 409 171 204 253 227 207 217 172 139 260 260 137 256 168 146 244 233 264 212 151 304 202 225 203 138 121 205 125 249 183 133 382 309 -9 180 320 269 216 206 181 -9 192 146 258 231 231 259 237 
1048 87 Pima Mexico AMERICA 126 -9 124 129 142 226 150 112 182 -9 130 120 148 217 254 231 147 165 -9 188 175 143 247 132 224 184 188 138 119 199 183 182 154 167 -9 166 120 147 168 174 208 185 255 115 141 120 234 239 271 195 221 96 117 233 196 291 187 -9 95 241 192 127 132 -9 163 150 257 234 91 120 260 107 155 157 106 162 234 152 190 130 187 104 131 136 202 243 241 148 182 160 -9 156 184 235 126 181 246 197 119 152 246 201 194 158 162 259 181 119 326 176 188 195 178 156 202 139 240 194 140 192 151 241 151 172 125 200 202 273 247 151 122 151 137 150 149 157 202 208 128 208 238 208 -9 220 228 133 374 183 173 200 147 188 157 196 351 212 149 240 115 218 259 230 116 175 231 128 177 234 251 192 149 179 117 269 187 176 131 196 149 139 117 212 191 142 146 171 308 199 151 245 190 183 169 244 148 233 270 211 112 240 155 176 293 241 171 266 147 260 216 280 183 249 185 251 104 263 104 262 220 257 100 280 319 233 230 286 154 194 189 -9 290 164 274 235 190 -9 278 -9 176 207 140 159 141 100 291 178 193 226 180 301 237 307 214 129 129 244 -9 322 155 253 166 170 154 204 -9 264 198 220 278 217 174 226 172 304 -9 235 266 142 316 289 203 229 -9 136 -9 -9 203 177 -9 213 160 292 182 179 -9 303 140 176 152 273 119 154 191 192 188 169 264 300 242 202 188 149 242 202 201 260 135 245 -9 197 100 270 204 186 246 163 173 115 141 405 159 192 241 227 203 213 164 131 260 260 129 256 164 134 240 233 252 204 151 304 198 217 199 134 121 205 125 245 181 117 358 305 -9 180 316 265 212 198 181 -9 184 146 250 231 219 251 217 
1049 87 Pima Mexico AMERICA 126 128 144 137 142 234 150 124 182 98 130 120 148 227 258 233 173 165 218 198 193 149 247 132 224 200 206 146 141 207 183 182 158 169 104 172 120 147 170 180 208 188 255 115 141 129 234 -9 271 201 239 96 117 233 208 294 187 116 95 241 192 133 138 122 166 156 266 246 91 135 263 110 155 157 106 165 240 152 190 130 187 104 137 136 202 243 244 148 182 169 197 156 184 253 135 181 252 200 119 156 254 201 202 162 170 259 181 119 338 176 194 203 178 168 206 147 244 194 140 196 151 241 159 172 133 240 210 305 255 155 126 159 137 150 157 157 206 208 128 220 250 224 137 224 240 145 382 183 173 204 159 192 157 200 351 224 161 260 119 218 259 234 120 175 235 136 185 242 259 192 153 183 117 277 195 180 131 196 157 151 121 212 191 158 146 175 324 219 151 245 190 187 169 -9 148 237 270 231 124 248 155 184 297 241 -9 278 147 260 220 280 207 261 185 267 104 267 108 278 224 277 108 296 323 245 238 -9 154 206 209 233 314 164 278 239 190 177 278 -9 184 219 160 163 153 106 291 178 193 246 184 309 237 307 222 133 129 244 153 326 159 253 174 170 158 216 216 264 198 224 286 217 174 226 -9 304 177 255 266 158 320 293 203 229 164 136 184 376 207 193 189 233 172 296 186 187 298 303 140 188 152 273 123 162 195 196 188 181 -9 300 258 202 200 153 250 206 209 284 135 249 286 201 116 278 208 198 246 175 173 115 161 409 159 204 253 227 205 217 176 131 260 260 137 256 172 146 244 233 252 204 159 308 198 217 199 138 121 213 125 249 195 -9 382 309 203 212 316 269 216 206 181 205 192 146 258 235 231 259 237 
1049 87 Pima Mexico AMERICA 126 128 124 129 142 226 140 112 182 96 130 114 148 217 254 231 147 165 214 188 175 147 247 128 204 184 188 138 119 199 174 176 148 169 112 166 120 145 170 174 208 188 249 115 141 108 234 -9 271 195 221 96 117 233 196 291 184 116 95 238 192 127 132 122 163 156 257 234 91 132 260 107 155 157 106 162 234 152 190 130 178 104 131 130 202 243 241 148 179 160 179 153 181 235 126 172 249 197 119 152 246 201 194 158 166 259 181 119 334 176 188 195 178 152 190 139 240 194 140 184 151 241 151 172 125 232 202 273 251 151 126 151 133 150 157 157 202 208 128 208 238 224 121 224 236 145 374 179 173 204 147 188 157 196 347 212 153 240 115 218 259 234 120 175 231 128 185 238 259 180 153 179 109 269 187 180 131 188 149 151 117 212 191 154 138 163 308 215 151 245 190 183 169 -9 144 233 270 211 124 240 151 176 297 225 -9 274 143 260 220 276 195 249 185 251 104 267 104 262 216 273 100 296 323 237 230 -9 146 194 189 233 278 164 270 231 178 173 278 -9 180 207 156 159 141 100 287 174 193 246 184 305 237 303 214 129 125 224 149 322 155 249 170 170 150 208 212 260 198 220 278 217 170 226 -9 300 173 255 266 158 320 289 199 229 160 128 172 372 203 189 181 213 160 292 186 183 298 303 140 176 152 273 119 158 191 192 184 173 -9 296 242 198 188 149 234 190 201 260 135 245 282 197 100 270 204 186 246 163 137 111 141 405 159 192 245 227 203 201 164 119 252 260 129 256 168 134 240 229 252 204 151 304 198 185 199 130 111 205 125 245 181 -9 346 309 203 180 316 265 216 206 177 205 184 146 250 231 219 251 217 
1050 87 Pima Mexico AMERICA 126 128 144 129 142 232 150 124 182 98 130 120 148 217 258 231 173 169 218 196 175 143 247 134 224 184 208 146 119 207 183 182 158 165 98 172 120 147 168 180 212 188 258 115 156 129 234 245 271 216 239 96 117 233 196 297 -9 116 107 241 192 136 144 122 163 156 266 246 94 132 266 107 155 157 115 162 234 152 190 130 193 104 143 136 205 246 244 148 182 160 197 156 190 247 126 193 249 200 119 156 254 201 202 158 170 251 189 131 338 176 188 203 180 168 206 139 240 194 160 192 155 241 -9 176 141 232 210 273 255 151 118 159 137 170 165 157 202 212 128 208 238 224 145 224 236 145 378 183 173 204 163 196 157 200 359 224 157 260 -9 222 271 234 120 187 243 140 185 242 255 192 153 183 129 273 199 184 143 208 157 151 117 212 191 154 146 175 328 199 159 245 194 187 169 244 148 249 274 215 116 244 155 184 297 241 175 274 147 268 220 280 195 253 185 263 104 267 108 286 224 257 100 296 323 241 230 294 170 194 189 241 314 172 274 223 190 189 278 -9 180 215 152 159 153 112 291 182 201 -9 184 309 241 315 222 129 129 244 153 326 163 257 174 170 162 208 216 264 198 224 282 223 194 226 184 308 173 255 266 158 320 -9 207 261 164 136 172 376 211 177 197 229 172 300 182 187 298 299 144 176 -9 277 119 162 195 196 188 173 272 324 274 202 204 153 250 206 -9 284 135 249 286 201 100 270 204 198 250 175 173 115 165 409 171 200 253 227 211 217 172 119 260 268 137 256 168 146 248 233 264 224 151 304 198 221 203 138 -9 205 125 249 183 133 382 309 211 180 320 265 216 206 181 213 184 146 258 231 231 259 237 
1050 87 Pima Mexico AMERICA 120 124 124 129 142 226 150 112 182 96 130 114 148 217 258 231 173 167 214 188 175 143 237 132 204 184 188 146 119 199 183 182 154 165 94 172 120 147 166 174 212 188 255 115 141 108 234 239 271 195 221 96 117 233 196 291 -9 113 95 241 192 127 132 113 163 150 257 234 91 120 257 107 155 157 106 162 234 152 190 130 193 104 143 133 202 243 241 148 179 160 194 156 184 235 126 181 246 197 119 152 254 201 194 158 166 247 181 127 326 176 188 195 178 156 202 139 240 194 140 188 151 241 -9 172 137 224 206 273 247 151 110 155 137 150 157 157 202 208 128 208 238 208 141 220 224 133 374 183 173 204 147 188 157 196 351 212 153 240 -9 218 259 230 116 175 225 128 177 234 251 172 149 179 117 269 187 180 131 196 149 147 117 210 167 142 146 171 308 199 151 245 190 183 169 240 148 233 270 215 112 244 151 176 289 241 171 274 143 260 216 276 195 253 181 251 104 263 104 262 212 257 100 288 319 237 226 286 166 194 189 233 290 164 274 223 190 173 274 -9 176 207 140 159 141 100 291 178 193 -9 180 305 237 307 218 125 129 244 153 322 159 245 166 170 158 204 220 264 198 220 278 217 174 226 172 304 173 239 266 142 316 -9 203 229 160 136 172 372 203 177 181 209 160 292 174 179 294 275 140 176 -9 273 119 154 191 192 184 173 268 296 266 202 188 149 242 202 -9 272 135 245 282 201 100 270 180 186 246 175 173 111 141 405 163 192 241 227 203 213 160 119 260 260 137 256 160 134 240 233 252 204 151 304 198 217 199 134 -9 205 125 237 181 117 358 305 203 180 312 241 212 206 181 205 180 146 254 231 231 259 217 
1051 87 Pima Mexico AMERICA 126 124 152 129 142 234 150 122 182 98 130 120 148 225 264 241 173 165 218 196 183 149 247 132 232 208 188 146 139 199 183 176 154 173 98 172 130 173 166 180 212 188 249 115 156 108 237 242 271 195 242 96 117 236 196 306 187 116 98 238 195 136 144 116 163 150 266 246 91 135 257 107 155 157 115 168 243 152 190 133 190 104 137 136 205 243 244 142 184 166 197 153 184 241 138 193 249 200 119 152 254 201 202 166 170 -9 185 131 334 176 190 199 184 164 210 143 248 198 156 192 155 241 159 176 141 200 206 313 247 151 118 155 149 166 161 157 202 208 128 208 250 232 121 228 236 145 386 183 177 204 159 196 177 192 347 224 157 268 120 222 267 238 120 183 243 140 181 242 251 196 153 179 117 273 195 180 143 200 149 143 121 212 191 142 150 171 324 215 159 241 190 187 173 256 144 237 274 227 124 244 155 176 297 245 175 270 155 268 220 276 199 253 189 267 112 267 104 262 220 265 108 300 323 245 242 298 162 202 193 241 302 172 278 239 178 173 278 -9 184 219 156 167 141 106 287 178 193 258 184 301 241 307 226 133 129 248 169 326 163 257 174 178 150 208 216 264 198 224 282 209 174 226 180 308 173 255 266 158 332 289 199 229 164 136 176 376 207 193 193 209 176 300 186 187 298 275 144 176 164 277 127 154 191 196 184 173 264 296 270 206 188 149 246 202 201 284 135 249 286 205 112 258 204 198 246 163 161 111 165 409 171 204 253 235 205 213 164 131 260 276 121 264 168 -9 240 237 256 208 167 312 202 225 203 134 -9 205 125 253 195 129 370 317 215 216 316 265 216 -9 181 205 188 146 258 235 235 271 217 
1051 87 Pima Mexico AMERICA 120 124 144 129 142 234 150 112 182 96 130 120 148 225 258 229 173 165 218 194 175 143 249 132 228 198 188 144 119 193 183 176 154 169 94 166 128 145 166 180 212 185 246 115 150 108 225 239 265 195 221 96 117 230 196 294 187 116 95 238 192 127 132 113 163 147 266 234 91 132 257 107 155 151 112 162 228 152 190 130 190 104 134 133 202 243 244 139 179 160 179 150 184 241 132 187 246 197 119 152 246 201 202 162 170 -9 181 131 334 176 190 195 178 160 190 139 244 194 152 192 155 237 151 172 137 200 206 301 247 151 118 155 137 150 161 157 198 204 128 204 238 228 121 228 236 133 386 183 173 200 147 188 133 192 347 204 153 240 97 214 259 234 116 183 225 132 177 234 251 192 153 179 109 265 191 176 131 200 141 139 117 212 191 142 146 167 320 215 151 237 190 187 173 244 144 233 270 227 116 240 151 172 293 241 171 270 155 264 220 272 191 241 181 263 104 263 104 258 220 257 100 288 323 241 230 298 146 198 193 237 298 164 278 235 178 173 270 -9 176 215 152 159 141 100 279 178 185 242 180 301 237 303 210 129 125 244 153 322 155 253 166 178 146 204 212 260 198 220 278 209 166 226 180 304 143 251 258 154 320 289 199 225 164 128 172 372 207 193 181 209 172 300 174 183 298 275 144 176 152 269 115 146 163 192 184 173 264 296 250 202 188 145 234 194 201 268 135 245 274 201 100 258 180 186 246 163 153 111 161 405 163 204 253 231 205 213 164 119 252 268 121 256 160 -9 240 233 256 204 151 308 202 221 203 134 -9 203 123 245 195 117 366 313 203 216 312 237 216 -9 177 193 184 142 250 227 227 267 217 
1052 87 Pima Mexico AMERICA 126 128 124 137 142 232 150 112 188 98 130 120 148 217 258 241 173 167 220 196 175 143 247 134 226 184 208 146 119 201 183 182 158 169 100 172 120 147 168 180 212 188 258 115 153 129 240 245 277 195 221 96 117 233 -9 294 190 113 107 256 192 127 144 113 163 156 266 246 94 -9 260 107 155 157 106 162 240 152 190 130 193 104 143 136 205 246 241 148 182 169 197 156 190 247 135 193 261 200 119 156 254 201 202 162 170 259 189 131 338 176 188 203 184 168 202 139 248 194 160 196 155 241 155 -9 141 232 210 273 247 151 122 155 137 170 165 -9 -9 212 128 216 238 228 141 224 240 145 378 183 173 204 163 196 157 196 359 224 153 264 123 222 271 234 120 187 243 128 209 246 259 192 153 183 117 277 191 184 135 208 153 159 117 212 191 154 146 171 312 -9 159 245 198 183 -9 244 148 237 274 215 112 244 155 188 293 241 175 274 147 268 228 280 195 257 189 263 108 267 108 -9 220 257 108 296 319 237 230 294 166 194 189 241 290 172 278 239 190 189 278 -9 180 207 156 159 153 112 291 182 201 246 184 305 241 315 222 129 129 -9 153 326 163 253 166 178 158 -9 220 264 202 228 282 217 194 226 184 308 173 255 266 158 320 293 207 261 164 140 184 372 211 193 181 213 172 300 186 179 298 303 144 188 156 289 123 154 203 192 188 181 272 300 266 202 204 153 250 206 209 284 135 249 282 201 100 -9 204 186 246 175 173 115 165 409 171 200 253 235 211 217 172 131 260 268 137 256 168 146 240 233 264 224 151 304 200 217 -9 138 121 205 125 245 191 133 358 309 211 216 320 265 216 210 181 205 188 146 254 231 231 259 217 
1052 87 Pima Mexico AMERICA 126 128 124 129 142 228 150 112 182 98 130 120 148 217 254 231 165 165 214 194 175 143 237 132 222 184 206 138 119 199 183 182 154 165 98 172 120 145 166 174 212 185 249 115 141 120 234 224 271 195 221 96 117 233 -9 291 187 113 95 241 192 127 132 113 163 150 266 234 91 -9 257 101 155 157 106 162 234 152 190 130 190 104 131 133 202 243 241 148 179 160 179 150 184 235 126 181 246 194 119 152 246 201 194 158 170 251 181 123 334 176 188 195 180 160 202 139 240 194 140 188 155 241 151 -9 125 200 202 269 247 151 110 151 133 166 149 -9 -9 208 128 208 238 208 121 220 236 145 374 183 173 204 147 188 157 192 351 220 149 240 119 218 259 230 116 183 233 128 177 242 251 172 149 175 109 269 187 176 131 200 149 151 117 212 167 142 126 171 308 -9 155 245 190 183 -9 240 144 233 270 211 108 236 155 176 289 241 171 274 143 260 217 276 183 253 181 251 104 267 108 -9 212 257 100 292 319 233 226 286 154 186 189 233 278 164 274 223 178 173 278 -9 176 207 140 159 141 110 291 178 185 226 180 301 237 315 218 125 125 -9 149 322 155 245 166 170 158 -9 216 264 198 224 278 217 170 226 172 308 173 235 266 158 316 289 203 261 160 136 172 372 203 177 181 209 160 292 174 179 294 299 140 176 152 277 119 154 195 188 184 173 264 296 262 202 200 153 242 190 201 260 135 249 278 197 100 -9 180 182 228 163 173 111 141 405 167 192 241 227 203 217 160 119 260 260 121 256 160 142 180 233 260 204 151 304 198 185 -9 138 111 205 125 237 181 117 346 305 211 180 320 265 216 206 181 201 184 138 250 231 219 251 217 
1053 87 Pima Mexico AMERICA 126 126 150 129 142 234 150 112 182 98 130 120 148 217 264 233 173 167 218 196 187 147 247 140 226 184 200 146 119 207 183 182 158 173 102 166 120 147 168 182 212 185 249 115 150 120 234 245 271 -9 221 96 117 233 208 306 190 116 95 -9 192 133 141 116 163 156 266 246 91 132 263 110 155 157 115 162 234 152 202 133 187 104 137 136 205 243 244 148 179 160 200 156 184 244 126 193 246 200 119 156 254 201 202 182 174 251 185 131 334 176 200 203 180 164 190 139 244 194 148 192 151 241 163 176 137 216 210 273 251 151 126 155 153 170 153 169 206 208 128 216 242 244 145 228 -9 145 386 183 173 208 151 188 157 200 359 212 157 244 115 226 263 238 120 183 229 136 185 234 255 188 153 -9 117 273 -9 184 143 200 149 163 121 210 195 158 150 175 324 221 159 245 190 195 181 256 144 233 274 227 124 240 -9 184 297 241 175 274 147 268 224 276 187 261 181 267 108 267 108 278 224 269 100 288 327 -9 234 290 162 202 209 245 286 172 278 235 178 193 278 -9 184 215 160 163 153 110 287 182 201 242 184 317 241 311 214 133 125 248 153 322 159 261 166 182 154 204 224 264 202 220 286 221 178 230 -9 292 173 255 270 158 320 289 207 229 160 136 172 380 211 193 197 229 172 300 186 187 302 307 148 176 152 289 131 162 207 196 196 173 264 300 274 202 200 149 246 202 201 284 -9 249 278 201 -9 278 204 202 246 163 153 111 165 405 163 204 253 227 205 -9 160 131 260 272 129 256 -9 150 244 237 260 224 171 308 202 217 203 134 121 205 129 245 187 129 354 313 211 220 316 265 216 210 181 213 188 146 262 227 231 271 217 
1053 87 Pima Mexico AMERICA 120 124 124 129 142 232 150 112 180 98 130 120 148 217 264 229 171 163 218 194 175 143 243 140 204 184 188 134 119 205 183 176 154 171 94 166 120 145 166 174 208 185 249 115 141 120 225 224 271 -9 221 96 117 233 196 291 184 116 95 -9 192 127 132 113 163 150 263 234 91 126 260 101 155 151 112 162 234 152 190 130 187 104 134 136 205 243 244 142 179 160 200 153 184 241 126 193 246 197 119 152 246 201 190 162 162 251 181 127 334 176 196 203 180 156 190 135 240 190 144 184 151 233 155 172 137 200 206 273 247 147 122 147 145 170 153 157 206 204 124 208 238 224 121 228 -9 133 378 183 169 200 147 188 153 200 347 204 153 240 115 218 259 234 112 175 225 132 177 234 251 172 153 -9 113 269 -9 180 131 200 145 147 121 200 195 142 138 171 324 215 151 245 190 183 177 252 140 233 274 227 116 236 -9 176 297 241 175 274 143 260 221 272 183 253 181 263 104 267 104 278 220 257 100 288 323 -9 230 286 158 194 181 233 274 164 278 231 178 189 270 -9 184 207 156 159 141 100 283 178 185 242 180 309 237 303 210 117 125 244 153 322 155 257 166 170 146 204 220 264 198 220 282 213 174 226 -9 292 169 235 258 146 320 289 199 229 160 136 172 376 203 177 181 209 172 296 182 187 302 303 144 176 152 273 123 146 163 196 184 169 264 296 266 198 192 149 242 202 201 272 -9 249 274 197 -9 270 204 198 232 163 149 111 141 405 163 204 249 227 205 -9 160 119 252 264 121 256 -9 134 220 233 256 204 155 308 198 185 199 118 111 205 123 241 183 117 342 309 211 216 316 261 212 206 173 205 184 138 258 227 231 259 217 
1054 87 Pima Mexico AMERICA 126 128 144 129 156 234 150 126 182 98 130 120 148 227 264 233 165 165 218 198 191 149 249 134 224 186 190 146 139 207 183 182 154 173 104 172 126 147 172 182 212 188 249 115 141 108 234 242 271 -9 239 96 117 230 196 297 -9 116 95 253 192 127 144 122 163 150 266 246 91 132 263 107 155 157 109 165 240 152 190 130 193 104 146 133 205 243 244 148 182 166 200 150 184 247 141 196 246 200 119 156 246 201 166 166 174 251 185 131 338 180 194 207 178 156 198 143 244 198 148 192 151 241 155 176 141 200 206 305 255 151 122 151 133 170 161 161 206 208 132 204 242 232 145 228 244 149 378 183 173 204 159 188 157 200 355 224 153 264 119 214 259 238 120 183 243 136 177 238 -9 180 153 179 121 277 199 188 143 200 157 159 121 219 191 154 150 171 324 215 159 245 190 203 173 260 144 233 274 227 112 244 163 184 297 249 171 274 151 268 224 272 195 261 185 271 104 267 108 282 224 265 104 296 327 241 242 286 158 198 -9 233 286 172 278 239 178 177 278 260 188 215 160 159 141 106 287 182 193 250 184 309 237 311 218 129 125 244 153 322 159 245 166 178 158 212 216 264 198 220 282 217 178 234 180 308 143 263 270 142 324 289 207 229 160 140 172 376 207 201 197 209 172 296 186 183 302 311 144 192 152 277 119 158 199 196 216 169 272 296 270 198 196 149 242 202 209 280 139 253 286 201 120 274 204 198 246 175 153 111 169 405 171 204 253 227 211 217 168 131 264 268 137 256 164 150 244 241 252 212 159 308 202 225 203 134 111 205 125 249 183 117 354 317 211 216 320 265 212 206 181 213 188 146 262 227 235 267 217 
1054 87 Pima Mexico AMERICA 120 128 140 129 142 230 140 112 182 98 130 114 148 217 250 231 163 165 218 194 183 147 247 132 204 184 188 146 139 205 183 180 148 163 104 168 120 145 170 182 208 188 249 115 141 108 234 239 271 -9 221 96 117 230 196 291 -9 116 95 238 192 118 132 119 163 150 251 237 91 126 260 101 155 157 109 165 228 152 190 130 193 104 146 133 202 243 241 145 179 160 194 150 184 241 126 193 246 200 119 156 246 201 194 166 162 251 181 123 326 176 188 195 178 156 190 139 244 198 140 184 147 237 155 172 133 200 206 273 247 151 118 147 133 166 157 157 202 204 124 204 242 224 121 216 240 145 374 183 169 204 147 184 153 196 355 212 153 244 111 214 259 234 120 175 243 128 177 234 -9 180 153 179 121 273 199 176 131 192 149 147 117 208 191 142 150 167 320 199 151 241 190 187 169 244 132 233 274 215 108 244 155 184 289 225 171 274 147 260 218 272 195 253 181 251 104 267 104 278 212 257 100 296 323 237 242 286 158 194 -9 229 270 160 274 223 174 173 278 256 176 215 140 155 141 98 287 178 193 242 176 301 237 303 218 125 121 244 153 322 155 233 166 178 154 204 212 264 198 220 278 209 174 230 176 304 143 251 258 142 316 289 199 225 160 136 172 368 207 185 193 209 172 292 182 179 302 275 140 176 148 273 119 154 191 192 188 165 272 296 266 190 188 149 234 202 205 272 135 249 278 197 116 266 180 182 246 163 149 111 165 405 159 204 241 227 203 213 160 119 256 264 121 256 148 138 224 237 252 204 151 304 198 185 199 134 111 203 125 249 181 117 338 305 203 204 316 265 212 206 181 205 188 138 262 227 231 255 217 
1055 87 Pima Mexico AMERICA 126 128 144 129 156 234 140 126 182 98 130 120 148 227 264 233 169 165 218 198 183 149 249 134 204 200 188 146 139 207 183 182 154 173 104 172 126 173 172 182 212 188 249 115 150 108 234 242 274 -9 239 96 117 233 208 297 -9 116 95 253 195 127 144 119 166 156 266 246 -9 132 263 113 155 157 109 165 243 152 190 130 193 104 146 133 -9 246 -9 148 182 160 197 150 184 247 126 193 246 200 119 156 246 201 166 166 162 251 197 131 338 176 194 207 180 156 198 143 248 202 160 192 147 237 159 176 141 240 206 273 247 151 122 155 149 166 161 165 206 216 140 208 242 232 121 228 240 145 378 183 173 208 159 188 157 196 355 224 157 264 119 218 267 238 120 183 -9 140 193 238 251 180 153 183 121 281 199 180 143 200 149 155 121 216 191 142 150 171 324 199 155 245 190 203 173 252 152 237 274 227 116 244 163 184 293 249 171 274 155 -9 224 272 195 253 193 259 104 271 108 278 224 265 108 296 327 241 242 286 158 202 -9 237 314 172 274 235 178 173 278 -9 192 219 160 159 157 98 287 178 201 250 188 301 237 307 222 129 125 248 153 322 155 253 166 178 158 204 220 264 198 220 278 223 174 234 180 308 169 263 270 154 324 293 207 229 164 136 172 376 211 185 197 209 172 296 182 183 302 307 148 176 164 273 135 158 191 196 196 173 272 296 270 206 204 149 246 202 209 280 139 249 286 209 120 278 204 202 246 175 149 111 165 409 163 204 249 235 203 217 168 131 256 268 125 256 164 150 240 241 260 212 159 308 202 225 203 138 121 203 125 249 195 117 354 305 211 216 320 265 216 210 181 213 188 146 262 227 231 263 217 
1055 87 Pima Mexico AMERICA 126 128 124 129 142 230 140 112 182 98 130 120 148 217 258 233 163 165 218 194 183 143 247 132 204 186 188 134 119 199 183 176 154 163 94 172 126 147 166 180 208 188 249 115 141 108 225 224 271 -9 221 96 117 230 196 294 -9 113 95 238 192 118 144 113 163 150 251 237 -9 132 257 107 155 151 106 162 228 152 190 130 190 104 140 133 -9 243 -9 142 182 160 194 150 184 241 126 193 246 200 119 152 246 201 202 166 162 247 185 131 338 172 188 195 178 152 190 143 244 198 148 192 147 237 155 176 137 200 202 273 247 147 118 147 133 150 157 161 206 208 132 204 238 224 121 224 224 145 374 183 173 204 147 188 157 196 347 220 153 260 111 214 259 230 116 183 -9 128 177 234 251 172 153 179 109 277 187 176 135 200 145 147 117 208 191 142 146 167 320 199 159 237 190 203 169 244 132 233 274 215 112 244 151 176 289 241 171 270 151 -9 220 260 183 245 185 251 104 267 108 278 220 257 100 288 323 237 226 286 158 194 -9 229 286 160 274 223 174 173 278 -9 188 215 140 155 141 98 279 178 193 242 176 301 237 303 218 125 125 244 153 322 155 245 166 178 154 204 216 264 198 220 278 217 166 226 180 304 143 255 270 142 316 289 207 225 160 136 172 368 207 185 193 209 172 296 182 179 294 307 144 176 148 273 119 154 191 192 188 169 268 292 242 198 188 149 234 202 209 268 139 249 282 201 100 266 180 182 246 163 149 111 149 405 159 204 241 227 203 213 160 127 252 264 121 256 148 138 224 237 252 208 151 308 196 225 199 134 111 199 125 245 181 117 382 285 211 204 316 265 212 206 181 205 188 138 250 227 219 255 217 
1056 87 Pima Mexico AMERICA 126 128 124 141 142 234 146 112 182 98 144 120 148 217 258 233 173 171 218 196 187 149 247 134 224 184 188 146 139 207 183 182 154 173 104 172 126 145 168 -9 212 188 255 115 141 120 234 239 271 216 221 96 117 236 205 306 190 116 95 241 192 133 144 113 163 156 257 246 91 132 260 107 155 157 109 165 240 152 190 130 190 104 137 133 202 243 244 151 179 166 194 153 184 253 135 187 249 197 119 156 -9 201 202 182 162 251 185 123 338 180 200 203 180 164 206 143 244 194 148 -9 155 237 155 172 141 240 210 273 247 155 126 155 137 166 161 157 206 204 140 212 250 232 137 228 232 133 386 187 173 208 -9 188 157 204 375 212 157 244 119 218 259 234 116 183 235 140 185 242 -9 192 153 179 121 277 199 188 143 192 157 167 121 212 191 154 146 175 320 -9 159 245 190 187 173 240 148 249 278 223 116 244 163 184 293 241 171 274 147 268 228 276 187 257 189 259 108 267 104 -9 216 257 104 288 327 241 242 298 166 202 209 233 286 164 274 235 178 177 278 268 184 219 156 159 149 110 291 182 201 246 184 309 237 303 218 129 129 244 169 330 163 257 174 182 158 208 216 264 198 224 278 223 174 230 180 -9 173 255 270 142 320 289 207 233 -9 136 172 372 215 201 197 233 164 292 182 187 298 303 -9 192 164 273 135 158 195 192 188 173 264 324 266 202 200 149 246 202 205 272 135 249 282 201 100 270 208 198 246 163 149 115 165 417 163 204 253 239 211 217 160 119 260 268 137 256 164 150 244 245 252 224 159 304 202 225 203 134 119 205 125 245 187 117 354 305 203 180 312 269 216 198 181 -9 188 146 258 227 -9 263 237 
1056 87 Pima Mexico AMERICA 126 126 124 129 142 234 140 112 182 98 130 120 148 217 250 231 163 169 218 194 187 143 249 134 204 184 188 138 119 199 183 176 154 171 94 172 120 145 166 -9 208 185 249 115 141 108 234 239 271 195 221 96 117 233 196 297 187 116 95 241 192 133 144 113 163 150 251 246 91 126 257 107 155 157 106 162 228 152 190 130 187 104 134 133 202 243 241 139 179 160 194 153 184 247 126 181 246 197 119 156 -9 197 194 166 162 247 181 119 326 176 194 195 178 164 202 139 240 194 140 -9 151 233 155 164 133 200 206 273 247 151 118 151 137 166 153 157 194 200 124 204 246 224 121 228 228 133 382 183 173 200 -9 184 157 200 351 212 157 240 115 214 259 234 116 175 233 128 177 238 -9 188 153 179 117 273 191 184 131 192 149 139 121 208 191 154 130 171 308 -9 151 237 190 183 169 240 132 245 274 215 116 244 151 184 289 241 171 270 143 260 220 276 187 253 185 251 104 263 104 -9 212 257 100 288 323 241 230 286 162 202 209 233 278 164 270 235 178 177 278 256 184 219 156 155 141 108 291 174 197 242 180 301 237 303 214 125 125 244 153 322 159 245 170 178 150 208 212 260 198 220 278 217 174 226 176 -9 165 235 266 138 316 289 207 229 -9 136 172 364 203 177 189 213 160 292 182 183 298 275 -9 176 156 269 131 158 191 188 184 173 264 296 266 194 196 141 242 190 201 272 135 245 278 201 100 266 204 178 232 163 149 111 149 405 163 200 241 231 205 213 160 119 260 264 121 256 160 134 224 241 252 204 159 304 198 217 203 134 111 203 125 245 181 117 346 305 203 180 308 265 212 198 181 -9 184 138 254 227 -9 259 217 
1057 87 Pima Mexico AMERICA 126 128 144 131 142 234 150 112 186 98 130 122 148 217 258 231 173 165 218 198 193 147 243 140 204 200 188 146 119 207 183 182 154 173 110 168 120 173 168 182 212 188 255 115 153 108 240 -9 271 195 239 111 126 233 205 306 190 116 95 241 195 133 144 122 163 156 -9 246 91 135 257 110 155 157 112 165 249 152 202 130 193 104 -9 136 205 243 244 139 182 166 200 153 184 247 135 199 249 197 119 156 254 201 198 182 174 255 185 139 342 176 196 207 178 156 206 139 244 202 148 196 163 241 167 176 141 224 210 297 251 155 126 163 133 170 161 177 202 216 128 204 242 232 145 228 232 149 374 187 181 204 147 188 157 208 367 212 153 260 115 218 259 234 124 183 243 132 177 242 251 188 153 179 133 277 191 184 139 196 149 147 117 212 191 158 138 175 320 219 159 253 190 187 173 252 148 245 274 223 116 244 151 188 297 241 187 274 143 260 220 276 187 253 189 271 112 267 108 278 216 257 96 300 327 241 238 294 170 198 189 237 306 172 282 239 174 193 274 264 184 215 160 159 141 110 283 194 193 250 176 309 241 307 226 137 137 248 169 322 163 257 170 182 162 212 220 260 198 224 282 221 170 234 180 304 169 255 266 158 324 293 199 261 160 136 172 376 215 197 181 209 196 296 186 187 302 311 144 196 164 273 135 158 203 192 184 173 268 296 266 202 196 153 242 202 209 272 135 253 282 197 116 270 204 198 246 175 173 111 165 405 163 200 253 227 207 213 176 119 260 272 137 256 172 134 244 241 260 204 159 312 202 221 211 134 121 205 125 249 191 133 374 313 211 216 320 265 216 206 181 205 188 146 262 227 235 267 221 
1057 87 Pima Mexico AMERICA 120 128 124 129 142 228 150 112 186 98 130 120 148 217 250 229 147 165 218 194 175 145 243 140 204 184 188 134 119 205 183 182 154 169 100 168 120 173 166 180 208 185 249 115 141 108 231 -9 271 195 221 96 117 233 196 306 184 116 95 238 192 127 144 113 163 141 -9 234 91 132 257 110 155 157 112 162 228 152 190 130 190 104 -9 133 205 243 244 139 179 160 194 150 184 247 126 190 246 197 119 152 246 201 194 166 170 251 181 135 334 176 194 195 174 156 190 139 240 194 140 184 151 237 163 176 137 216 210 273 247 151 110 151 133 166 157 157 198 204 124 204 238 232 121 224 228 145 374 183 181 204 147 188 149 200 355 212 153 244 97 214 259 230 116 183 229 128 177 238 251 180 153 175 117 273 191 176 131 196 149 147 105 212 191 154 138 175 308 199 151 245 190 183 173 252 132 233 274 211 108 244 151 180 293 225 175 270 143 260 220 272 183 253 185 263 104 267 104 274 216 253 84 288 323 241 234 286 158 198 181 233 270 164 270 231 174 193 274 256 180 215 152 155 141 106 279 174 185 246 172 305 237 303 218 129 129 248 149 322 163 253 162 178 158 212 216 260 198 224 278 209 170 226 172 300 143 239 262 142 320 293 199 229 160 136 172 372 211 189 181 209 160 292 182 183 298 307 136 176 164 269 123 158 183 192 184 165 268 296 266 198 188 141 242 190 197 256 132 249 274 197 100 254 200 198 228 163 153 111 149 405 159 200 245 227 197 213 172 119 252 268 133 256 160 134 208 229 252 204 159 304 198 185 199 134 111 199 125 249 181 117 338 285 203 212 312 265 212 206 181 205 184 146 258 227 227 263 217 
1058 87 Pima Mexico AMERICA 120 128 -9 129 142 234 142 124 188 100 130 120 148 217 258 241 173 171 220 196 191 149 247 136 230 186 190 146 139 207 183 182 158 169 104 172 120 173 168 180 212 188 246 115 141 120 240 245 271 195 221 111 117 233 196 306 190 116 95 241 192 127 138 113 166 156 266 237 91 132 263 110 155 157 -9 165 240 152 190 130 190 107 137 136 202 243 244 148 182 160 200 153 190 247 135 193 249 200 122 156 246 201 166 182 170 251 185 131 334 176 196 203 180 160 202 147 240 198 148 192 155 237 159 176 141 232 -9 273 247 151 122 155 149 170 157 161 202 208 144 208 258 244 145 220 240 149 378 187 173 204 163 192 153 200 355 212 157 260 115 222 267 234 120 175 243 128 177 242 259 192 153 187 109 277 191 180 143 200 145 143 117 219 191 154 150 171 324 235 159 245 190 187 181 260 148 245 274 227 116 244 159 184 297 241 175 274 147 264 228 276 187 253 185 259 104 267 108 278 216 273 108 296 327 245 234 298 166 206 193 233 314 172 278 239 178 189 282 264 184 215 152 159 149 108 283 186 201 246 180 309 237 303 218 133 129 244 153 322 159 257 166 182 150 204 216 264 202 224 286 223 194 234 184 308 173 239 266 158 320 289 207 261 168 136 172 376 215 189 197 221 172 292 186 191 298 295 136 188 152 277 135 -9 191 188 208 169 268 300 274 202 200 149 250 202 209 284 135 249 286 -9 116 278 204 198 246 163 153 115 169 405 163 204 253 235 203 213 172 139 260 -9 129 256 156 134 244 237 264 212 171 -9 202 221 203 134 111 205 125 249 181 129 382 313 203 212 316 265 216 206 181 205 192 146 -9 231 235 263 217 
1058 87 Pima Mexico AMERICA 120 124 -9 129 142 228 140 112 182 98 130 120 148 217 258 241 173 163 218 188 175 143 243 134 204 184 188 146 119 205 183 182 154 165 96 166 120 145 164 176 212 182 246 115 141 120 234 239 271 195 221 96 117 230 196 297 187 113 95 238 192 127 132 113 163 150 257 234 91 132 257 107 155 157 -9 156 234 152 187 130 190 104 137 133 202 228 241 148 179 154 197 150 184 241 126 181 246 197 119 140 246 201 202 162 162 251 181 119 334 176 186 195 180 156 202 147 240 194 144 184 155 237 151 172 133 200 -9 273 247 147 118 155 137 166 153 161 202 204 124 208 238 228 121 216 232 133 378 183 173 200 159 188 153 196 347 212 153 240 115 218 263 230 112 175 243 128 177 234 251 172 153 179 105 273 191 176 131 200 145 139 105 208 167 154 138 171 308 235 151 245 190 183 165 260 140 237 270 215 112 236 155 184 289 225 167 274 143 264 228 276 187 249 181 255 104 267 104 278 212 257 104 296 327 241 230 294 162 202 185 233 278 164 278 235 174 173 282 256 176 215 148 151 141 108 279 186 201 242 180 305 237 303 214 117 129 236 153 322 155 245 166 178 150 204 204 264 202 220 278 209 170 230 184 300 165 235 266 142 312 289 195 261 160 136 172 372 207 189 181 209 172 292 170 179 298 275 136 176 148 277 135 -9 187 188 184 169 264 292 258 190 200 145 230 190 201 272 135 249 262 -9 100 266 204 190 228 163 137 111 165 405 159 196 241 227 203 213 172 131 256 -9 121 256 148 134 240 233 256 204 151 -9 202 185 199 134 111 205 125 245 181 117 346 313 203 180 308 261 216 206 181 201 188 138 -9 227 227 263 217 
1059 87 Pima Mexico AMERICA 126 126 150 129 142 234 152 -9 188 98 142 120 148 217 258 241 173 163 218 194 191 149 249 134 230 208 190 138 141 207 183 182 158 169 104 172 128 147 170 182 212 188 258 115 150 108 234 245 271 216 221 111 126 236 208 309 190 116 95 256 198 130 141 116 163 156 266 234 91 126 263 113 158 157 115 165 234 152 190 133 193 107 146 133 205 243 244 148 179 160 197 150 184 247 135 187 246 200 119 152 254 201 202 178 170 247 185 127 338 180 196 199 180 156 206 147 248 194 144 196 155 237 163 172 137 224 210 313 255 151 118 155 133 150 157 165 206 204 140 208 258 232 121 228 236 149 382 187 173 208 155 196 157 204 355 212 157 260 119 218 263 234 120 175 243 128 177 238 255 192 153 179 113 277 199 180 139 200 157 151 121 218 191 142 134 175 324 215 155 245 194 187 177 256 144 237 278 227 120 244 163 184 297 249 187 274 151 268 224 276 207 253 185 263 108 267 112 278 224 257 108 296 323 241 230 294 162 198 209 241 286 172 278 235 178 173 282 268 192 215 164 163 141 106 287 186 201 242 184 305 237 303 218 129 133 244 165 322 163 261 170 178 154 208 220 264 202 224 286 209 194 230 184 308 165 251 266 158 316 293 199 261 172 136 184 372 215 185 189 221 172 296 182 187 302 275 140 176 164 277 119 158 191 192 212 173 272 296 270 202 196 149 246 194 209 284 135 -9 282 209 116 286 204 198 246 163 173 115 -9 405 163 204 253 239 209 217 176 131 260 268 137 256 160 134 204 241 260 212 159 308 202 217 203 134 119 205 125 253 195 125 354 313 203 204 316 261 216 210 181 213 184 146 254 231 235 275 221 
1059 87 Pima Mexico AMERICA 120 124 144 129 142 228 146 -9 186 96 130 114 148 217 250 231 173 163 218 188 177 143 247 132 228 184 188 134 119 199 183 172 154 165 94 166 120 143 170 176 208 185 249 115 141 108 225 242 271 216 221 96 117 230 205 297 187 113 95 238 198 127 138 113 163 156 263 234 91 120 260 101 155 157 112 162 228 152 187 130 193 104 137 130 205 228 241 148 179 160 194 150 184 241 135 181 246 197 119 152 246 201 202 158 162 247 181 127 326 176 194 195 180 156 190 135 240 194 144 184 151 237 155 164 137 216 206 273 255 147 110 151 133 150 157 157 202 196 124 204 238 224 121 224 232 133 378 183 169 200 147 188 117 200 343 204 157 240 111 214 263 234 116 175 235 120 177 234 255 180 149 175 109 273 199 180 131 200 145 139 121 210 187 142 126 167 320 199 151 245 190 183 177 252 132 233 274 211 116 244 155 172 289 241 187 274 151 260 224 276 191 253 185 263 96 267 112 258 220 257 100 288 319 241 226 286 162 186 197 237 278 164 274 231 175 173 274 256 184 211 164 159 141 106 283 182 193 226 184 301 233 303 214 129 125 240 153 322 159 249 166 170 150 204 212 264 198 224 278 209 178 230 180 292 143 235 258 150 316 289 199 225 160 132 172 368 203 177 181 209 172 292 182 187 298 275 140 176 148 269 119 158 191 192 208 169 264 292 258 190 196 145 234 190 201 284 135 -9 274 201 100 278 200 194 246 163 165 111 -9 405 163 204 253 235 205 217 168 127 260 264 125 256 152 134 196 233 252 204 159 308 202 209 199 134 111 205 125 253 181 125 346 309 203 180 312 241 216 202 177 213 184 142 246 227 227 263 217 
1060 87 Pima Mexico AMERICA 126 124 124 133 142 234 150 124 182 98 130 120 148 217 264 233 173 167 218 194 187 149 249 134 228 184 200 138 139 207 183 180 154 169 94 172 130 173 170 180 212 191 255 115 153 108 234 239 271 210 221 111 132 236 196 297 187 116 98 241 192 127 144 116 166 156 266 246 91 135 266 101 155 157 115 156 240 152 190 130 193 110 146 133 -9 246 244 148 179 160 203 150 187 241 138 190 249 200 122 152 254 201 202 182 174 263 185 119 334 176 194 203 178 168 210 147 244 194 144 192 155 241 159 176 133 216 210 273 255 151 126 155 149 166 157 169 206 212 140 216 246 232 121 228 -9 145 382 187 189 204 159 188 181 200 351 216 161 268 123 218 271 238 120 183 235 140 181 238 259 180 153 179 117 273 191 184 143 196 157 147 121 218 191 154 146 175 324 235 159 245 190 195 177 256 148 249 278 231 120 240 155 176 297 245 187 274 155 268 220 276 187 253 181 263 112 267 108 286 216 269 108 296 323 245 234 294 162 206 -9 237 298 172 274 235 178 177 278 264 188 215 156 159 141 100 283 178 189 246 184 309 237 307 226 129 137 244 157 322 163 253 174 182 154 212 216 268 202 224 286 223 194 226 184 308 -9 259 266 142 320 289 211 229 168 136 184 376 207 193 197 209 168 292 186 191 302 307 144 176 164 273 131 158 187 192 212 177 264 296 270 202 196 153 242 202 209 268 135 249 286 209 116 278 208 198 246 171 173 115 -9 417 163 204 253 235 209 225 172 131 272 268 125 256 172 134 244 237 256 212 171 308 202 217 203 138 121 205 125 245 195 129 366 317 203 212 320 265 216 210 181 213 184 146 258 235 231 259 217 
1060 87 Pima Mexico AMERICA 126 124 124 129 142 232 140 122 180 98 130 120 148 217 254 229 147 165 218 194 187 143 245 132 204 184 188 134 119 199 174 172 154 165 94 172 120 145 170 174 212 188 246 115 150 105 234 239 271 195 221 96 117 236 196 297 187 116 95 238 192 127 132 113 163 150 251 237 91 135 260 101 155 157 106 156 228 152 187 130 178 104 137 133 -9 243 238 139 179 148 200 150 184 241 126 187 246 200 119 152 246 197 190 166 170 251 185 119 334 176 194 195 174 164 198 139 244 194 144 184 155 241 151 172 129 200 210 269 247 151 122 155 149 166 153 157 202 208 128 208 238 228 121 224 -9 141 374 183 173 200 159 188 157 196 347 212 161 244 116 214 259 234 116 183 225 132 177 234 255 180 153 179 117 265 187 176 131 192 149 139 105 212 187 142 146 171 308 199 159 241 190 187 173 240 144 245 274 211 112 240 147 172 293 241 171 274 151 260 220 272 187 249 181 259 108 267 104 258 216 257 104 288 323 233 230 282 162 198 -9 233 278 164 270 235 174 173 274 260 180 207 152 159 141 100 279 178 185 242 184 305 237 303 218 129 125 244 153 322 155 237 166 170 146 204 212 260 198 224 278 209 178 226 180 304 -9 255 266 142 320 281 199 229 168 136 172 364 203 177 193 209 164 288 174 179 298 303 140 176 152 265 127 146 163 192 208 169 264 296 266 198 188 145 242 194 201 268 135 249 278 197 116 266 200 190 246 163 149 111 -9 405 159 196 249 231 205 217 168 131 252 260 121 252 160 134 240 233 252 204 171 308 202 209 203 130 111 201 125 233 187 117 346 293 203 180 316 261 212 198 173 201 180 146 258 227 227 259 205 
1061 87 Pima Mexico AMERICA 126 124 142 129 142 234 146 124 182 100 130 120 148 217 264 233 173 165 218 196 187 -9 249 134 230 184 188 138 139 199 183 180 154 169 94 172 130 173 168 180 212 188 255 115 153 120 234 239 271 210 239 111 126 236 196 297 187 116 98 241 192 127 144 116 163 150 266 246 91 135 266 110 155 157 112 156 240 152 187 130 193 104 146 133 205 243 244 148 179 160 203 150 190 247 129 190 249 197 119 152 246 201 202 178 174 259 189 123 334 176 196 203 180 160 210 147 244 194 156 192 163 241 159 172 133 240 210 273 255 151 122 155 149 174 157 173 206 212 144 216 242 244 129 228 240 145 382 187 189 208 159 188 181 200 351 212 161 260 123 214 259 238 116 183 243 140 181 238 255 192 153 179 117 273 199 188 143 200 157 147 121 218 191 142 146 175 324 235 159 245 190 195 177 244 148 245 274 227 124 240 155 188 297 245 187 274 151 260 228 280 195 253 189 259 108 267 112 258 216 269 108 296 323 245 234 298 162 206 197 233 298 164 274 -9 178 173 282 260 184 215 156 159 141 106 299 194 189 246 184 309 245 307 222 129 137 244 157 330 163 253 174 178 154 212 216 260 202 224 286 209 178 226 180 -9 173 251 266 142 320 -9 211 233 168 136 184 376 207 193 197 229 172 292 182 191 302 307 140 176 164 273 127 158 207 192 212 177 264 324 270 206 196 149 250 202 209 272 135 249 286 197 116 278 200 194 250 163 149 115 165 405 163 204 253 235 209 225 172 131 252 272 129 256 160 134 244 241 256 212 171 308 202 209 203 138 121 201 125 245 187 129 366 317 203 216 320 265 212 206 181 213 184 146 -9 235 235 263 217 
1061 87 Pima Mexico AMERICA 126 124 124 129 142 232 144 122 180 98 130 120 148 217 254 229 147 165 218 194 177 -9 243 134 204 184 188 134 119 199 183 172 154 165 94 172 120 145 166 174 208 185 249 115 150 120 234 239 271 195 221 96 117 236 196 297 187 113 95 238 192 127 132 113 163 150 251 237 88 132 260 110 155 157 106 156 228 152 187 130 190 104 137 133 202 243 244 139 179 160 200 150 184 241 126 187 246 197 119 152 246 197 190 166 170 251 185 123 334 176 190 195 178 152 198 139 244 194 144 184 155 237 159 172 129 216 202 269 251 147 110 155 149 150 153 157 202 208 140 208 238 228 121 224 224 145 374 183 173 204 147 188 153 196 347 212 161 244 123 214 259 234 116 183 235 132 177 234 251 180 149 179 113 265 199 180 131 196 153 139 105 212 191 142 138 171 320 199 159 241 190 187 169 240 144 233 270 211 120 240 147 176 293 241 171 258 151 260 220 276 187 249 185 251 104 267 108 258 216 257 104 288 323 233 230 282 162 202 185 233 286 160 270 -9 174 173 274 260 180 207 152 159 141 106 283 178 185 242 184 305 237 303 214 125 125 244 153 322 155 237 174 170 146 204 212 260 198 224 278 209 178 226 176 -9 169 239 266 142 320 -9 207 229 168 136 184 364 203 177 193 209 164 292 182 179 298 303 140 176 152 269 123 146 163 192 212 169 264 296 262 202 188 145 242 190 209 268 132 245 286 197 116 270 180 186 246 159 149 115 161 405 163 196 245 231 205 201 168 131 252 268 125 252 152 134 204 237 252 204 171 308 198 185 203 130 111 199 121 245 187 117 354 293 203 180 312 261 212 198 173 205 180 146 -9 227 227 259 205 
711 677 Cambodian Cambodia EAST_ASIA 124 124 144 131 160 234 146 120 -9 106 130 126 150 227 258 243 171 167 218 194 189 147 249 140 218 184 204 136 139 209 191 182 154 167 94 168 126 147 172 186 -9 191 249 124 147 108 231 224 271 210 221 111 117 236 205 306 190 113 95 -9 195 127 147 122 163 162 263 234 -9 129 260 113 152 157 118 165 234 155 211 133 193 110 143 136 211 -9 247 142 185 -9 200 159 190 250 138 193 252 200 119 152 246 201 198 162 166 255 189 127 342 176 194 203 202 164 198 151 252 194 144 192 155 237 159 180 -9 232 204 273 255 155 126 151 -9 166 157 173 198 200 140 212 246 228 137 228 240 149 386 183 177 204 159 192 157 212 347 220 161 244 119 226 259 234 120 183 229 140 207 242 259 192 153 183 129 281 183 184 135 200 157 139 121 212 -9 142 150 171 320 221 159 249 194 187 -9 260 144 249 278 219 112 248 151 184 297 241 175 278 163 264 216 276 191 253 185 275 112 263 104 274 212 269 104 292 323 245 230 294 162 194 193 241 298 170 282 239 186 197 -9 -9 200 215 164 -9 161 108 295 198 189 246 180 301 241 315 234 133 133 240 169 322 163 -9 178 174 154 -9 224 268 198 224 286 209 170 226 180 300 169 251 266 142 320 289 199 245 164 128 176 376 215 185 189 229 172 -9 182 191 294 307 148 192 164 289 131 162 191 200 208 177 268 324 298 202 192 153 242 198 209 268 -9 245 290 201 112 -9 204 198 242 167 157 119 161 413 167 200 261 243 207 217 172 135 264 272 129 264 168 142 240 233 260 224 159 304 202 221 203 134 119 205 131 253 181 129 366 305 203 220 312 249 220 198 181 213 192 -9 258 235 235 263 -9 
711 677 Cambodian Cambodia EAST_ASIA 120 112 124 129 156 234 144 112 -9 98 130 120 148 217 258 229 171 167 216 194 187 143 255 132 218 184 190 134 119 199 183 176 154 161 94 166 120 143 170 180 -9 188 249 112 141 105 225 224 271 201 221 96 117 230 196 294 181 110 95 -9 192 121 132 119 160 150 251 234 -9 123 257 107 143 154 115 162 234 152 187 130 187 104 143 127 205 -9 235 133 179 -9 179 159 184 238 132 187 246 197 119 140 246 197 194 158 162 255 185 127 326 176 190 191 186 164 190 147 244 190 144 184 151 233 159 172 -9 224 202 265 255 151 126 151 -9 166 157 173 198 196 124 204 242 224 121 224 228 149 378 183 177 204 139 188 153 192 347 204 161 240 97 218 255 230 116 175 225 128 189 238 255 188 129 179 113 277 183 184 131 196 153 139 117 208 -9 142 138 171 320 215 151 249 190 183 -9 252 144 237 274 211 108 244 151 180 297 241 167 270 159 264 216 264 183 249 185 255 112 263 104 266 196 261 100 280 323 237 230 282 162 194 189 233 290 170 270 235 174 185 -9 -9 196 201 156 -9 141 98 291 182 185 242 180 297 233 299 226 125 125 224 169 310 155 -9 162 170 154 -9 212 260 198 216 266 209 170 226 180 300 161 239 266 138 316 289 191 233 160 128 176 372 211 173 181 213 168 -9 182 187 294 303 144 192 160 265 131 158 187 192 184 177 260 296 266 202 188 149 238 194 197 264 -9 245 282 201 100 -9 180 190 242 163 157 111 141 413 159 200 257 227 205 213 168 131 252 268 121 256 164 138 216 233 252 224 159 304 196 213 191 118 111 201 125 237 181 117 358 297 191 180 296 237 212 198 181 209 184 -9 254 231 223 247 -9
712 677 Cambodian Cambodia EAST_ASIA 126 116 146 135 164 234 142 120 188 98 140 122 152 217 260 233 147 -9 218 194 189 143 251 140 218 184 188 134 119 205 191 182 158 163 94 172 122 147 170 180 -9 188 249 127 144 123 234 245 271 201 -9 111 117 236 199 288 190 116 95 250 195 133 144 119 163 162 263 246 91 126 263 116 161 157 112 165 249 -9 202 139 190 110 143 133 217 249 247 148 187 160 194 150 190 250 141 193 252 200 -9 152 246 205 206 158 170 263 209 127 342 172 198 207 188 164 198 151 240 202 152 192 151 249 159 172 145 244 210 289 251 151 126 155 153 170 161 177 202 216 128 -9 254 232 137 228 240 145 390 183 193 200 163 188 185 212 -9 204 149 256 119 218 267 238 116 183 245 132 193 246 259 192 145 179 113 281 191 184 135 -9 157 147 117 210 191 158 150 171 320 215 151 245 198 195 173 256 152 245 -9 231 112 248 151 176 297 249 175 274 159 268 224 284 191 253 189 271 108 267 112 -9 212 265 100 292 323 241 234 302 170 202 193 229 290 174 278 239 186 193 -9 260 200 223 164 159 145 102 287 186 193 254 180 -9 237 319 210 133 125 252 169 -9 163 261 170 178 158 216 212 268 202 228 270 209 190 226 172 308 172 251 262 150 324 293 207 253 168 132 176 372 207 189 197 237 168 300 182 179 302 307 144 200 164 289 -9 154 199 192 208 181 268 296 294 198 192 153 242 198 213 280 142 249 286 201 116 286 204 198 250 171 161 115 145 409 163 200 -9 227 213 213 176 115 -9 272 129 264 164 134 204 237 256 208 159 304 202 225 203 142 121 205 127 257 191 129 358 293 191 180 312 241 216 198 185 221 188 146 258 231 235 259 237 
712 677 Cambodian Cambodia EAST_ASIA 126 112 124 135 160 230 138 112 180 98 130 120 148 217 250 229 147 -9 218 190 189 143 245 134 218 184 188 134 119 201 174 180 154 163 94 166 120 145 160 174 -9 185 249 115 141 108 231 242 271 195 -9 96 117 227 196 288 190 113 86 241 192 115 132 119 157 150 251 246 91 123 260 110 155 151 109 162 234 -9 187 133 187 107 134 130 208 240 235 139 179 160 179 147 184 241 132 181 246 200 -9 140 246 201 194 158 162 259 181 127 326 168 190 199 182 156 198 147 236 194 140 188 151 233 155 172 141 224 196 269 251 147 118 155 148 170 157 173 198 204 128 -9 250 228 137 224 236 145 370 183 173 200 147 188 157 212 -9 204 137 240 97 198 263 230 116 183 231 120 189 234 255 188 145 179 109 277 187 180 135 -9 149 147 113 208 183 146 134 167 316 215 151 237 198 187 169 248 144 245 -9 227 112 236 151 176 297 241 167 258 155 260 220 276 183 245 181 263 104 263 104 -9 200 257 100 292 319 233 234 290 154 190 193 229 278 168 274 239 182 181 -9 256 184 207 156 143 141 98 287 186 189 230 176 -9 237 303 210 125 125 240 153 -9 159 249 162 170 154 216 204 264 202 220 270 209 170 222 168 304 157 239 262 134 320 269 195 233 168 128 176 368 199 185 189 233 164 292 170 175 298 307 140 196 164 261 -9 154 191 188 204 177 260 296 294 198 188 149 238 198 209 264 139 245 278 193 112 270 204 186 246 163 161 111 141 409 159 192 -9 219 211 213 176 115 -9 264 125 256 160 134 196 233 248 204 151 304 196 225 199 118 119 199 125 245 187 117 346 289 191 180 312 241 212 198 177 217 176 142 258 227 227 255 233 
713 677 Cambodian Cambodia EAST_ASIA 128 124 124 139 168 230 150 112 186 98 130 120 164 225 264 233 165 167 224 198 195 145 245 140 228 202 188 -9 139 201 191 184 158 173 106 172 124 173 -9 184 212 191 249 118 144 129 237 224 271 210 221 111 -9 236 205 312 190 113 98 241 -9 121 144 -9 163 150 251 234 91 126 266 107 158 160 112 165 234 155 202 -9 193 104 146 139 208 252 247 154 182 166 179 156 190 250 144 190 249 200 125 156 246 201 198 162 170 263 189 127 334 176 -9 207 174 160 194 155 248 198 -9 188 155 233 159 176 133 232 -9 265 255 151 126 163 -9 182 -9 169 202 216 124 204 246 240 137 228 228 149 390 183 -9 200 163 188 193 200 351 220 157 244 115 222 263 234 -9 187 237 128 201 242 255 192 149 183 -9 281 191 184 135 208 153 151 117 218 195 142 146 175 320 227 163 241 194 187 173 256 132 233 278 223 116 248 163 188 297 241 187 -9 -9 264 220 276 199 241 185 271 112 263 108 278 212 273 104 -9 331 249 246 302 162 194 185 233 310 170 278 235 182 189 -9 268 184 219 168 155 145 100 295 206 201 -9 184 305 245 307 218 133 133 244 169 -9 167 249 170 182 158 212 208 264 218 224 282 209 -9 226 184 308 169 255 270 150 316 289 207 261 -9 136 192 384 203 193 193 233 184 -9 198 183 302 307 148 -9 164 289 135 -9 191 192 -9 177 268 296 298 -9 200 149 246 198 213 -9 142 249 278 -9 116 278 -9 206 -9 171 149 115 149 409 163 204 257 239 211 221 172 131 264 -9 125 264 164 142 248 233 260 220 171 304 204 221 199 118 121 205 125 -9 -9 121 378 297 191 204 316 -9 216 210 181 -9 192 146 -9 231 235 255 221 
713 677 Cambodian Cambodia EAST_ASIA 124 124 124 135 142 230 140 112 182 98 130 120 150 217 260 233 147 165 224 194 187 143 243 138 204 184 188 -9 119 199 174 176 148 167 100 172 122 143 -9 174 212 188 249 115 141 108 237 224 271 198 221 99 -9 236 196 291 190 113 98 238 -9 121 132 -9 163 144 251 234 91 123 260 107 152 157 109 165 234 140 196 -9 178 98 140 133 205 240 244 148 182 163 179 150 184 250 132 172 246 200 122 148 246 197 198 158 170 255 189 127 334 176 -9 203 168 152 186 147 240 194 -9 184 147 233 151 172 129 212 -9 261 255 151 118 155 -9 170 -9 165 198 204 124 204 238 232 129 224 216 145 378 183 -9 200 147 184 157 196 347 204 137 244 111 222 255 234 -9 179 229 120 193 238 255 188 129 179 -9 277 187 180 131 200 149 143 113 212 187 142 142 171 320 221 155 237 190 183 169 252 132 233 274 215 112 240 151 184 297 241 175 -9 -9 260 216 276 195 237 185 267 108 263 108 258 200 269 96 -9 319 233 238 290 146 170 181 233 306 168 270 231 178 181 -9 260 180 203 156 155 141 98 287 190 193 -9 184 305 237 303 210 125 125 244 149 -9 163 245 158 178 154 192 208 260 194 216 278 209 -9 226 168 300 169 239 266 142 316 289 203 241 -9 136 172 368 195 193 181 209 160 -9 170 175 298 299 136 -9 148 289 131 -9 191 192 -9 169 260 292 250 -9 188 149 234 190 209 -9 139 249 274 -9 100 274 -9 182 -9 167 141 111 141 409 159 196 245 227 207 217 168 115 260 -9 121 256 148 126 236 217 260 204 171 304 200 209 199 118 115 201 119 -9 -9 117 374 289 191 180 316 -9 216 202 181 -9 188 146 -9 223 227 251 205
714 677 Cambodian Cambodia EAST_ASIA 126 116 142 139 164 236 146 112 188 98 136 122 150 223 260 233 165 -9 218 194 187 147 243 138 218 184 188 142 139 201 189 180 162 165 112 172 120 147 170 180 -9 188 255 124 141 129 237 239 277 210 236 111 129 239 199 297 190 116 95 241 195 133 144 119 163 159 269 246 91 126 266 113 158 160 118 165 249 158 190 130 187 107 143 136 208 243 230 154 179 148 179 156 190 247 132 190 252 200 125 148 254 205 202 162 166 267 201 127 342 176 194 207 178 164 198 151 248 198 144 196 159 241 163 176 133 224 -9 285 251 151 126 155 -9 170 165 173 198 204 136 212 254 228 141 232 228 145 390 183 -9 -9 159 192 169 204 355 208 161 244 -9 222 263 234 120 187 245 128 197 242 263 192 149 183 -9 281 195 -9 139 208 157 159 117 212 -9 142 154 175 320 225 163 241 194 187 173 240 152 249 274 227 120 240 163 192 297 245 -9 274 167 268 220 272 199 253 189 263 104 267 108 274 216 269 108 296 327 241 238 294 158 198 197 233 -9 170 266 239 190 181 278 264 204 227 156 159 161 108 295 186 193 258 188 309 245 303 226 133 -9 244 173 326 163 253 170 182 154 208 216 264 202 228 290 219 178 230 180 304 169 239 266 138 328 293 203 261 168 132 180 376 211 -9 201 229 188 -9 190 187 294 303 136 196 -9 277 131 -9 191 200 208 173 264 296 266 202 208 153 238 198 209 268 155 253 286 201 116 278 204 206 250 175 157 111 165 424 167 200 249 223 211 209 168 119 260 272 137 260 164 126 240 241 268 204 159 304 204 221 203 142 121 205 133 245 191 117 366 297 203 204 328 265 216 206 181 209 188 146 -9 227 231 259 229 
714 677 Cambodian Cambodia EAST_ASIA 124 116 124 129 162 230 140 112 188 98 130 120 148 217 258 229 161 -9 214 194 183 143 243 136 208 184 188 134 139 199 183 176 148 161 104 166 118 147 164 174 -9 188 255 115 141 108 234 224 268 201 221 105 117 236 199 297 184 116 86 238 189 121 132 116 163 150 263 234 91 123 263 113 155 154 106 162 234 155 190 130 187 104 134 130 205 240 227 148 179 142 179 150 184 247 126 187 252 197 119 148 246 197 198 158 162 259 193 119 338 168 192 191 168 156 194 147 248 194 140 184 155 237 163 172 133 200 -9 273 251 131 118 139 -9 170 161 165 198 200 124 208 246 228 129 228 228 145 386 183 -9 -9 147 188 157 200 351 204 145 236 -9 214 251 230 116 183 237 120 193 242 259 188 149 179 -9 277 191 -9 131 204 157 147 109 208 -9 142 146 175 312 219 155 237 190 183 173 240 148 225 274 207 120 240 155 180 289 237 -9 270 151 260 208 272 183 245 185 263 104 267 104 254 200 253 96 280 323 221 230 290 154 178 193 233 -9 168 258 231 174 177 278 260 184 211 152 155 141 106 287 178 193 246 180 305 241 303 214 129 -9 244 153 322 155 249 170 178 154 208 212 260 198 220 286 209 170 226 180 304 161 235 266 130 324 289 203 237 164 128 172 364 195 -9 185 209 168 -9 174 175 294 299 132 176 -9 261 123 -9 167 192 184 169 264 288 266 202 196 149 222 198 197 260 151 245 278 197 100 278 204 190 242 167 145 111 145 424 167 200 245 223 203 201 164 115 252 268 129 256 148 122 220 217 260 204 159 304 202 209 199 118 119 201 123 233 181 117 370 297 191 168 316 245 208 198 173 201 184 146 -9 223 231 255 225 
715 677 Cambodian Cambodia EAST_ASIA 126 124 138 141 142 234 144 122 188 98 130 122 158 227 260 235 171 -9 218 194 187 145 249 142 218 198 188 138 139 201 191 184 158 167 94 172 124 175 170 184 -9 191 249 127 141 108 234 239 274 -9 221 105 -9 224 199 312 184 116 98 241 195 133 144 125 160 147 263 234 88 132 263 113 158 157 118 165 234 155 202 136 190 113 143 136 211 246 250 148 182 169 179 156 184 247 138 193 249 200 119 152 254 201 206 162 170 267 185 131 342 172 190 203 178 168 202 151 244 202 144 196 155 237 163 180 153 224 210 273 255 155 126 155 161 170 153 161 206 212 128 204 250 -9 145 224 248 149 382 183 -9 204 151 192 169 200 355 204 161 256 119 214 255 238 120 183 249 128 209 246 259 192 157 191 117 277 187 184 131 204 157 159 117 214 199 158 150 175 324 219 159 249 198 195 177 256 144 245 278 219 124 248 163 180 297 257 187 278 151 268 216 276 191 249 189 267 108 263 108 278 216 265 108 296 331 245 234 294 162 202 209 233 302 168 278 239 186 189 282 260 200 219 164 159 149 98 291 182 189 246 180 309 237 307 218 133 125 252 -9 326 155 253 170 182 158 224 220 268 202 224 286 209 178 230 180 304 161 239 266 -9 320 289 199 257 168 136 176 376 215 193 197 221 184 308 186 187 298 307 140 200 164 265 131 162 187 192 208 177 272 296 294 202 204 149 242 198 209 276 143 253 286 197 120 270 204 194 242 167 161 115 141 413 163 204 257 243 203 213 180 131 260 272 125 268 172 138 244 237 264 224 159 304 198 217 199 134 117 205 131 241 191 117 370 297 203 212 308 245 216 206 181 201 192 146 262 -9 231 263 225 
715 677 Cambodian Cambodia EAST_ASIA 124 116 124 129 144 230 138 112 186 98 130 122 152 223 260 233 165 -9 218 188 185 137 245 136 204 184 188 138 139 201 187 182 148 161 104 166 120 173 164 180 -9 185 246 115 141 108 231 239 271 -9 221 96 -9 218 196 297 181 110 86 238 189 121 144 113 157 147 257 234 88 126 257 110 155 154 115 165 234 152 187 130 178 107 140 130 208 240 244 145 179 157 179 153 184 247 132 193 246 200 119 152 246 197 198 158 170 255 185 127 322 168 186 191 168 164 198 143 240 194 144 192 151 221 151 164 145 200 202 273 251 131 110 147 153 146 145 157 202 208 124 204 246 -9 141 224 232 145 370 183 -9 200 147 188 117 192 343 204 137 252 97 210 255 230 116 167 241 124 177 238 255 172 145 175 113 257 187 184 131 200 153 143 113 208 179 158 138 171 320 195 151 245 190 183 169 256 136 237 278 211 120 244 163 176 297 245 175 258 139 264 216 260 183 241 185 259 108 263 104 262 200 261 104 284 315 241 234 290 158 194 201 229 286 166 266 235 182 173 274 256 180 207 160 151 149 98 283 178 189 246 180 297 237 303 214 129 125 228 -9 322 155 245 170 162 154 192 216 264 198 220 286 209 170 226 168 304 157 235 262 -9 316 289 199 229 160 132 176 376 195 185 193 209 172 300 186 175 294 307 128 176 148 261 127 150 163 188 204 177 268 292 262 198 188 149 234 198 205 264 135 245 282 193 120 270 204 186 232 159 141 115 141 409 159 192 245 231 199 209 176 131 256 268 121 264 160 134 204 233 260 220 159 304 186 185 199 118 115 201 123 233 181 117 354 297 191 180 304 209 216 206 173 201 184 146 254 -9 227 255 205 
716 677 Cambodian Cambodia EAST_ASIA 126 128 146 131 160 232 152 124 182 98 140 120 152 217 262 235 177 -9 218 -9 187 147 245 142 230 184 204 142 119 201 191 176 162 163 94 168 126 173 172 180 -9 185 252 115 150 129 231 242 271 207 239 111 -9 236 196 297 190 113 95 241 195 121 144 119 157 153 263 246 91 126 260 119 158 -9 115 165 234 152 190 133 187 116 140 130 208 252 244 151 182 163 200 150 187 253 132 196 252 200 125 148 246 205 198 162 162 259 189 131 350 176 194 207 180 168 202 151 244 194 144 188 155 233 163 180 149 240 214 297 255 147 122 155 153 170 157 177 210 212 128 212 246 228 141 228 244 149 386 191 -9 -9 159 188 153 212 375 204 157 244 119 214 -9 238 120 187 241 -9 205 242 259 192 129 183 109 277 187 180 143 200 161 159 117 212 191 158 158 171 320 229 163 241 -9 187 169 252 152 245 278 235 120 244 159 184 297 249 187 274 151 264 -9 272 187 253 197 263 112 263 104 258 208 269 104 312 327 245 234 294 158 210 193 241 270 178 278 235 186 185 286 260 204 219 168 159 157 110 287 198 193 250 184 301 241 307 218 129 125 228 169 330 163 245 170 178 158 204 220 272 202 220 286 217 202 234 180 300 161 235 270 158 324 257 203 229 164 132 180 372 211 189 197 209 -9 296 186 187 298 307 140 196 168 265 131 154 191 196 212 173 272 296 270 198 200 153 234 190 213 268 143 249 278 201 120 270 180 194 242 171 157 115 173 417 163 208 257 243 207 221 180 131 264 268 125 268 160 150 236 233 256 208 171 308 200 213 207 142 117 203 129 245 191 129 318 309 191 216 312 245 216 206 181 201 180 146 254 231 231 267 225 
716 677 Cambodian Cambodia EAST_ASIA 126 116 124 129 156 230 138 120 180 98 130 120 148 217 262 233 169 -9 218 -9 185 143 245 140 218 184 188 134 119 201 185 174 158 161 94 166 124 143 170 174 -9 185 249 115 141 108 225 242 265 207 236 96 -9 230 196 288 184 113 89 241 192 118 141 116 157 150 257 234 79 123 257 113 155 -9 109 165 228 140 190 130 178 110 134 127 205 246 244 139 179 160 194 150 184 253 129 190 246 197 122 140 246 205 190 162 162 255 177 127 334 176 186 203 168 164 198 151 244 194 140 184 147 233 163 176 133 200 202 277 251 131 110 155 149 166 149 165 206 200 120 204 246 224 133 228 228 145 374 187 -9 -9 147 184 117 192 351 204 133 240 119 210 -9 230 116 183 229 -9 197 238 259 188 129 179 109 269 183 176 135 200 157 151 117 208 191 142 138 159 320 215 155 241 -9 183 161 240 132 237 278 227 112 240 151 180 297 241 175 274 151 260 -9 272 183 245 181 263 112 263 104 254 200 261 104 300 323 241 230 286 158 190 185 233 250 164 266 231 178 173 274 260 188 203 156 155 153 98 283 178 189 250 180 297 229 303 214 125 125 224 169 330 155 245 162 174 154 200 212 260 198 220 274 213 170 234 172 292 161 235 258 150 320 257 203 221 156 128 176 372 203 173 193 209 -9 296 182 187 294 299 132 176 148 261 119 154 163 192 184 169 264 292 266 194 188 153 230 182 213 264 139 245 262 197 116 262 180 190 242 163 157 115 149 405 159 200 245 227 203 217 168 115 256 264 117 256 160 122 200 233 252 204 167 304 196 185 203 134 111 203 125 241 191 117 338 297 191 180 308 237 216 198 177 201 176 142 246 231 231 251 205 
717 677 Cambodian Cambodia EAST_ASIA 126 116 126 135 160 234 150 124 -9 98 130 120 150 223 262 233 173 -9 218 198 193 149 243 144 224 208 208 144 139 207 -9 184 162 163 102 166 126 145 170 184 -9 191 249 115 144 120 237 239 274 210 236 111 -9 236 208 300 187 113 95 250 192 136 144 119 163 153 263 246 91 123 266 125 158 157 118 165 234 -9 190 136 187 110 146 133 208 240 244 151 179 166 194 159 190 250 141 190 246 200 119 152 246 205 194 166 174 263 209 127 330 168 192 207 176 160 190 147 244 194 160 192 155 241 163 172 149 232 212 273 259 151 126 155 148 170 165 169 206 208 144 208 258 244 133 228 236 145 390 191 177 204 159 200 189 200 355 204 161 256 97 226 267 238 120 187 225 -9 197 242 255 192 149 175 117 285 191 188 131 208 157 151 117 212 195 158 150 171 324 209 159 245 194 203 169 252 148 245 274 231 128 244 151 188 297 245 187 254 151 264 220 272 183 249 185 259 112 267 104 266 216 265 108 292 323 249 234 298 158 206 197 233 286 174 282 239 186 189 282 264 196 219 156 163 149 114 287 202 193 250 180 305 241 319 218 133 125 240 -9 326 155 253 174 174 158 208 216 268 198 -9 282 223 174 238 180 304 173 239 270 154 316 293 203 261 160 132 176 376 211 193 197 225 172 300 182 183 294 303 144 192 164 261 123 162 199 192 216 177 264 300 290 198 208 153 234 190 217 268 142 245 282 201 104 270 200 206 -9 167 149 111 161 420 167 204 249 239 213 221 176 131 264 272 129 264 164 138 244 237 260 204 167 308 192 205 199 138 119 201 125 241 191 121 354 301 191 216 320 261 224 206 177 217 188 146 246 231 231 267 221 
717 677 Cambodian Cambodia EAST_ASIA 122 116 124 119 142 230 140 116 -9 96 130 114 148 217 258 229 167 -9 218 196 187 143 239 132 204 206 206 134 119 193 -9 176 154 159 94 166 124 145 170 180 -9 188 249 115 141 108 237 239 271 210 230 96 -9 227 199 288 184 113 95 241 189 127 138 116 163 150 239 234 79 123 263 107 155 154 112 165 234 -9 187 124 184 107 134 133 208 240 244 148 179 160 191 147 181 247 129 184 246 197 119 152 246 197 194 158 170 259 185 123 326 156 186 207 168 156 186 143 240 194 144 188 147 233 159 172 141 220 206 269 251 131 114 155 133 146 157 169 202 200 128 204 246 232 133 220 224 141 382 183 177 204 159 196 169 200 347 204 137 252 97 206 263 230 116 183 231 -9 181 238 255 184 129 163 117 269 187 180 131 204 157 147 113 210 187 142 138 171 316 201 159 237 190 183 165 240 132 233 266 211 112 240 147 180 293 241 171 254 151 260 220 260 179 245 185 259 116 267 96 250 200 265 100 284 323 241 234 294 154 194 189 229 278 168 278 239 182 181 274 256 196 215 148 155 145 98 283 194 185 246 172 305 241 311 210 129 121 224 -9 322 155 245 162 174 154 208 216 260 190 -9 274 209 170 230 168 304 169 235 266 138 316 289 199 241 152 128 172 372 207 185 193 209 172 288 174 175 294 299 140 176 148 261 119 150 159 188 184 173 264 300 270 194 200 153 234 190 209 252 142 245 274 197 100 266 180 190 -9 163 141 111 141 405 163 200 249 231 203 221 176 131 264 260 129 256 148 134 200 217 260 204 159 304 192 185 199 118 111 197 123 241 181 117 346 293 191 180 316 241 212 198 177 209 188 142 246 227 227 263 205
718 677 Cambodian Cambodia EAST_ASIA 124 124 126 139 168 230 140 112 182 100 130 120 164 -9 260 -9 165 -9 224 198 195 143 245 140 228 202 188 134 -9 199 -9 184 164 173 106 172 130 175 168 184 -9 188 249 124 147 129 237 242 271 210 221 111 -9 239 205 312 190 113 98 241 192 121 135 119 163 147 251 237 91 126 266 119 158 160 112 168 249 152 196 133 187 104 140 133 208 246 244 148 182 166 185 156 184 250 132 193 246 200 122 156 246 201 198 162 170 263 209 135 334 180 190 203 194 160 202 147 248 198 144 184 155 237 159 176 137 236 202 273 259 151 118 155 157 170 169 173 202 216 124 208 246 236 137 224 224 149 390 187 177 204 147 188 157 204 351 212 157 244 119 222 263 234 116 187 229 -9 197 242 255 -9 129 183 129 281 195 184 131 208 165 151 117 212 195 142 146 -9 320 221 155 241 190 187 177 256 136 -9 282 227 116 240 155 188 297 265 175 274 159 264 220 276 195 245 -9 267 112 263 108 274 216 273 96 -9 331 233 238 290 162 202 189 233 310 168 274 239 -9 189 290 268 184 205 164 159 -9 98 291 206 193 250 188 305 245 311 218 133 -9 248 157 322 167 249 174 182 158 216 208 268 218 -9 282 209 -9 230 184 304 169 239 270 150 328 289 207 257 164 136 192 384 195 -9 193 233 160 300 174 175 302 307 148 192 164 289 131 162 191 -9 212 173 268 300 278 202 188 149 246 198 209 268 143 257 282 205 116 278 204 198 254 167 161 115 161 409 163 200 257 239 211 221 172 131 264 268 125 -9 164 142 236 233 264 220 171 304 204 209 199 142 -9 205 133 245 191 121 378 293 203 204 320 261 216 210 181 209 192 146 258 235 235 263 221 
718 677 Cambodian Cambodia EAST_ASIA 122 116 124 135 158 230 140 112 180 98 130 120 152 -9 250 -9 147 -9 218 188 187 143 243 132 226 184 188 134 -9 199 -9 176 148 165 106 166 124 143 168 180 -9 188 249 115 141 120 231 224 271 198 221 105 -9 236 199 291 184 113 95 241 192 121 132 119 160 144 251 234 91 126 266 107 152 157 109 165 234 140 187 130 178 101 134 133 205 240 244 148 178 157 179 156 184 235 132 172 246 200 122 140 246 201 194 162 166 255 189 127 330 176 190 191 168 152 186 143 240 194 144 184 147 233 151 172 129 212 200 261 255 151 110 151 153 170 157 165 198 208 124 204 238 232 121 224 216 145 390 183 177 200 147 184 149 200 351 204 137 244 111 202 255 230 112 183 229 -9 193 238 251 -9 129 179 109 277 187 180 131 192 153 147 117 210 187 142 142 -9 316 201 147 241 190 187 173 248 132 -9 274 223 108 240 151 184 293 241 175 258 151 260 216 276 191 241 -9 259 108 263 104 258 212 269 96 -9 319 233 230 286 154 170 185 233 266 164 270 235 -9 189 278 260 180 203 156 155 -9 98 287 166 189 246 184 305 245 307 210 133 -9 244 149 310 159 245 158 174 154 192 208 260 202 -9 282 209 -9 226 168 300 169 239 262 138 316 289 199 241 152 128 176 364 195 -9 181 213 160 296 170 175 290 299 140 192 152 265 131 158 187 -9 208 169 260 292 250 202 188 145 246 190 209 264 139 249 274 201 100 278 180 182 236 167 141 115 141 405 159 196 253 227 199 209 168 115 260 268 121 -9 164 126 200 233 260 216 159 304 198 209 199 118 -9 205 125 233 191 117 334 289 191 168 316 249 216 210 181 205 188 146 258 223 235 255 217
719 677 Cambodian Cambodia EAST_ASIA 126 124 124 129 160 236 -9 112 182 98 142 120 152 217 264 233 173 169 218 194 187 143 243 142 230 204 188 138 139 207 -9 184 162 167 94 172 126 147 168 184 212 188 249 115 -9 108 237 242 271 210 221 111 138 230 205 288 193 113 98 241 192 133 132 116 163 150 254 237 91 135 266 125 158 166 121 162 246 158 190 133 190 110 146 133 214 252 247 148 179 163 197 156 184 253 141 187 252 200 119 156 254 201 206 158 170 259 197 127 334 176 194 199 178 164 202 155 240 198 144 188 155 237 163 180 141 228 210 273 251 151 126 159 161 170 165 169 198 212 132 204 242 232 121 228 232 149 386 187 189 204 159 192 177 200 355 220 165 244 97 226 263 234 120 -9 235 132 189 242 255 192 145 199 109 277 187 176 139 196 157 143 121 212 195 142 146 175 316 215 155 245 198 187 173 244 148 -9 274 231 120 248 159 180 297 241 175 270 151 264 224 272 195 257 185 263 108 267 112 266 200 269 100 292 319 245 230 306 162 194 193 253 294 168 274 239 -9 185 290 264 208 219 168 159 -9 106 291 178 193 258 180 317 245 307 226 137 129 244 169 330 -9 249 166 186 154 212 216 264 202 224 286 213 202 226 180 292 169 251 266 154 320 293 199 257 164 128 176 376 -9 193 193 225 188 296 190 191 302 311 144 180 164 269 123 162 159 -9 216 -9 264 304 286 202 192 153 242 198 217 280 151 249 278 201 116 270 200 198 258 175 157 111 161 409 159 196 261 235 211 221 172 131 260 276 125 -9 176 138 208 233 264 224 167 304 204 185 207 138 117 205 125 245 181 125 362 313 203 216 320 269 216 198 181 213 188 146 258 231 235 259 225 
719 677 Cambodian Cambodia EAST_ASIA 124 116 124 129 156 230 -9 112 180 98 130 118 150 217 258 229 171 165 216 188 187 143 243 134 222 184 188 134 119 205 -9 182 158 163 94 166 126 143 164 184 208 188 249 115 -9 108 231 242 265 207 221 96 117 230 196 288 181 104 86 241 192 121 132 113 157 147 239 237 88 126 263 110 152 157 115 162 234 152 187 130 187 104 140 130 205 240 238 142 179 157 179 150 184 235 141 181 249 200 119 152 246 201 202 158 166 255 185 127 326 172 188 191 172 160 186 143 240 194 144 184 151 237 159 176 137 220 206 265 251 131 118 155 153 150 157 169 198 212 128 204 234 228 121 220 228 149 374 183 173 192 151 192 153 196 347 212 145 240 97 218 259 230 116 -9 225 120 189 242 247 172 129 195 109 269 187 176 135 196 153 139 109 192 191 142 142 171 304 199 155 245 198 183 169 240 144 -9 274 219 120 240 151 180 293 225 171 258 139 260 224 272 195 249 185 259 112 263 108 254 200 253 96 288 315 233 230 302 154 194 189 225 294 160 266 239 -9 185 282 264 208 205 168 155 -9 98 291 178 185 250 180 297 241 307 222 125 125 224 145 322 -9 245 162 174 154 208 212 260 198 216 278 205 174 218 180 292 161 235 266 138 320 293 199 241 164 128 176 372 -9 193 185 213 184 296 170 187 294 303 140 176 152 257 119 154 159 -9 212 -9 264 292 258 198 188 149 234 194 205 256 135 245 266 197 116 266 180 186 242 167 153 111 145 405 159 196 249 231 209 217 168 115 260 264 121 -9 160 134 196 233 256 216 151 304 198 185 203 118 117 197 123 241 181 117 362 293 203 180 320 241 216 198 177 205 184 142 254 227 235 255 221
720 677 Cambodian Cambodia EAST_ASIA 126 128 144 133 164 230 138 124 186 100 130 120 156 221 262 233 169 171 218 194 187 147 249 140 220 184 204 134 119 207 -9 184 158 169 106 174 130 147 170 184 212 185 249 118 -9 120 -9 224 271 210 233 111 138 236 -9 312 187 116 89 256 195 133 144 116 163 150 263 246 88 -9 263 113 155 157 124 165 249 158 190 130 178 104 143 133 208 246 244 145 179 169 194 153 190 259 132 193 246 200 125 160 246 201 202 178 174 255 189 127 350 176 204 203 178 164 202 151 248 202 144 188 155 233 -9 176 149 228 210 277 251 147 122 163 149 170 157 169 198 208 124 204 250 228 121 228 228 145 382 187 193 204 163 200 193 196 371 208 169 256 97 214 263 230 120 -9 245 136 205 246 255 192 153 183 117 281 191 184 143 200 161 147 121 212 191 146 150 171 324 225 167 245 190 207 169 256 152 245 278 231 120 -9 163 192 301 249 187 274 155 268 -9 276 199 249 185 267 104 263 108 262 200 269 104 300 323 245 242 302 158 202 213 233 290 174 270 239 186 185 282 260 196 211 164 155 153 106 291 194 197 250 188 313 237 311 230 133 125 -9 173 322 163 253 170 182 158 212 224 272 214 220 286 227 174 238 180 308 157 239 266 154 320 -9 199 257 172 136 180 376 215 189 197 233 180 300 174 191 302 299 144 196 164 265 127 154 191 200 212 169 272 296 266 202 192 157 250 202 -9 268 151 245 286 201 116 278 208 198 250 171 169 115 149 413 167 204 261 239 213 221 180 135 272 264 145 264 164 134 240 237 260 224 159 304 196 221 199 154 123 203 125 241 181 129 358 301 203 212 308 241 228 210 173 213 -9 146 266 231 231 263 237 
720 677 Cambodian Cambodia EAST_ASIA 124 112 124 129 162 230 138 112 180 98 130 118 150 217 250 229 163 165 218 194 187 143 247 132 218 184 200 134 119 201 -9 176 152 163 98 172 120 143 168 180 208 182 249 115 -9 108 -9 224 271 201 221 111 126 236 -9 306 184 113 89 256 192 133 138 113 157 150 260 234 88 -9 257 107 152 157 112 165 234 140 190 130 178 104 140 133 205 240 238 139 179 157 194 153 190 253 126 190 246 200 119 152 246 197 198 166 166 243 181 123 338 164 194 203 168 164 198 143 240 190 144 184 151 233 -9 172 137 208 206 273 247 135 118 139 133 150 157 165 198 208 124 204 242 224 121 224 228 145 374 187 173 204 143 200 185 188 347 204 141 240 97 214 263 230 112 -9 231 128 177 238 255 192 149 179 113 277 187 176 131 196 153 143 113 208 187 142 134 171 316 215 159 241 190 203 169 240 132 225 274 211 112 -9 155 176 297 245 171 258 143 260 -9 272 187 241 185 255 108 263 104 250 196 261 96 296 319 237 230 294 158 174 197 233 290 172 270 235 178 177 274 256 188 209 164 143 141 102 283 186 193 242 184 305 237 311 210 129 125 -9 173 322 163 245 166 170 154 208 208 264 202 220 266 209 170 226 176 300 147 235 266 146 316 -9 199 241 160 132 180 372 211 181 197 229 160 296 170 175 294 291 132 176 152 261 123 150 183 192 184 169 272 292 266 198 188 153 246 190 -9 252 135 245 282 197 104 254 204 190 246 167 145 115 145 405 159 204 249 235 207 217 168 131 252 264 129 256 164 134 172 221 260 216 151 304 196 213 199 118 123 197 125 241 181 117 358 301 191 180 304 209 212 206 169 205 -9 146 262 231 227 255 225 
721 677 Cambodian Cambodia EAST_ASIA 126 128 142 135 156 234 140 120 180 106 130 126 148 217 262 233 167 165 218 196 187 147 245 142 232 184 204 144 119 207 189 182 164 175 106 166 126 161 170 184 212 191 249 115 141 108 231 224 274 207 236 111 132 236 205 312 187 116 98 250 189 121 144 119 157 150 251 234 91 129 263 113 158 166 121 165 234 155 187 130 187 104 143 139 208 252 244 148 185 163 197 156 190 247 138 193 246 200 122 152 254 205 202 162 170 255 201 131 330 176 194 203 178 160 202 147 236 198 164 192 159 241 163 176 141 232 210 273 251 151 126 159 149 170 157 173 198 212 128 208 258 244 145 228 232 149 394 183 193 200 163 192 153 192 355 204 161 260 97 226 263 234 116 -9 237 124 197 242 259 192 129 183 129 281 191 180 139 200 157 163 113 212 195 158 150 171 316 201 151 245 198 187 165 260 148 233 278 235 128 -9 155 180 301 245 187 274 151 264 224 276 191 253 189 271 108 267 108 274 220 269 104 296 327 245 246 290 154 190 193 241 298 178 270 239 186 185 282 260 200 211 156 163 145 110 287 198 193 246 180 305 245 315 218 129 129 248 169 326 163 257 162 178 154 208 224 264 202 220 286 209 194 234 172 304 173 239 270 142 320 289 199 257 168 128 176 372 203 197 197 233 176 300 182 187 302 307 144 192 164 289 127 158 195 196 204 169 272 300 306 198 188 149 238 190 213 268 143 245 278 201 116 262 180 190 246 179 145 119 165 413 163 204 245 227 207 221 176 135 260 264 129 284 168 138 232 229 260 216 159 304 204 185 199 142 123 201 125 245 191 117 366 305 191 180 316 265 216 206 181 213 188 146 258 227 235 255 221 
721 677 Cambodian Cambodia EAST_ASIA 124 116 130 129 142 234 138 112 180 98 130 120 146 217 250 233 147 165 218 194 185 143 243 136 218 184 188 134 119 203 174 182 148 163 106 166 124 143 170 180 212 188 249 112 141 108 231 224 271 201 221 96 117 233 199 309 187 113 89 238 186 118 138 116 157 147 251 234 91 123 263 110 155 154 109 162 234 152 187 127 178 104 143 136 205 240 241 130 179 160 179 150 190 235 135 187 246 200 122 148 246 201 202 158 162 255 181 127 322 172 194 199 168 156 198 143 232 198 144 188 147 237 151 172 125 232 200 269 247 147 122 151 133 150 153 165 198 200 124 204 246 232 137 216 228 149 378 183 193 192 147 192 117 192 347 204 157 256 97 202 259 234 116 -9 231 124 177 238 255 188 129 171 113 269 187 176 139 196 153 155 113 204 187 150 150 163 312 199 151 237 190 183 161 236 144 225 278 211 120 -9 155 180 301 241 171 258 151 260 212 276 187 253 181 271 112 259 104 274 200 253 100 288 323 241 242 282 150 174 193 233 266 170 262 235 182 185 274 260 188 203 152 143 145 110 287 182 193 246 180 301 237 315 218 117 125 240 169 322 155 257 162 174 150 204 208 256 198 220 282 209 194 230 168 300 169 235 258 130 316 285 179 237 160 128 172 364 195 185 185 209 160 300 182 179 290 299 144 176 152 265 119 158 187 192 184 165 268 296 302 198 188 141 234 190 201 252 142 245 262 201 104 254 180 178 242 159 141 115 145 409 163 200 245 227 207 205 168 131 256 256 125 256 164 126 232 221 260 204 159 304 198 185 199 134 123 197 123 241 181 117 334 301 191 168 316 265 216 206 181 209 180 146 246 219 231 247 209 
1307 606 Dai China EAST_ASIA 124 116 144 135 142 236 146 116 -9 98 134 -9 158 -9 264 233 173 167 218 194 187 143 257 142 228 200 188 148 119 207 191 182 154 175 96 172 124 171 170 184 212 188 249 115 -9 120 237 239 271 204 221 111 117 236 196 297 190 116 98 250 195 121 144 113 163 159 266 249 91 123 -9 110 164 151 115 165 234 152 187 130 190 107 146 133 214 252 247 154 178 163 -9 153 196 250 135 190 252 200 119 152 246 205 190 158 178 259 185 131 346 176 194 203 168 160 198 147 244 202 168 192 155 241 163 176 157 244 206 277 263 135 118 159 161 178 153 177 210 204 144 220 242 232 145 236 244 145 374 191 197 204 163 200 157 208 367 204 157 260 115 214 255 230 120 -9 235 128 197 246 255 192 129 183 109 273 191 176 143 200 157 143 113 212 195 146 158 175 320 235 155 -9 190 195 169 252 144 -9 274 211 120 -9 155 180 301 265 187 274 159 264 220 276 199 249 189 267 108 267 104 286 216 269 104 296 323 245 242 298 166 198 201 241 -9 172 278 243 190 185 278 260 -9 215 -9 163 157 102 287 202 189 250 184 305 245 303 218 133 129 244 153 -9 167 257 178 178 158 208 220 268 210 224 286 215 178 230 168 300 169 235 266 154 320 293 203 225 168 128 180 376 211 197 193 233 176 296 194 183 298 303 148 176 164 293 131 154 187 -9 208 177 268 -9 302 202 204 145 246 206 213 280 143 253 282 201 100 270 208 194 254 171 153 111 145 421 167 204 249 -9 209 213 168 139 260 272 125 -9 164 142 244 229 264 220 171 304 196 209 203 146 121 201 125 245 181 129 358 305 203 204 320 257 216 206 181 221 188 146 254 227 235 255 221 
1307 606 Dai China EAST_ASIA 120 112 124 127 142 236 138 112 -9 98 130 -9 158 -9 250 229 173 165 218 194 175 143 255 132 204 184 188 138 119 201 183 182 148 163 94 166 124 147 170 180 208 185 246 115 -9 108 225 224 271 195 221 96 117 233 196 288 187 113 95 241 189 118 135 113 160 141 263 234 91 123 -9 107 161 151 109 165 234 140 187 127 187 104 143 127 208 240 247 139 178 160 -9 150 181 235 126 187 246 197 119 152 246 205 190 158 170 259 185 123 338 172 192 199 168 156 198 147 240 194 144 188 151 237 151 172 133 232 200 265 251 131 110 143 153 170 145 165 202 200 128 208 242 228 121 224 228 145 374 187 173 204 147 188 153 184 355 204 157 256 97 210 255 230 120 -9 225 120 173 242 255 188 129 175 109 269 187 164 143 196 153 151 109 210 195 142 150 171 320 225 147 -9 190 187 169 248 132 -9 274 207 112 -9 151 180 297 241 171 270 151 264 216 268 187 241 189 263 108 263 104 250 212 261 96 292 319 233 238 298 154 170 201 233 -9 160 274 239 178 181 278 256 -9 211 -9 143 153 98 283 194 177 250 180 301 237 299 214 129 129 224 153 -9 155 245 170 174 154 204 208 260 198 220 278 209 174 214 168 300 161 235 262 134 316 285 195 217 156 128 176 368 207 193 189 209 168 296 170 179 294 303 140 176 148 289 123 146 159 -9 208 173 264 -9 270 198 200 141 230 194 201 252 139 249 278 201 100 254 180 186 242 167 141 111 141 405 159 204 249 -9 207 201 168 115 252 268 125 -9 160 138 236 221 260 204 171 304 196 185 199 138 119 199 119 245 181 117 326 293 191 180 316 209 216 202 177 209 184 146 246 227 231 255 205
1308 606 Dai China EAST_ASIA 126 124 124 133 164 236 138 124 186 98 138 120 148 -9 264 233 169 165 218 198 195 143 249 136 218 200 188 134 143 215 191 184 160 173 102 172 130 173 172 184 212 188 252 115 -9 108 243 233 268 213 233 117 138 -9 205 312 190 116 89 241 195 133 141 119 163 156 251 246 94 135 263 113 158 157 112 168 234 155 187 133 187 107 143 130 211 249 247 154 185 166 200 150 184 253 138 193 246 200 119 156 246 205 198 158 170 -9 205 143 338 172 196 207 182 164 202 147 244 198 144 188 155 241 163 180 145 224 210 277 255 147 130 159 153 170 157 173 202 212 128 216 246 228 145 224 240 149 382 187 177 204 167 192 153 208 355 204 157 244 119 214 263 234 120 -9 237 132 193 238 259 192 149 175 117 277 195 176 131 200 165 151 121 -9 187 154 142 179 324 215 159 245 198 187 173 256 152 -9 274 227 120 -9 151 184 297 257 187 274 151 264 224 276 195 249 189 -9 108 267 104 258 208 257 104 300 323 245 246 298 154 198 193 233 290 170 274 243 -9 189 282 260 184 223 160 155 -9 110 291 202 189 246 180 321 241 311 218 129 125 244 169 322 167 253 174 178 158 208 216 264 198 224 286 223 174 230 180 308 151 239 262 158 320 285 203 257 164 136 180 376 211 197 193 229 168 308 186 183 302 303 140 192 168 293 131 158 199 -9 212 173 264 296 266 202 192 149 246 198 217 272 142 249 282 205 116 270 200 202 250 171 157 111 141 421 163 200 245 227 207 209 -9 131 264 268 121 -9 164 138 244 225 260 220 159 304 198 209 203 138 121 205 125 245 187 121 358 301 203 212 324 269 212 206 181 205 180 146 266 235 235 271 221 
1308 606 Dai China EAST_ASIA 126 116 124 129 156 234 136 112 180 92 136 118 148 -9 258 229 169 163 218 194 193 143 245 136 204 184 188 134 119 205 187 182 158 163 102 172 120 143 170 180 212 188 246 115 -9 105 231 224 268 198 221 96 117 -9 196 297 187 113 89 238 195 121 132 113 157 147 239 234 94 126 263 113 155 157 112 165 234 152 187 130 178 104 137 130 205 249 238 151 179 160 182 150 184 250 135 193 246 200 119 152 246 205 194 158 170 -9 185 127 334 168 194 203 174 160 198 147 236 198 140 188 155 237 159 172 141 212 206 277 251 147 122 155 153 166 149 173 198 208 124 212 242 228 133 220 224 149 370 187 169 204 155 188 153 200 351 204 145 240 97 214 263 230 116 -9 233 120 173 234 259 192 129 175 109 269 187 176 131 196 157 159 109 -9 183 154 142 171 320 207 155 241 190 183 169 240 132 -9 274 223 116 -9 151 180 293 245 167 254 151 252 224 272 183 249 185 -9 108 263 100 258 200 257 96 300 319 245 242 290 150 174 189 233 286 166 270 239 -9 181 274 260 172 209 156 155 -9 98 287 194 173 246 180 309 237 303 218 129 125 228 169 322 163 245 170 174 158 204 208 260 190 220 282 209 174 226 172 304 147 239 258 138 316 257 203 257 160 128 176 372 211 189 189 225 164 300 170 175 294 303 140 176 148 261 123 154 195 -9 204 173 264 292 266 198 188 149 238 182 201 260 139 245 274 201 104 266 180 198 228 163 153 111 141 409 159 200 241 223 207 201 -9 119 256 268 117 -9 160 138 196 217 256 204 159 304 198 185 199 118 113 201 123 237 183 117 354 285 203 180 320 237 212 198 173 197 176 142 258 231 227 255 205
1309 606 Dai China EAST_ASIA 126 116 124 137 162 230 138 124 186 98 130 120 158 223 264 241 167 165 218 200 191 143 249 140 -9 184 192 140 139 207 191 186 154 167 102 172 130 147 166 184 212 188 252 115 141 108 240 224 268 216 242 117 138 236 199 312 -9 113 98 253 195 133 144 125 163 159 251 246 91 126 269 116 158 157 118 162 234 152 193 127 190 110 140 136 214 252 247 148 180 166 200 156 190 247 132 190 249 200 125 152 254 201 194 166 174 263 189 127 342 176 196 203 178 160 206 147 248 198 144 196 155 241 163 176 133 228 210 281 251 155 122 159 157 170 165 173 206 208 124 212 246 224 133 224 232 145 386 183 193 208 159 200 193 200 347 220 149 244 119 222 263 230 120 175 241 136 201 242 259 192 153 183 117 269 195 180 135 196 157 135 -9 214 191 142 146 175 328 217 155 245 194 195 181 248 148 245 274 227 116 244 151 184 293 245 171 270 151 260 220 276 195 249 185 263 104 267 104 262 212 265 100 292 319 241 246 298 158 194 193 237 302 170 274 243 182 189 282 264 204 219 156 167 157 110 295 202 193 254 184 309 241 303 226 133 129 248 169 334 163 265 178 178 158 216 212 272 198 224 282 231 182 234 180 304 161 239 266 158 324 289 199 241 164 132 176 376 211 193 201 233 -9 300 190 175 294 307 140 192 164 293 131 158 191 196 184 173 272 296 266 198 204 149 242 190 209 284 151 249 286 205 116 278 184 190 246 175 149 119 173 421 167 204 249 227 209 217 180 135 268 276 129 264 168 138 240 233 272 224 159 312 198 217 203 118 117 201 129 245 191 129 370 301 203 180 316 237 216 202 181 205 180 146 262 235 235 263 229 
1309 606 Dai China EAST_ASIA 126 116 124 129 142 230 138 120 180 98 130 120 148 217 258 233 147 165 216 194 191 143 245 128 -9 184 188 134 139 201 187 176 148 163 94 172 130 145 166 182 212 185 249 115 141 108 234 224 265 210 236 96 117 227 196 300 -9 113 98 241 189 133 132 119 163 150 251 234 91 126 263 113 158 157 109 162 234 140 190 127 178 104 134 133 205 237 247 148 179 157 179 150 184 235 126 184 246 200 119 152 246 197 182 162 170 259 185 127 338 172 182 203 168 160 198 147 240 194 144 188 155 237 151 176 129 224 202 273 247 131 122 155 153 166 157 169 194 208 120 204 242 208 133 224 232 133 370 175 177 200 147 188 165 196 347 204 141 240 111 222 255 230 116 175 215 120 197 238 255 180 129 179 109 269 191 180 135 196 157 147 -9 206 191 142 146 159 324 213 151 237 194 195 177 240 144 225 274 211 116 240 151 180 289 241 167 258 151 260 208 276 187 245 185 259 108 259 104 250 200 261 100 284 315 233 234 286 158 194 169 229 270 164 270 239 178 185 274 260 192 207 152 159 153 110 291 202 185 242 180 301 237 303 206 129 125 248 153 314 155 253 162 174 154 208 208 256 190 220 274 209 170 226 168 300 157 235 266 146 312 289 191 233 160 128 176 368 211 189 197 233 -9 296 190 175 294 303 140 176 152 261 127 150 183 192 184 173 268 292 262 194 188 145 234 190 201 272 139 245 278 201 116 254 180 190 242 167 145 111 165 405 163 200 245 227 207 213 176 131 252 272 121 256 156 138 196 233 252 208 159 308 198 213 203 118 111 199 125 241 181 121 338 297 203 180 304 237 212 202 177 201 176 146 250 227 231 255 209 
1310 606 Dai China EAST_ASIA 120 128 154 135 144 230 138 120 188 98 130 120 150 -9 264 235 -9 167 218 194 191 143 255 128 224 184 188 144 119 207 183 184 162 165 108 168 124 145 174 186 212 191 252 115 -9 108 234 239 277 -9 230 96 138 236 -9 312 187 113 98 259 195 121 144 122 166 162 251 246 94 -9 266 116 158 157 118 165 234 155 187 136 190 107 137 136 208 252 244 154 188 160 197 153 181 247 138 190 252 200 125 152 246 205 202 162 166 263 189 131 338 172 190 195 180 164 198 159 252 198 144 192 155 241 159 176 137 240 210 273 247 131 126 159 137 174 165 173 198 216 140 208 242 232 121 228 240 149 374 183 197 204 163 188 189 212 351 208 157 256 119 214 259 234 120 -9 229 128 201 246 259 180 145 199 117 277 191 184 147 208 157 143 117 212 187 154 150 175 328 225 155 245 194 195 173 256 140 237 278 231 128 -9 159 188 293 257 183 274 159 260 224 268 187 257 185 271 108 263 112 258 224 269 104 296 323 249 234 290 162 202 213 237 298 170 274 -9 182 185 282 260 204 211 164 167 149 108 287 190 189 254 184 313 237 311 218 133 125 -9 153 326 167 249 170 170 154 208 212 260 198 228 278 209 182 230 176 300 169 239 266 150 324 289 207 257 168 136 176 364 211 193 197 229 180 300 190 183 298 303 144 188 164 289 131 158 187 -9 184 181 268 296 274 202 200 153 246 190 205 272 151 249 274 201 116 278 204 206 236 175 145 111 169 421 171 208 253 227 213 201 176 135 264 272 125 -9 164 142 240 233 260 224 167 304 206 185 203 146 119 205 125 249 191 117 366 309 203 208 324 265 216 202 181 213 184 150 258 231 235 263 221 
1310 606 Dai China EAST_ASIA 120 124 144 129 142 218 138 120 186 98 130 118 148 -9 260 233 -9 165 216 194 187 143 245 128 204 184 188 134 119 201 183 174 158 163 102 166 120 143 172 174 208 185 249 115 -9 108 234 236 271 -9 221 96 117 230 -9 297 181 110 95 241 192 121 132 119 157 159 251 234 76 -9 263 107 152 151 112 162 234 152 187 130 187 104 134 118 208 246 230 151 178 160 182 150 181 229 135 187 246 197 119 140 246 201 198 158 162 263 185 131 338 168 190 191 168 164 186 147 244 194 140 184 151 237 159 176 133 228 206 269 247 131 122 151 133 166 149 173 198 208 128 204 242 208 121 224 224 145 374 183 177 200 159 188 117 208 347 204 141 240 111 210 255 234 120 -9 225 120 193 242 255 172 129 183 109 269 183 176 131 200 153 155 117 208 187 142 142 171 320 219 147 237 194 187 169 240 132 225 278 211 124 -9 155 184 289 241 175 274 139 260 220 260 175 253 185 259 112 263 104 254 196 253 100 296 319 233 230 286 154 198 189 233 282 164 270 -9 174 177 274 260 188 207 152 159 141 98 287 182 189 246 180 309 233 303 214 129 125 -9 153 322 163 245 162 170 154 204 208 260 198 228 266 209 170 226 168 292 143 235 266 138 320 257 195 237 164 128 176 364 195 193 181 225 160 300 174 179 298 303 136 176 160 261 131 154 187 -9 184 173 264 284 262 190 188 153 242 182 201 252 139 245 274 201 116 262 204 194 236 171 145 111 145 405 163 200 249 227 213 201 164 131 252 264 117 -9 148 138 196 225 248 208 159 304 198 185 199 134 115 203 123 245 181 117 350 297 191 208 312 241 216 198 181 213 180 146 250 231 235 255 221 
1311 606 Dai China EAST_ASIA 126 124 124 129 156 234 140 120 188 98 130 118 -9 -9 262 233 165 167 218 194 189 143 249 142 222 184 188 136 119 205 189 180 154 165 104 166 128 173 168 186 212 191 249 115 141 129 234 242 274 207 -9 96 117 236 205 294 184 116 95 -9 -9 127 141 119 163 150 266 237 91 126 -9 113 155 157 121 165 234 158 190 -9 193 104 140 130 208 249 244 148 182 -9 179 156 190 238 138 196 252 200 122 156 246 201 198 162 174 259 185 135 342 172 194 203 186 156 -9 147 248 194 144 196 155 241 167 176 141 216 206 269 255 151 126 159 153 170 161 173 198 212 124 204 246 232 133 228 228 149 382 183 177 204 163 188 189 200 355 -9 157 240 115 222 263 238 116 -9 245 140 197 238 259 188 149 179 109 277 187 184 143 200 157 143 113 212 191 162 154 175 324 229 159 245 190 207 173 256 144 -9 274 227 120 -9 159 188 301 261 175 282 151 264 224 276 179 253 189 271 112 271 108 278 220 265 108 300 323 245 230 298 158 -9 213 233 306 174 278 243 -9 189 290 268 188 215 164 167 -9 110 287 198 197 246 180 301 241 311 214 133 129 252 157 -9 163 245 166 178 150 212 208 268 202 220 282 213 174 238 184 296 157 239 266 154 316 289 199 237 168 -9 176 368 203 193 193 229 184 300 182 187 302 311 140 196 168 293 119 158 199 -9 212 177 268 296 306 202 192 153 242 202 209 -9 -9 253 282 209 120 274 204 198 246 167 157 111 165 405 163 204 249 235 213 221 176 135 268 272 125 -9 160 142 252 233 260 228 171 304 202 185 207 146 119 205 127 249 191 125 374 297 203 -9 316 269 216 214 181 213 192 150 -9 231 231 267 221 
1311 606 Dai China EAST_ASIA 126 116 124 129 142 230 138 112 180 98 130 114 -9 -9 262 233 163 163 218 194 189 143 241 140 222 184 186 134 119 205 189 176 154 165 94 166 124 147 164 180 212 188 249 115 141 120 234 224 265 201 -9 96 117 227 196 288 184 113 95 -9 -9 118 132 119 163 144 251 234 88 123 -9 110 152 157 109 162 234 149 187 -9 190 98 134 127 205 228 235 139 178 -9 179 156 184 235 126 196 252 197 119 140 246 197 198 158 162 259 185 135 334 168 192 203 178 152 -9 143 240 190 144 188 151 237 151 176 133 216 206 265 251 151 118 151 153 170 153 165 198 204 124 204 246 228 121 224 224 149 382 179 177 200 159 188 153 184 351 -9 157 240 97 194 259 230 116 -9 237 136 197 238 255 188 149 175 105 277 183 180 131 196 149 143 113 210 191 158 150 163 324 221 151 241 190 187 169 248 144 -9 270 211 112 -9 151 176 297 245 175 274 151 264 220 272 179 241 185 259 104 263 104 270 216 261 104 296 319 241 230 294 158 -9 197 225 286 164 274 239 -9 189 278 260 184 207 164 159 -9 98 287 178 189 246 160 301 237 303 214 129 129 240 153 -9 155 245 162 170 150 208 208 260 198 220 266 209 174 226 168 292 143 235 266 138 316 285 199 229 156 -9 176 364 203 193 189 225 168 300 182 175 298 307 136 176 164 273 119 150 195 -9 184 177 264 292 266 198 188 149 230 190 205 -9 -9 245 274 197 104 254 180 190 242 163 149 111 141 405 159 196 245 227 207 217 172 131 260 268 121 -9 156 138 228 233 256 216 159 304 200 185 195 142 113 201 123 245 181 117 354 293 191 -9 296 237 216 202 181 205 176 146 -9 227 231 263 205
1312 606 Dai China EAST_ASIA 124 126 142 135 144 232 150 -9 182 98 -9 120 148 -9 262 233 -9 163 218 200 193 147 249 128 218 200 202 136 139 209 183 176 158 165 96 172 130 145 174 184 212 188 -9 115 -9 108 234 245 277 210 230 105 132 233 196 312 196 110 98 256 195 136 138 116 157 159 266 246 94 123 266 110 155 166 112 162 -9 152 190 133 187 104 143 136 214 246 247 139 179 166 197 159 190 250 138 -9 246 200 125 152 246 205 202 158 162 267 189 131 346 176 198 203 202 164 206 151 248 198 148 192 155 237 163 -9 141 216 206 273 255 155 126 155 153 170 157 177 -9 212 136 212 242 228 137 228 236 145 382 183 181 204 159 192 181 200 351 216 161 240 115 218 267 238 120 -9 237 140 197 242 255 188 153 183 109 281 187 180 135 200 157 147 117 212 195 142 146 171 320 225 159 241 190 195 177 256 140 -9 278 231 124 -9 159 188 297 241 175 274 139 264 216 272 187 253 189 -9 112 267 104 278 216 257 104 296 323 253 238 294 166 194 -9 233 290 168 274 239 -9 185 274 268 200 -9 168 167 -9 110 291 194 193 250 184 301 237 311 230 129 -9 244 169 326 -9 253 174 174 150 212 220 268 202 228 282 209 170 234 176 -9 169 239 266 162 320 289 207 233 164 136 176 376 211 -9 197 229 168 300 194 187 298 307 140 192 160 293 135 158 195 -9 212 177 264 292 266 202 200 153 242 206 205 264 155 253 282 201 120 270 204 190 242 167 165 111 149 421 171 208 245 235 211 221 180 135 248 260 133 -9 156 146 248 233 260 224 -9 304 196 217 207 138 117 203 129 241 191 129 358 297 203 -9 316 265 220 206 -9 205 180 150 254 251 235 267 213 
1312 606 Dai China EAST_ASIA 120 116 124 133 142 230 140 -9 180 98 -9 120 132 -9 258 233 -9 163 218 194 191 143 245 128 204 184 200 134 119 201 174 176 154 161 94 172 120 145 172 180 212 188 -9 115 -9 105 231 239 271 207 230 96 117 230 196 297 187 104 89 253 192 121 132 113 157 147 263 234 91 123 263 107 155 157 109 162 -9 149 187 130 178 98 137 130 205 240 230 139 179 160 179 150 190 235 135 -9 246 200 119 152 246 197 194 158 162 259 185 119 326 168 194 203 178 152 206 147 244 194 144 188 147 237 159 -9 129 216 206 261 251 147 114 151 149 170 149 169 -9 196 136 208 238 224 121 228 224 145 370 183 177 200 155 188 157 188 351 204 141 240 97 198 259 234 116 -9 235 128 177 238 255 180 145 171 109 277 187 180 135 196 157 151 109 208 191 142 146 167 316 221 155 237 190 195 173 252 132 -9 278 227 116 -9 155 176 293 241 175 254 139 260 216 264 175 249 189 -9 108 263 104 266 212 257 100 296 319 241 234 290 158 190 -9 225 282 164 266 235 -9 177 270 260 184 -9 148 163 -9 100 287 178 189 246 164 297 237 299 222 129 -9 244 169 318 -9 249 166 162 150 212 208 264 198 220 274 209 170 234 168 -9 169 235 262 138 316 285 203 229 156 128 172 368 207 -9 197 225 160 296 178 175 298 303 140 184 152 265 123 154 187 -9 208 173 260 292 266 198 188 141 234 198 201 256 135 245 282 201 116 270 184 186 242 163 161 111 141 417 163 204 245 227 207 209 172 131 248 256 121 -9 152 138 236 229 252 216 -9 304 196 209 199 118 113 201 127 237 191 117 350 293 191 -9 312 241 216 206 -9 193 176 146 254 231 227 259 209
1313 606 Dai China EAST_ASIA 126 124 146 129 166 238 138 124 188 98 136 120 158 223 262 233 171 167 218 194 187 143 249 132 218 184 204 134 119 205 -9 180 156 169 94 172 130 145 170 180 212 191 249 115 141 129 231 239 274 -9 236 111 138 221 196 297 181 116 98 241 192 121 144 119 163 150 251 237 91 132 266 119 158 157 115 165 255 152 193 133 190 107 143 133 208 252 247 154 185 166 200 159 190 253 144 190 246 200 119 152 254 205 202 162 170 259 209 127 342 172 190 203 182 168 210 151 248 198 140 188 155 233 163 176 137 232 210 277 255 147 122 159 149 150 157 177 198 208 128 220 250 228 141 224 228 153 374 183 177 204 159 188 157 204 355 212 157 244 123 222 267 238 124 183 239 124 189 238 259 188 157 187 129 281 199 184 143 200 153 155 117 212 199 158 142 171 324 215 155 245 190 203 173 260 148 225 274 223 116 236 155 184 293 241 167 274 163 260 228 280 187 253 189 271 108 263 104 270 216 269 100 296 319 245 246 290 162 194 193 233 298 170 274 239 186 185 282 264 184 219 164 163 157 106 295 194 193 254 180 309 249 311 214 129 129 240 153 322 155 249 166 178 158 208 216 268 198 -9 282 223 178 234 180 304 157 259 270 150 320 293 203 233 168 136 176 372 207 193 197 229 184 300 190 179 294 303 144 192 168 289 131 150 187 192 208 177 268 296 270 202 192 153 246 194 209 284 151 253 286 201 120 254 204 190 242 175 145 115 141 405 171 200 261 227 213 209 176 131 260 264 121 264 176 142 244 233 260 216 167 308 202 217 203 142 111 201 125 245 191 117 366 297 191 216 308 265 216 214 181 205 180 142 262 227 231 255 237 
1313 606 Dai China EAST_ASIA 120 116 124 127 142 232 138 120 186 98 130 120 148 217 258 233 147 163 218 194 187 143 243 128 218 184 188 134 119 201 -9 172 154 167 94 166 124 143 170 174 208 188 249 115 141 105 225 224 271 -9 230 96 117 218 196 294 178 113 95 241 192 118 144 113 157 150 251 234 79 126 260 110 155 157 112 165 234 152 187 127 187 104 134 130 205 249 235 148 178 157 179 156 184 235 138 190 246 200 119 152 246 201 194 162 170 255 185 123 330 168 190 203 168 152 206 139 240 194 140 188 155 221 151 168 133 224 210 273 247 143 110 151 133 150 145 165 194 208 124 204 242 228 121 216 228 145 374 183 169 204 139 188 153 192 351 204 145 240 115 198 255 238 116 167 225 120 189 238 255 188 129 183 109 277 187 184 131 192 149 167 113 212 183 142 142 171 316 215 155 241 190 195 169 256 132 225 274 207 112 236 155 176 293 241 167 258 159 260 220 272 187 245 185 247 104 263 100 266 212 265 100 296 319 233 246 286 154 194 189 233 294 168 274 239 174 177 274 264 184 211 160 155 153 98 291 182 189 246 164 305 229 307 214 129 125 224 153 322 155 249 166 174 158 204 208 256 190 -9 278 209 170 226 172 304 143 235 262 130 316 289 199 233 168 128 172 364 203 185 189 229 172 296 174 175 294 303 140 176 156 285 123 150 187 188 184 173 264 296 266 198 188 149 234 190 209 268 151 249 274 197 112 254 204 186 228 167 141 111 141 405 163 196 245 227 213 201 172 131 256 256 117 256 152 138 196 233 248 204 159 304 198 185 199 118 111 201 123 241 181 117 362 293 191 180 296 241 212 202 181 201 180 142 246 223 227 247 217 
1314 606 Dai China EAST_ASIA 126 130 142 129 156 234 140 124 188 102 140 122 148 -9 264 233 -9 165 218 194 187 143 253 142 226 206 190 142 141 207 -9 184 162 167 108 166 128 169 172 184 -9 185 246 115 -9 129 237 224 277 201 236 111 126 236 199 306 190 110 98 241 192 133 144 113 163 156 251 237 91 126 263 116 158 166 121 165 234 155 190 133 190 113 146 133 214 252 -9 154 179 169 197 156 190 250 138 193 252 200 122 152 250 201 202 166 170 271 209 135 338 180 200 195 188 160 206 151 244 194 168 184 155 237 163 176 137 224 210 273 255 155 126 155 157 170 157 173 202 208 128 212 242 236 133 224 236 149 378 183 193 204 159 200 165 212 359 208 141 244 111 222 263 234 120 -9 245 140 197 246 259 188 129 187 109 277 195 176 143 196 165 147 113 212 191 154 150 171 320 213 159 237 190 203 165 260 152 249 270 223 120 -9 151 188 297 241 187 274 151 -9 224 276 195 257 189 267 108 267 108 278 220 265 104 296 331 245 234 294 158 202 213 233 294 168 278 243 182 189 286 264 188 219 164 163 157 100 283 194 193 246 180 305 241 303 214 137 125 252 169 322 167 249 170 178 154 208 208 268 198 -9 286 213 190 242 180 304 173 251 266 154 320 289 199 233 160 136 180 372 215 193 193 233 168 308 182 183 302 303 144 192 164 261 123 158 195 -9 212 177 272 300 310 198 192 149 246 206 209 264 143 253 282 201 116 270 208 202 250 167 161 111 165 417 163 208 253 227 213 205 176 131 260 272 121 -9 164 138 244 233 264 216 -9 308 204 221 203 134 111 -9 125 241 187 129 362 297 207 216 312 265 220 206 181 213 188 146 262 231 231 259 237 
1314 606 Dai China EAST_ASIA 126 116 124 129 156 230 138 112 182 98 130 120 148 -9 250 233 -9 165 214 194 177 143 245 140 204 184 186 134 119 201 -9 176 154 161 102 166 120 143 170 180 -9 185 246 115 -9 126 234 224 265 201 221 96 117 227 196 288 184 104 98 238 192 133 135 113 157 150 251 234 91 123 263 113 155 151 118 162 234 152 187 133 178 98 143 130 208 246 -9 148 179 163 194 150 184 235 129 187 246 197 119 152 246 201 198 158 162 259 185 131 338 172 194 191 168 160 202 147 240 194 144 184 155 225 159 172 137 224 200 273 255 131 110 139 153 170 153 173 194 196 124 204 242 208 121 212 228 145 370 183 189 204 147 188 157 200 347 204 141 240 97 218 259 230 116 -9 229 136 193 242 259 184 129 183 109 269 187 176 131 196 157 151 109 206 187 142 146 159 312 211 155 237 190 187 165 240 144 225 266 211 112 -9 151 184 297 241 187 254 139 -9 224 252 191 253 185 255 108 259 108 250 212 257 100 296 327 245 234 290 154 194 193 233 278 166 270 235 178 189 274 264 184 203 152 159 149 98 283 194 177 242 180 305 237 303 214 133 121 244 165 322 159 245 166 170 154 204 204 260 190 -9 278 209 174 238 176 304 169 239 262 142 320 257 199 233 160 132 176 364 207 193 181 229 164 300 174 175 298 299 140 192 160 261 123 150 187 -9 208 177 260 292 266 194 188 141 246 186 205 264 135 245 282 197 112 258 184 190 246 163 149 111 157 405 159 196 245 227 213 201 168 115 252 260 117 -9 156 138 196 221 252 204 -9 308 196 209 203 134 111 -9 123 241 181 117 346 285 203 180 296 209 216 206 181 201 180 146 258 227 231 255 225 
1315 606 Dai China EAST_ASIA 126 124 142 135 158 234 144 120 182 98 132 120 156 229 260 -9 165 167 216 194 193 143 251 146 222 184 202 138 139 207 189 180 162 163 102 166 126 145 -9 186 212 188 252 121 147 120 231 239 271 207 221 96 -9 236 199 297 190 113 95 241 195 130 144 119 163 159 263 234 91 135 263 113 158 157 121 168 234 152 187 130 190 119 140 130 205 228 247 148 188 166 197 156 184 250 135 193 249 200 128 152 246 201 206 166 174 271 209 127 342 172 194 207 182 164 -9 155 248 194 144 196 155 241 159 176 145 228 -9 281 255 131 126 155 157 -9 157 177 198 212 132 208 246 232 141 224 240 145 390 187 -9 204 163 188 -9 200 363 204 153 240 115 218 267 238 120 187 239 132 197 250 255 188 149 191 121 281 191 176 147 200 165 143 121 212 187 142 142 171 316 215 155 237 190 187 173 264 144 -9 274 227 120 248 167 180 289 245 171 274 159 268 228 276 179 245 185 259 108 263 108 278 220 269 100 296 319 245 246 294 158 194 193 261 278 174 278 239 -9 185 -9 264 188 207 164 155 -9 106 291 182 185 250 180 309 241 311 226 129 125 248 157 -9 163 261 170 178 150 212 216 264 210 220 282 209 190 230 176 308 173 255 262 146 312 289 199 257 168 140 176 376 207 193 189 229 184 304 170 179 294 307 152 196 156 285 119 -9 187 192 212 177 264 296 266 202 204 149 238 198 213 280 151 249 278 201 120 278 204 190 246 163 161 111 145 421 163 200 249 227 203 213 -9 131 260 276 129 -9 164 138 236 233 260 220 159 304 202 213 203 142 123 203 127 253 187 129 346 293 203 204 320 -9 216 202 181 225 184 146 -9 231 227 255 221 
1315 606 Dai China EAST_ASIA 124 112 124 135 142 230 144 112 180 98 130 118 148 217 250 -9 165 165 214 194 187 143 245 134 218 184 188 134 119 207 183 176 162 163 94 166 120 143 -9 180 212 188 249 121 141 105 225 224 271 195 221 96 -9 233 199 291 184 113 86 238 192 118 132 113 163 147 239 234 79 126 254 113 158 151 112 162 234 140 187 130 187 104 134 127 202 228 247 148 179 166 182 147 184 247 132 187 246 200 128 148 246 201 202 162 170 263 205 123 326 172 190 199 174 156 -9 155 236 194 144 184 151 237 159 176 137 228 -9 273 247 131 110 151 153 -9 153 165 198 204 124 204 246 232 121 224 232 145 370 187 -9 204 147 188 -9 196 347 204 153 240 97 210 263 234 120 179 239 128 193 242 255 180 149 183 109 277 187 176 143 200 153 147 117 208 183 142 138 159 316 215 147 233 190 183 169 260 132 -9 274 207 108 244 151 180 289 241 167 270 155 260 224 272 179 245 185 251 108 263 104 266 196 261 100 296 315 233 234 282 154 170 189 233 278 168 274 235 -9 181 -9 260 184 199 156 155 -9 98 287 178 181 246 180 301 225 303 206 129 125 248 153 -9 163 245 154 162 142 212 204 260 198 220 266 209 178 226 172 300 169 239 262 146 312 285 195 229 160 128 172 376 203 185 181 209 164 300 170 175 282 307 140 184 152 265 119 -9 183 192 192 169 260 296 258 202 196 141 234 198 209 256 139 245 262 197 100 258 204 190 228 163 149 111 145 417 159 200 245 227 203 213 -9 131 252 264 121 -9 160 134 236 233 256 216 159 304 196 185 195 118 119 201 123 241 183 117 346 293 199 180 308 -9 212 202 181 201 180 142 -9 231 227 255 221
1316 606 Dai China EAST_ASIA 126 128 124 135 156 234 144 -9 188 100 130 120 148 223 258 235 165 167 218 198 193 145 249 142 218 184 204 138 139 201 191 182 158 169 102 166 126 145 172 184 212 188 255 115 141 123 228 224 274 210 -9 111 135 233 211 309 190 113 98 241 192 136 132 116 163 159 263 234 94 129 266 110 155 157 109 168 234 152 187 136 187 104 146 130 214 252 244 154 179 169 203 159 187 253 132 193 252 200 125 152 254 209 198 166 170 263 209 127 342 176 196 207 178 160 198 155 244 202 144 188 155 237 163 180 141 228 214 273 255 151 126 155 153 170 161 173 206 216 128 212 246 232 145 228 232 145 374 183 173 208 159 188 157 200 367 216 157 256 119 214 -9 238 116 187 235 136 201 238 255 188 145 183 121 281 191 180 135 204 153 143 121 214 199 142 154 163 324 223 155 245 -9 207 173 260 148 245 278 223 120 244 159 180 301 257 187 274 151 268 228 272 191 249 185 271 108 263 108 282 208 269 104 304 323 241 246 302 158 222 193 237 -9 168 274 239 -9 185 278 260 200 215 164 167 157 -9 287 198 185 250 184 301 245 315 226 137 125 244 157 322 163 261 166 178 158 208 208 260 202 224 282 209 170 238 180 308 173 239 266 154 320 285 203 229 164 128 184 368 203 189 193 233 184 300 174 195 302 307 144 192 148 269 123 162 199 192 204 177 264 300 274 198 204 153 242 194 213 288 139 249 286 205 112 266 208 206 242 183 145 115 -9 421 163 208 253 227 207 213 176 131 252 268 125 -9 156 150 236 237 264 220 167 304 204 209 195 142 127 205 127 245 183 121 -9 305 191 -9 324 245 216 214 181 209 184 150 262 227 239 259 225 
1316 606 Dai China EAST_ASIA 120 124 124 135 142 232 138 -9 182 98 130 120 148 217 250 229 161 163 218 194 187 143 243 132 204 184 188 134 121 201 174 176 154 163 104 166 120 145 170 180 208 188 249 115 141 108 225 224 265 201 -9 111 117 230 196 297 187 113 95 241 192 133 132 116 163 153 251 234 79 120 263 107 155 157 109 162 234 152 187 133 178 98 134 127 205 252 244 139 179 163 179 156 184 235 126 172 246 197 125 152 246 197 190 162 162 259 189 123 342 172 194 199 168 152 198 147 236 194 140 188 147 233 163 172 129 224 210 273 247 143 126 151 148 150 145 161 198 208 120 204 242 221 121 228 228 133 374 183 173 200 147 188 157 196 355 204 157 240 97 210 -9 238 116 187 231 120 199 238 255 172 129 183 113 273 191 176 131 200 153 163 117 208 187 142 154 159 316 219 151 241 -9 187 169 248 144 237 278 223 116 240 151 180 297 225 171 258 135 264 224 268 171 241 185 263 104 259 108 250 200 261 100 288 323 237 230 302 154 198 193 233 -9 168 274 239 -9 185 278 256 184 215 164 159 145 -9 287 178 185 250 180 297 237 303 222 133 121 244 153 318 163 245 166 178 154 208 208 260 198 216 282 209 170 230 168 292 161 235 262 130 316 257 203 221 156 128 180 364 203 185 181 225 168 296 174 187 298 303 132 192 148 265 119 150 171 188 184 173 256 296 270 198 200 141 234 190 205 260 139 249 282 201 100 254 200 190 242 163 137 115 -9 401 163 204 245 223 203 213 172 127 252 268 121 -9 152 142 196 233 256 204 151 304 196 185 195 134 123 201 125 245 183 117 -9 293 191 -9 312 245 216 202 177 205 180 146 262 223 231 251 205 
1213 607 Daur China EAST_ASIA 126 116 144 129 164 230 140 126 188 100 130 120 148 227 264 233 169 167 222 198 187 143 249 140 226 184 188 138 119 201 191 182 158 165 104 172 130 177 172 180 212 185 249 115 141 120 234 242 286 210 233 105 132 227 199 297 190 116 95 256 198 130 138 119 160 162 251 246 91 129 266 -9 158 160 115 168 249 155 190 130 -9 113 143 136 220 255 244 148 182 172 200 150 190 253 132 193 246 200 125 152 254 201 206 166 170 259 201 139 334 176 194 207 180 168 206 147 248 198 144 196 155 237 163 176 141 208 210 269 255 147 126 155 153 174 153 169 210 216 140 212 258 236 121 228 228 153 386 187 181 208 163 200 157 204 355 204 161 260 115 218 267 230 124 183 237 140 185 246 259 172 149 187 113 281 191 184 135 204 157 159 109 212 191 142 146 171 320 229 159 237 190 183 169 260 148 237 278 211 124 248 159 180 297 245 175 274 155 272 228 276 199 253 185 263 112 267 108 250 220 253 108 300 327 241 238 294 162 194 197 249 290 164 278 223 182 185 282 264 204 223 160 159 153 100 291 198 193 250 184 309 245 307 222 133 133 244 153 330 163 253 162 178 158 208 212 264 206 220 286 219 190 234 176 304 169 239 270 158 324 289 199 261 168 132 192 376 207 185 189 229 184 300 190 179 302 307 140 196 168 289 139 162 195 200 212 177 272 300 262 198 200 157 242 206 209 288 143 249 286 197 116 274 212 198 246 171 169 119 165 405 167 200 253 235 217 213 172 135 260 268 121 268 156 150 244 229 260 224 151 308 206 209 207 142 119 201 125 245 223 129 358 305 203 220 316 241 216 206 185 209 184 146 262 235 231 255 237 
1213 607 Daur China EAST_ASIA 124 116 124 129 142 230 140 112 182 96 130 114 146 217 258 233 165 165 216 198 177 137 243 130 222 184 188 138 119 193 189 176 148 165 86 172 120 145 170 174 212 182 246 115 141 105 225 224 262 195 221 96 126 227 196 291 184 113 89 241 192 121 132 116 157 162 251 234 88 126 266 -9 155 157 106 165 234 140 190 130 -9 110 134 130 202 246 244 139 179 166 194 150 184 235 129 184 246 200 119 148 246 197 202 166 162 255 185 127 322 176 194 203 172 160 198 139 236 194 144 172 151 237 155 172 137 200 210 265 255 131 126 147 133 170 145 165 198 208 120 208 246 224 121 228 228 149 382 183 181 204 147 192 117 192 351 200 157 240 115 218 259 230 120 175 225 136 181 242 255 172 129 175 113 277 187 172 131 200 157 151 109 208 183 142 142 163 320 225 151 233 190 183 165 260 144 225 274 207 120 244 151 176 289 237 175 274 143 268 220 276 187 249 185 259 108 263 100 250 216 253 100 296 319 241 230 294 162 178 185 225 270 164 278 239 178 181 278 264 188 211 152 147 145 98 291 194 189 242 180 305 241 303 214 129 129 224 149 322 155 249 162 178 154 204 208 264 198 220 274 209 178 226 168 284 165 239 262 150 320 285 199 225 164 136 176 376 203 177 185 229 172 292 186 175 298 303 140 176 148 289 127 158 187 192 212 173 268 296 258 198 188 153 242 206 201 252 139 249 282 193 104 270 200 194 242 167 141 115 141 405 159 196 245 227 217 205 172 131 252 268 117 264 152 134 208 221 256 224 151 304 202 185 203 118 117 197 123 237 181 129 338 297 203 216 300 237 212 202 181 205 180 142 258 231 227 251 205 
1214 607 Daur China EAST_ASIA 126 128 124 139 164 234 140 112 188 100 130 114 148 221 262 -9 169 167 222 194 187 145 251 140 232 200 188 152 139 199 191 176 148 167 102 172 130 177 168 184 208 191 252 115 -9 108 234 239 271 204 230 96 117 239 199 309 187 113 98 241 195 127 141 116 163 -9 251 246 91 126 266 107 161 166 112 168 234 155 190 136 -9 110 146 139 217 252 244 148 -9 166 194 159 190 238 126 193 252 200 125 156 250 201 206 158 170 267 205 135 338 176 194 203 202 164 206 151 240 194 144 192 159 237 155 172 141 232 210 -9 255 151 126 159 137 170 165 181 206 204 144 212 246 232 121 228 228 149 382 187 181 204 163 188 169 196 363 208 157 256 115 218 267 230 124 -9 239 124 197 246 263 192 -9 183 109 269 195 176 147 200 153 151 121 212 195 142 146 175 320 229 159 245 194 195 173 256 152 237 278 235 116 -9 155 192 301 265 171 278 167 268 220 272 195 253 189 275 116 267 108 286 216 269 -9 292 323 249 242 302 162 202 197 233 -9 178 274 -9 194 189 278 260 200 211 -9 163 149 -9 295 202 193 246 180 301 -9 311 218 137 129 248 165 330 167 265 174 186 158 208 216 264 202 224 290 223 190 -9 180 304 169 -9 266 158 324 285 203 261 168 128 188 376 211 193 197 229 168 296 190 187 298 307 140 -9 156 -9 123 154 195 200 192 177 264 300 -9 198 188 -9 234 -9 209 276 139 -9 278 201 120 274 204 202 250 171 141 115 161 417 167 204 257 235 213 221 172 131 260 272 125 268 164 138 232 237 -9 216 159 312 202 221 199 142 123 205 123 249 191 117 354 293 203 208 320 265 216 206 181 221 188 146 254 231 227 263 241 
1214 607 Daur China EAST_ASIA 126 118 124 129 144 230 138 112 186 98 130 114 148 217 262 -9 163 165 218 194 175 143 243 128 218 184 186 142 139 199 189 172 148 163 94 166 126 163 166 180 208 185 249 115 -9 105 225 224 271 195 221 96 117 227 196 294 184 113 95 238 195 121 132 116 157 -9 239 234 79 123 257 107 155 157 109 162 234 152 187 133 -9 104 143 133 205 246 232 139 -9 163 179 156 184 235 126 187 246 200 122 148 246 193 202 158 162 259 185 131 338 172 194 199 182 164 202 143 224 194 144 188 155 237 151 172 129 224 200 -9 247 131 122 155 133 150 157 169 198 196 124 204 238 216 121 216 224 145 370 183 173 204 159 188 153 192 359 208 145 244 111 210 263 230 116 -9 225 120 177 242 255 188 -9 179 109 269 183 176 135 196 149 147 113 210 191 142 142 171 312 229 155 245 194 195 169 252 140 225 274 207 108 -9 155 184 293 241 167 262 139 264 220 260 187 241 181 263 112 263 104 258 216 257 -9 288 319 245 238 286 158 194 185 233 -9 168 274 -9 182 185 278 260 184 207 -9 159 145 -9 287 202 173 246 164 297 -9 307 214 125 129 240 157 322 155 253 174 178 154 208 212 264 202 216 266 213 174 -9 168 292 161 -9 262 142 316 269 199 225 164 128 180 372 207 185 185 229 164 296 186 187 294 303 140 -9 148 -9 123 154 167 196 184 173 264 292 -9 190 188 -9 234 -9 197 260 139 -9 274 197 112 254 204 202 242 171 141 111 145 405 159 200 253 227 211 217 156 131 256 268 121 256 156 134 228 233 -9 208 159 308 196 209 199 118 121 201 121 245 181 117 342 289 203 180 312 261 212 198 181 201 180 138 254 231 227 259 233 
1215 607 Daur China EAST_ASIA 126 116 142 139 166 234 146 116 186 98 138 120 152 219 262 -9 147 167 224 198 187 149 255 138 226 184 188 138 139 201 -9 182 162 167 104 166 126 163 170 174 212 188 -9 124 -9 120 228 245 277 201 239 111 117 236 202 300 193 113 92 238 198 127 144 122 163 162 251 246 94 126 266 110 158 157 115 165 237 155 -9 133 -9 110 143 136 208 252 241 151 -9 169 -9 156 -9 247 -9 190 252 200 122 156 250 205 206 158 174 263 189 131 350 176 200 203 -9 164 202 151 244 198 144 188 159 241 159 180 137 240 200 309 259 151 126 151 148 154 165 173 202 208 140 204 254 228 141 228 236 149 378 187 189 204 159 188 153 208 355 208 157 272 97 226 263 230 120 -9 245 128 205 242 259 192 -9 -9 121 281 187 184 139 196 157 163 121 216 191 142 142 175 320 229 159 245 198 207 169 240 148 245 278 223 120 -9 163 188 297 261 175 258 -9 264 220 280 199 253 185 -9 108 263 104 274 216 269 104 300 323 -9 234 302 170 202 209 233 298 172 274 239 190 193 282 268 196 223 -9 159 149 -9 291 194 193 246 180 309 -9 307 218 129 121 248 157 326 159 245 174 178 154 208 216 272 202 -9 282 209 178 238 180 304 169 255 266 150 324 289 211 241 172 140 180 372 211 197 197 213 192 300 182 187 302 299 144 176 164 -9 127 162 203 200 208 177 264 324 282 202 208 153 242 -9 209 280 151 249 278 209 116 274 212 198 246 171 -9 115 141 425 171 200 253 231 -9 217 176 131 268 272 121 264 160 138 236 237 264 220 167 308 198 -9 199 138 119 213 129 253 -9 117 366 309 203 180 308 209 220 202 177 213 180 146 266 235 231 275 221 
1215 607 Daur China EAST_ASIA 124 116 124 129 164 228 138 112 186 98 132 120 148 217 258 -9 147 165 218 194 185 143 249 136 218 184 188 134 119 201 -9 180 154 167 100 166 120 145 168 174 208 182 -9 118 -9 108 228 233 274 195 236 96 117 230 199 297 181 113 86 238 195 121 132 113 157 144 239 237 88 123 263 107 152 154 112 162 234 140 -9 133 -9 98 137 133 205 246 241 139 -9 154 -9 156 -9 235 -9 190 246 200 119 148 246 205 194 158 162 255 185 119 342 168 198 203 -9 156 198 143 244 194 144 188 155 237 155 180 129 216 200 265 251 131 122 147 133 150 153 165 202 204 124 204 246 224 121 228 228 145 370 187 189 204 147 188 117 192 351 204 149 240 97 218 259 230 112 -9 225 120 197 238 259 172 -9 -9 109 277 187 184 131 188 153 147 109 208 187 142 134 163 316 215 155 241 194 195 165 240 132 241 274 207 112 -9 155 184 289 241 171 258 -9 264 208 276 183 253 185 -9 104 263 104 250 216 265 100 292 319 -9 234 298 162 194 197 233 294 168 266 239 186 189 282 260 184 219 -9 155 141 -9 287 182 181 242 180 305 -9 303 218 129 121 244 153 326 155 241 170 174 154 204 208 264 198 -9 278 209 174 226 172 304 165 251 262 142 324 257 195 225 164 140 180 368 203 185 197 209 168 292 182 183 294 299 140 176 164 -9 119 158 183 192 196 173 260 296 266 202 204 149 234 -9 209 272 135 245 262 197 116 270 204 182 242 167 -9 111 141 417 159 200 249 223 -9 201 172 119 264 272 121 264 156 134 224 225 256 216 151 304 198 -9 195 138 117 205 125 245 -9 117 362 297 191 180 308 209 216 202 177 201 180 142 258 227 231 247 221 
1216 607 Daur China EAST_ASIA 126 124 144 139 142 230 146 112 188 98 130 120 148 217 258 -9 169 171 218 -9 175 143 247 140 222 184 192 152 119 205 189 182 162 171 104 172 130 173 170 180 208 191 252 121 -9 -9 237 242 271 201 221 111 138 239 196 297 187 116 98 238 192 133 138 122 166 156 251 246 94 135 266 119 158 157 115 165 249 158 190 133 -9 98 146 133 208 252 244 148 184 172 197 162 196 250 135 193 252 200 119 152 246 197 202 166 174 259 185 131 350 176 194 207 168 168 -9 143 248 -9 144 188 163 233 159 176 137 212 -9 277 255 147 126 155 149 154 157 169 202 208 136 204 254 236 129 216 228 145 386 187 181 204 163 188 193 200 351 224 157 256 111 218 263 238 120 -9 245 132 181 246 255 192 -9 195 -9 277 187 180 143 196 157 163 109 212 191 162 146 179 324 217 151 249 194 187 173 256 148 249 270 211 120 -9 167 184 301 241 171 278 151 260 216 272 207 245 193 271 108 267 108 282 216 273 108 300 323 241 250 306 162 198 233 233 298 170 270 235 182 189 282 260 208 215 164 163 145 110 291 198 189 250 184 325 -9 303 214 133 125 248 169 330 163 261 -9 182 154 208 220 264 206 224 278 213 178 234 176 304 143 255 266 150 324 289 203 257 160 136 184 372 215 193 193 237 180 300 182 191 302 307 148 192 164 -9 131 -9 187 196 208 177 268 300 286 194 188 149 242 -9 205 280 139 249 282 205 116 278 204 198 246 167 161 115 141 417 167 204 249 235 203 209 176 131 260 268 129 256 148 154 220 233 260 208 159 304 202 213 -9 138 119 205 125 249 181 129 366 301 207 204 320 269 220 206 -9 209 184 150 -9 231 235 271 209 
1216 607 Daur China EAST_ASIA 124 116 142 135 142 230 138 112 186 98 130 120 146 217 258 -9 147 165 218 -9 175 137 243 132 218 184 190 138 119 201 189 176 148 163 98 166 126 145 170 174 208 188 249 118 -9 -9 231 233 271 201 221 96 117 233 196 288 184 113 95 238 192 130 132 113 163 153 251 234 88 120 254 110 155 151 112 165 234 140 190 130 -9 98 143 133 205 228 225 148 179 166 197 159 193 235 126 190 249 200 113 152 246 193 194 158 170 255 185 127 350 168 192 203 168 164 -9 143 240 -9 144 188 155 233 159 176 133 200 -9 273 251 147 122 151 133 150 149 161 194 208 128 204 238 217 121 212 228 145 370 183 177 192 147 184 161 196 351 204 157 244 97 214 263 234 116 -9 237 128 177 238 255 188 -9 179 -9 277 187 176 131 196 153 159 109 204 183 142 142 171 324 215 135 233 190 183 165 252 144 237 270 211 108 -9 151 176 297 241 167 270 127 256 216 268 187 245 185 267 116 263 104 262 212 269 96 284 319 241 230 290 158 194 205 233 294 168 262 243 178 173 278 260 188 207 148 155 137 98 287 182 177 246 184 305 -9 291 210 129 125 240 161 330 163 253 -9 170 146 204 208 264 190 224 266 209 174 226 168 300 143 239 262 138 320 289 199 233 160 136 180 368 203 193 193 221 168 288 178 175 294 303 140 188 164 -9 131 -9 167 192 184 177 260 280 262 190 188 149 238 -9 205 271 135 249 282 197 104 270 180 190 236 167 141 115 141 405 163 200 245 231 203 209 176 127 248 268 129 256 148 150 208 225 256 204 151 304 198 205 -9 118 113 205 123 249 181 117 366 293 203 180 312 237 216 202 -9 209 180 146 -9 231 227 267 205 
1217 607 Daur China EAST_ASIA 126 116 142 135 156 230 140 120 186 98 136 120 148 223 260 233 165 165 -9 194 187 149 247 140 228 206 204 134 139 205 189 186 162 163 102 172 126 167 -9 186 212 188 249 115 141 105 237 224 274 210 221 111 132 239 208 300 187 -9 98 256 195 139 144 116 166 -9 254 246 91 132 -9 119 161 157 112 162 234 140 205 130 190 110 137 127 202 246 247 154 185 166 -9 156 190 250 132 193 252 200 125 152 246 201 206 162 -9 267 189 127 342 180 198 211 184 168 202 155 240 202 152 188 159 233 167 176 145 244 -9 313 255 151 126 155 -9 174 161 173 194 208 128 208 250 228 141 224 236 149 386 183 189 204 147 192 193 200 355 -9 157 256 111 218 255 238 116 183 237 128 197 246 255 -9 149 183 -9 277 191 180 143 196 157 155 113 220 191 158 146 167 320 215 151 245 194 203 173 240 132 249 274 227 128 248 167 184 297 241 187 274 147 264 220 268 195 253 193 267 112 263 108 266 212 257 108 304 323 241 230 298 166 214 229 241 302 170 278 227 186 177 282 264 212 205 160 159 149 98 283 194 193 250 180 313 241 307 210 137 129 248 169 -9 159 245 166 182 158 216 224 272 202 224 282 213 174 234 180 304 169 235 270 158 320 289 207 237 172 128 180 376 203 193 193 233 184 300 178 191 314 303 144 196 164 265 131 -9 195 192 204 173 268 300 -9 202 204 149 238 202 209 280 139 249 -9 209 120 270 204 202 242 167 165 115 165 425 171 208 253 231 213 217 168 135 252 272 125 264 -9 138 244 237 260 204 167 316 202 217 195 138 121 201 125 241 181 117 370 293 203 216 316 -9 220 210 185 217 184 142 -9 231 231 255 237 
1217 607 Daur China EAST_ASIA 120 116 124 135 156 230 138 112 182 98 130 120 148 223 258 233 147 163 -9 194 187 147 249 136 204 184 188 134 119 205 183 184 154 163 102 172 126 145 -9 180 208 188 246 115 141 105 225 224 274 207 221 96 132 236 193 288 184 -9 95 250 192 127 132 113 157 -9 251 246 85 132 -9 107 161 154 109 162 228 140 190 127 187 110 134 127 202 246 244 142 182 160 -9 153 184 247 132 190 246 200 119 140 246 197 194 162 -9 263 185 127 338 172 190 207 168 152 186 151 236 194 144 184 155 233 155 172 141 228 -9 277 251 131 122 155 -9 166 145 169 198 204 124 204 242 228 121 216 228 145 382 183 185 204 147 188 169 196 347 -9 153 256 97 218 255 230 112 183 225 120 189 242 255 -9 145 175 -9 277 191 172 131 196 149 143 113 218 187 142 146 159 320 205 135 233 194 199 173 240 132 245 274 219 108 240 159 172 293 241 175 274 135 260 208 260 195 241 185 263 108 263 108 254 200 257 104 292 323 233 230 294 162 198 209 233 278 168 266 239 178 177 282 256 188 201 152 159 141 98 283 178 193 250 180 301 237 303 210 133 125 244 157 -9 155 245 162 174 154 212 220 264 198 216 282 209 170 226 176 296 143 235 262 142 316 289 203 229 164 136 176 376 203 185 189 221 176 300 178 183 302 303 140 192 152 261 131 -9 191 192 184 169 264 296 -9 202 200 149 234 198 205 256 135 245 -9 201 116 258 184 202 242 163 157 115 161 405 167 204 249 227 203 213 152 131 252 268 121 256 -9 138 196 233 252 204 159 304 200 185 195 118 111 197 121 229 181 117 346 293 191 168 316 -9 212 198 177 201 184 138 -9 231 227 251 205 
1218 607 Daur China EAST_ASIA 126 116 142 131 158 234 140 124 186 106 130 120 156 -9 258 233 -9 165 220 194 187 149 251 144 218 184 190 134 119 205 191 180 158 173 112 172 126 173 172 186 208 191 249 121 -9 -9 243 239 268 210 239 111 138 233 199 297 190 116 95 241 192 121 132 122 160 156 263 234 94 129 -9 113 158 154 112 165 249 140 205 133 -9 107 137 139 208 252 247 145 179 172 200 156 184 235 144 196 249 200 119 156 246 205 202 162 174 259 189 127 334 176 194 203 200 172 198 143 252 194 144 188 159 233 159 176 141 244 210 273 251 155 122 159 137 170 153 169 202 200 124 204 242 228 137 220 236 153 -9 183 173 204 147 192 189 196 -9 208 161 240 115 222 259 234 120 -9 243 144 193 242 259 188 -9 183 109 281 187 180 131 200 161 163 121 212 191 146 146 171 328 227 155 237 198 183 169 256 148 -9 278 211 120 -9 155 180 297 241 187 274 155 260 228 272 187 257 185 267 116 267 108 262 220 265 112 292 323 241 234 294 166 194 193 233 -9 174 278 -9 -9 177 282 264 188 219 -9 159 -9 100 291 202 189 246 180 313 -9 311 222 -9 125 256 157 322 163 257 174 174 158 208 220 264 206 228 282 223 178 234 184 304 169 -9 270 162 -9 285 203 233 168 132 176 376 211 193 193 209 184 304 178 199 302 303 140 -9 148 -9 131 154 199 192 196 177 272 296 298 202 200 149 242 -9 205 288 143 245 282 -9 116 270 -9 202 250 167 165 115 161 417 167 200 253 239 203 217 180 131 260 -9 129 -9 164 134 248 237 -9 224 159 308 200 209 199 138 123 -9 125 245 191 129 354 293 203 220 312 269 220 206 181 -9 188 146 262 227 231 263 221 
1218 607 Daur China EAST_ASIA 126 116 140 129 142 228 138 120 182 98 130 118 148 -9 258 233 -9 165 220 194 177 149 245 136 218 184 188 134 119 193 189 178 148 163 102 166 120 171 170 180 208 188 249 115 -9 -9 234 239 265 201 233 96 117 233 196 297 187 116 95 238 192 121 132 113 160 150 239 234 91 126 -9 107 152 151 109 165 240 140 187 130 -9 98 134 136 202 246 244 145 179 163 194 150 181 235 126 181 246 197 119 148 246 201 194 158 170 255 181 123 322 172 186 199 180 156 190 143 248 194 144 184 159 233 159 176 137 212 206 273 251 151 122 151 133 150 153 161 198 196 124 204 242 204 129 216 228 149 -9 183 173 204 147 184 173 188 -9 204 133 240 111 218 255 230 116 -9 239 140 189 238 255 172 -9 175 109 277 183 180 131 196 157 159 117 212 191 142 138 171 324 215 151 237 198 183 169 248 132 -9 274 207 116 -9 151 180 289 241 171 254 151 260 224 260 183 249 181 259 112 259 108 250 212 257 108 284 323 241 230 294 154 194 185 233 -9 160 262 -9 -9 177 278 260 184 215 -9 159 -9 100 287 194 189 246 176 313 -9 307 210 -9 121 244 153 322 163 249 170 174 154 208 216 264 186 216 278 213 174 226 168 292 161 -9 262 142 -9 257 203 233 168 132 176 376 207 185 189 209 168 300 178 191 298 303 140 -9 148 -9 119 150 187 192 192 169 260 296 298 194 188 145 242 -9 201 256 143 245 274 -9 104 270 -9 198 238 167 157 111 141 405 167 200 245 235 203 201 172 127 252 -9 121 -9 160 134 244 233 -9 208 159 308 198 185 195 134 123 -9 123 241 181 117 342 289 203 168 308 209 212 202 173 -9 184 138 238 223 223 263 205
1219 607 Daur China EAST_ASIA 124 128 142 135 142 232 152 124 182 106 140 120 148 217 258 -9 171 167 218 198 195 149 243 132 228 184 190 148 139 207 189 182 154 -9 94 172 120 145 172 186 212 185 261 118 -9 129 225 242 271 210 221 105 138 239 199 297 190 116 95 241 195 136 144 119 163 162 251 234 91 135 269 113 158 157 121 165 246 152 -9 130 190 107 143 136 214 252 244 148 -9 166 197 156 184 256 138 196 246 200 119 156 246 205 198 158 178 259 189 131 330 172 194 207 184 164 198 143 244 194 144 192 155 237 159 180 141 228 210 273 263 147 126 151 149 174 153 173 202 208 128 204 246 224 141 228 232 145 390 183 181 204 163 192 181 200 351 212 157 244 115 218 267 234 120 -9 243 132 205 242 255 192 -9 183 121 277 199 180 139 192 161 155 117 212 191 142 146 179 320 219 167 249 198 207 173 256 132 -9 278 211 116 -9 163 180 297 261 187 274 155 264 224 276 199 249 189 263 104 267 116 278 220 269 100 300 319 245 242 294 166 198 193 229 294 174 274 239 -9 177 282 -9 208 207 156 159 -9 100 295 198 189 254 180 305 -9 303 214 133 125 248 153 322 167 253 166 174 154 220 216 260 198 228 286 219 182 238 184 304 165 239 266 154 324 285 199 237 164 128 176 376 211 197 185 229 184 296 186 175 298 307 148 192 164 289 131 154 195 196 212 177 268 292 270 202 200 149 242 -9 213 260 139 257 286 209 116 254 204 198 246 179 157 119 165 413 167 200 253 239 207 217 180 135 260 272 129 -9 168 142 244 233 260 224 167 308 -9 221 203 138 119 205 125 245 191 129 362 305 203 204 316 265 216 206 181 217 180 146 258 231 235 267 217 
1219 607 Daur China EAST_ASIA 120 116 124 129 142 232 140 112 180 98 130 120 148 217 258 -9 169 167 216 194 191 137 243 128 226 184 188 134 119 205 189 178 148 -9 94 166 120 143 170 174 212 182 249 115 -9 105 225 239 250 201 221 99 126 236 196 297 187 107 86 238 192 133 132 119 163 156 251 234 88 126 266 110 152 157 115 165 228 140 -9 127 190 104 140 136 208 228 244 142 -9 163 194 150 184 247 138 187 246 200 119 140 246 197 194 158 178 255 185 123 330 172 190 207 178 164 194 143 240 194 144 188 155 233 151 172 133 196 210 269 255 147 126 151 141 170 153 173 194 208 128 204 242 217 129 224 228 145 370 183 177 204 155 192 153 188 351 204 157 240 111 218 259 230 116 -9 243 128 177 242 251 188 -9 179 113 277 183 180 135 192 157 155 113 212 187 142 138 171 316 217 143 233 190 183 169 240 132 -9 274 211 112 -9 155 176 289 253 175 274 151 264 220 272 195 245 189 263 112 263 104 266 200 269 96 296 319 241 238 294 158 194 189 225 282 172 270 239 -9 177 278 -9 184 203 152 159 -9 98 291 174 185 238 180 301 -9 303 210 129 121 236 149 322 159 245 162 174 150 212 212 256 198 224 278 209 178 234 176 300 143 239 266 134 320 257 199 233 164 128 176 376 207 193 185 209 184 296 182 175 298 303 144 176 148 289 119 150 187 192 208 173 268 292 266 202 188 141 234 -9 201 256 139 245 262 205 104 254 184 186 246 171 141 111 141 405 155 200 245 223 207 201 172 131 252 264 121 -9 164 138 208 229 256 216 151 308 -9 185 203 138 111 205 123 233 181 121 350 293 191 180 316 209 216 202 177 209 180 150 254 227 231 263 205
1220 607 Daur China EAST_ASIA 128 128 142 131 164 230 146 122 186 98 130 120 152 223 264 -9 165 171 218 194 187 143 -9 140 228 184 188 134 139 201 189 176 158 175 104 172 126 163 170 174 212 188 249 115 -9 -9 237 242 271 216 236 105 126 239 199 309 190 116 98 256 195 124 144 119 157 147 260 234 91 126 266 119 161 157 112 165 234 140 193 133 -9 104 140 139 -9 249 247 148 -9 166 197 156 196 250 138 187 246 200 119 140 254 205 202 178 162 263 189 143 342 176 196 203 182 168 206 147 252 194 144 192 155 241 159 180 137 224 196 273 251 147 126 151 153 170 153 173 206 204 128 204 258 228 141 228 228 145 382 191 193 -9 163 192 193 196 359 216 165 240 111 -9 267 238 124 -9 239 132 193 242 255 -9 145 199 129 281 187 180 143 204 153 167 117 212 191 150 146 163 324 215 159 241 190 187 169 260 152 -9 274 227 124 -9 163 188 297 261 187 274 155 268 228 264 195 253 193 267 108 267 116 262 216 269 96 300 323 -9 242 298 162 198 193 233 -9 178 278 239 182 189 282 264 184 219 -9 155 149 102 291 182 197 246 180 317 -9 307 238 133 129 248 169 326 167 241 170 174 158 208 216 264 202 224 270 223 198 238 176 304 169 239 266 150 328 293 199 233 168 128 192 372 211 205 193 233 176 296 190 187 294 303 144 192 164 -9 131 158 191 196 212 173 264 296 270 202 208 153 238 -9 205 264 139 253 282 197 116 258 204 202 242 171 161 119 165 421 163 204 245 235 213 221 180 135 264 268 125 -9 160 138 244 237 -9 224 151 308 204 209 199 138 121 201 123 245 183 133 370 305 203 200 316 209 216 206 177 213 180 146 266 231 231 267 221 
1220 607 Daur China EAST_ASIA 126 128 124 129 164 230 138 122 180 98 130 114 132 217 262 -9 149 165 218 194 187 143 -9 140 204 184 180 134 119 201 176 176 156 165 100 166 120 145 164 174 212 188 246 115 -9 -9 225 239 271 201 221 96 117 239 199 294 184 113 95 241 195 118 132 116 157 141 251 234 79 126 266 110 158 151 109 165 234 140 190 127 -9 104 134 136 -9 249 244 139 -9 142 194 156 184 250 126 184 246 194 119 140 246 205 182 158 162 259 181 123 338 176 186 195 178 160 198 143 240 194 144 188 155 237 155 176 133 216 196 265 247 131 126 139 133 150 153 169 198 204 128 204 238 204 121 216 224 145 370 183 173 -9 159 188 117 196 343 208 161 240 97 -9 255 230 112 -9 235 128 181 238 251 -9 145 179 109 273 183 176 131 196 149 155 117 210 191 142 146 163 320 209 151 237 190 187 169 260 152 -9 274 207 116 -9 155 180 297 229 187 258 155 260 224 260 191 245 181 263 108 263 104 258 216 265 96 292 319 -9 234 294 150 194 189 225 -9 178 270 239 178 189 278 260 180 201 -9 151 141 98 291 178 189 242 176 297 -9 303 230 129 121 244 157 314 155 245 162 174 154 204 212 260 186 216 266 209 174 226 168 292 143 235 266 138 320 269 199 229 164 132 168 368 199 193 189 229 160 292 186 187 294 303 140 176 160 -9 131 154 187 196 204 169 264 296 266 190 204 149 234 -9 197 260 139 249 282 193 104 258 200 194 242 159 137 115 145 417 163 196 245 231 209 217 176 119 260 264 121 -9 148 138 240 229 -9 204 151 308 202 185 199 118 121 201 121 237 183 129 358 301 199 180 304 209 212 206 177 205 180 142 254 227 227 263 201
1221 607 Daur China EAST_ASIA 128 128 144 129 164 234 140 124 188 106 130 118 148 225 260 233 147 167 220 194 187 145 245 132 218 204 190 140 139 207 183 184 158 167 100 172 126 173 -9 184 212 188 249 115 141 120 234 245 274 210 236 99 117 236 196 306 184 -9 95 241 195 136 138 116 166 159 263 234 94 132 263 113 -9 157 118 165 234 155 190 133 190 107 140 -9 214 246 247 145 178 166 200 156 190 247 141 196 246 200 119 156 254 209 206 162 174 267 189 131 334 176 190 203 184 164 206 151 244 202 140 192 155 -9 155 176 137 232 210 313 255 147 126 155 149 174 161 173 202 208 140 208 246 224 129 228 228 149 386 183 177 204 151 192 189 204 355 204 157 264 97 222 255 230 116 183 233 132 201 242 263 -9 157 191 117 281 187 176 131 200 157 163 117 214 195 154 150 171 324 219 151 249 194 187 177 256 152 237 278 211 112 248 155 180 301 269 175 258 155 260 220 276 199 245 193 267 108 267 100 266 220 269 108 296 -9 245 242 294 162 -9 209 245 290 164 274 239 182 189 278 268 200 213 164 159 149 98 287 198 193 246 180 305 237 307 214 129 137 244 157 -9 155 269 174 178 154 212 212 268 210 224 278 223 178 234 168 300 169 239 262 158 328 285 199 241 164 132 176 376 215 189 197 229 176 296 190 187 302 307 144 196 164 289 119 162 179 196 212 177 264 296 298 198 204 153 242 194 213 276 139 249 278 213 104 278 204 202 250 179 141 115 173 417 171 -9 257 239 211 221 176 131 260 272 129 292 -9 150 236 233 260 216 167 308 208 229 207 146 121 205 127 245 191 117 358 305 191 180 312 -9 216 210 181 213 188 146 262 231 231 267 225 
1221 607 Daur China EAST_ASIA 120 124 140 129 142 230 138 112 182 98 130 114 148 225 250 233 147 165 218 194 187 145 243 132 218 184 188 136 119 201 183 184 158 163 94 166 120 143 -9 180 208 188 258 115 141 105 231 236 271 210 221 96 117 227 196 288 184 -9 95 238 195 130 132 113 163 150 251 234 91 123 263 110 -9 151 112 165 228 140 187 130 190 98 140 -9 208 240 241 139 178 160 179 150 184 247 135 193 246 200 119 148 246 197 202 158 170 259 185 127 334 172 190 203 168 152 202 143 244 194 136 184 147 -9 151 172 137 216 210 273 251 147 118 155 133 170 157 169 198 204 128 204 238 224 121 224 228 145 370 179 173 200 147 192 157 192 351 204 145 244 97 218 255 230 116 175 225 132 197 238 255 -9 153 167 109 277 187 172 131 196 153 159 109 212 191 142 146 171 320 219 143 241 190 183 169 240 140 237 274 207 108 236 155 176 297 241 171 254 155 260 208 272 191 245 181 267 108 263 100 254 216 269 104 288 -9 245 230 290 150 -9 189 233 262 164 274 239 178 185 278 260 188 203 160 159 141 98 283 198 185 246 180 301 237 299 210 129 121 228 153 -9 155 257 166 174 150 208 208 268 202 220 274 209 170 230 168 300 161 235 262 134 320 257 199 237 160 132 176 376 203 185 197 213 164 292 182 183 298 307 140 188 152 273 119 158 163 196 208 177 248 292 270 198 188 149 234 190 205 276 135 245 278 197 104 266 204 194 242 159 141 111 149 413 167 -9 245 227 207 209 172 127 256 268 121 256 -9 142 232 233 256 204 159 304 200 225 203 134 117 201 125 233 181 117 330 281 191 180 308 -9 216 210 181 197 188 138 254 227 215 259 221 
1222 607 Daur China EAST_ASIA 126 116 144 137 164 234 142 124 188 98 142 120 148 -9 262 -9 171 165 218 194 187 145 243 136 226 184 188 154 119 207 185 180 162 165 110 184 126 147 172 180 212 191 249 124 147 132 237 242 271 207 239 105 138 239 199 297 184 116 95 241 198 136 141 122 163 156 251 246 91 126 -9 110 158 166 115 162 249 155 190 136 193 113 143 130 217 249 244 151 179 163 200 153 190 250 132 190 246 200 119 152 246 205 206 162 178 267 197 135 350 176 192 203 168 164 202 147 244 194 148 200 151 245 159 176 137 236 206 277 255 143 118 155 153 166 157 177 198 204 140 204 242 232 145 228 228 153 382 187 189 212 163 188 117 192 351 204 157 256 97 222 263 230 124 -9 239 140 197 242 -9 180 -9 183 117 281 195 180 131 196 157 143 113 210 191 146 154 171 320 219 159 249 194 199 173 248 144 245 274 211 116 -9 151 180 297 261 175 278 -9 260 220 276 195 257 185 263 112 267 108 258 216 265 100 288 327 241 242 306 162 190 229 241 -9 174 278 219 178 193 282 260 208 235 -9 -9 157 114 295 194 197 246 184 317 -9 311 222 133 129 244 169 326 167 253 170 182 154 216 220 264 214 228 282 213 182 238 180 304 169 -9 270 146 324 293 203 257 168 132 184 372 207 193 197 233 176 300 194 179 298 303 148 180 148 289 131 166 199 196 212 169 264 296 298 202 208 149 242 -9 205 276 143 253 282 205 120 270 184 186 246 167 145 111 161 409 167 204 245 235 205 213 176 131 260 272 121 292 156 154 240 229 -9 224 159 308 204 221 -9 138 119 201 129 -9 -9 117 366 297 203 180 320 265 216 206 181 205 184 150 262 235 231 267 225 
1222 607 Daur China EAST_ASIA 122 112 124 133 156 232 138 124 186 98 130 114 132 -9 256 -9 167 163 218 194 187 143 249 132 224 184 188 134 119 199 183 176 154 165 86 172 120 143 164 174 212 188 246 115 141 108 237 224 265 201 236 102 117 236 199 297 181 113 89 235 195 118 132 119 163 147 239 234 91 123 -9 110 155 157 109 162 240 137 190 130 187 110 128 130 205 243 227 151 179 157 194 150 184 247 126 181 246 200 119 148 246 201 202 158 174 267 189 131 322 168 190 199 168 152 202 143 240 194 144 188 143 233 159 172 133 200 196 265 251 135 118 139 133 166 153 165 194 204 128 204 238 212 129 228 228 145 370 187 169 204 163 184 117 188 347 204 153 240 97 214 259 230 120 -9 203 120 181 238 -9 180 -9 179 109 281 187 176 131 196 145 139 113 208 191 142 146 167 320 215 159 241 194 179 173 240 132 225 274 211 112 -9 151 176 289 257 175 254 -9 260 220 268 195 245 181 251 112 263 100 250 216 261 96 284 323 237 242 290 162 190 193 233 -9 168 270 239 178 185 274 260 192 219 -9 -9 149 98 287 178 189 242 180 297 -9 303 214 133 125 240 169 322 163 245 170 174 150 208 204 260 186 224 282 209 178 230 172 300 143 -9 262 146 316 289 199 225 164 136 176 368 199 185 189 229 172 296 194 175 294 303 136 176 144 289 119 162 187 192 208 165 264 296 274 194 188 149 242 -9 201 252 139 249 282 197 116 254 180 186 242 167 141 111 141 409 163 200 245 231 203 205 172 119 256 268 117 256 148 150 232 221 -9 216 151 304 202 185 -9 134 115 201 125 -9 -9 117 354 297 191 180 308 209 212 202 181 201 184 146 262 223 231 263 225 
1287 602 Han-NChina China EAST_ASIA 126 126 140 129 164 230 138 120 188 104 142 124 156 223 262 235 173 169 218 198 187 143 249 140 226 184 200 138 119 209 191 184 158 163 102 166 124 143 170 180 212 191 252 115 141 108 231 233 271 207 239 111 117 239 199 303 193 116 95 244 195 133 144 125 160 156 266 234 91 126 263 110 155 166 115 162 234 164 187 133 193 107 146 133 208 252 244 154 179 169 -9 150 190 250 132 190 246 200 119 152 246 197 202 166 162 267 185 131 342 176 198 207 188 164 198 151 248 194 144 196 151 237 167 176 133 224 210 277 255 151 126 151 160 158 161 173 198 204 144 208 242 236 145 228 232 153 382 187 177 200 159 192 157 204 355 208 157 240 119 218 255 238 120 187 233 128 193 242 267 192 153 -9 129 273 191 184 143 208 165 163 117 212 191 150 158 175 320 205 159 253 194 207 169 260 152 237 278 211 124 244 163 180 301 261 171 270 163 268 220 276 199 253 189 271 112 263 104 274 200 257 108 296 331 -9 242 302 162 198 213 241 306 168 278 235 182 189 278 264 196 219 160 163 157 108 291 194 189 250 184 309 241 311 230 129 129 244 177 326 163 253 170 182 158 212 216 268 206 224 278 223 174 234 184 308 173 263 262 158 320 285 203 261 168 128 172 372 211 193 197 233 172 304 186 187 298 303 144 188 148 289 131 162 187 -9 216 181 264 300 270 206 208 153 246 206 201 268 151 249 278 201 112 266 200 198 250 167 145 111 165 417 159 200 249 235 209 217 172 135 264 268 125 264 168 138 240 233 256 224 159 308 202 209 199 138 123 205 129 245 191 125 374 313 203 216 312 241 216 206 181 201 188 146 266 235 235 259 229 
1287 602 Han-NChina China EAST_ASIA 122 116 124 127 162 230 136 112 182 98 136 120 156 217 262 233 169 167 218 194 187 143 245 130 204 184 190 134 119 203 183 182 148 163 86 166 120 143 170 180 212 185 252 115 141 105 231 224 271 201 221 96 117 236 196 297 181 116 95 238 192 127 132 113 157 153 260 234 85 123 263 107 155 157 109 162 234 152 187 130 187 98 140 127 208 246 244 139 179 160 -9 150 184 247 129 190 246 200 119 140 246 193 202 162 162 267 181 127 334 168 192 199 168 160 198 147 244 190 140 188 151 229 159 172 133 216 206 277 251 135 122 151 133 154 157 165 198 204 128 204 242 228 137 216 224 149 378 183 177 200 155 188 149 200 355 204 145 240 115 214 255 230 120 183 225 120 177 238 259 188 145 -9 109 269 183 180 135 204 157 139 117 212 187 142 150 163 316 193 151 249 190 187 169 240 132 237 274 211 120 240 151 180 297 261 167 258 135 264 220 272 191 245 189 263 108 263 100 258 200 253 96 288 323 -9 234 294 158 190 169 237 290 164 274 239 178 189 278 256 184 215 156 155 141 98 287 186 189 246 164 309 237 299 222 129 125 224 153 326 155 249 162 178 154 204 212 260 190 224 274 213 174 226 180 304 169 239 262 138 316 285 199 233 168 128 172 368 203 185 197 209 164 292 170 179 294 299 132 180 144 269 119 154 159 -9 208 181 256 288 258 202 200 141 246 198 201 252 135 245 274 193 104 258 180 198 238 163 141 111 165 409 159 200 245 235 207 205 168 131 260 268 121 256 168 138 204 225 252 216 159 308 198 205 199 138 119 201 123 245 191 125 358 301 203 216 308 209 212 206 177 197 184 142 262 223 227 259 221 
1288 602 Han-NChina China EAST_ASIA 128 128 142 131 164 230 140 114 186 98 136 120 154 217 260 235 169 167 218 -9 187 143 249 136 230 186 204 134 139 201 191 176 158 171 100 172 130 143 170 174 212 194 249 115 141 108 234 224 271 210 236 111 138 -9 196 300 190 113 95 -9 195 136 144 116 163 147 263 246 91 126 266 110 161 157 109 165 234 155 205 133 187 119 143 139 208 252 244 148 182 166 -9 159 187 247 138 193 252 200 119 156 254 209 198 166 174 263 189 135 330 176 196 203 178 164 202 151 248 194 148 192 155 241 167 172 137 224 210 297 255 131 122 155 161 174 157 169 202 212 124 208 246 232 141 220 236 -9 382 187 181 204 155 192 165 192 367 204 161 244 119 214 251 234 116 183 231 136 201 242 259 192 153 183 129 269 195 176 131 200 157 147 121 214 191 142 154 175 324 223 155 245 198 183 181 256 148 245 278 211 120 244 167 180 -9 245 -9 270 155 264 228 276 191 253 185 263 108 267 108 282 224 265 104 304 323 245 234 -9 158 194 217 241 302 168 278 239 186 185 278 264 192 219 164 155 153 98 291 186 193 250 180 309 241 307 214 -9 129 252 165 326 159 261 174 182 158 208 224 260 202 224 286 223 182 230 168 304 143 239 270 138 324 293 207 233 168 128 176 376 207 193 197 237 176 308 -9 179 302 303 140 196 160 273 119 154 191 196 212 177 272 292 266 198 204 149 238 190 213 268 151 245 282 213 116 278 204 198 246 171 157 111 169 421 167 204 249 227 -9 221 184 131 260 276 129 292 160 138 244 233 264 224 167 308 196 217 207 138 121 201 129 229 191 129 370 297 207 216 320 265 216 206 181 205 188 146 270 235 235 267 221 
1288 602 Han-NChina China EAST_ASIA 122 116 124 129 162 230 140 112 180 98 130 114 152 217 258 229 165 165 218 -9 171 143 243 128 218 184 188 134 119 201 183 176 158 167 94 172 120 143 170 174 208 188 249 115 141 108 234 224 265 201 233 96 117 -9 196 297 187 113 95 -9 192 127 132 116 163 141 239 234 91 123 266 107 158 154 109 165 234 149 190 133 178 104 134 130 208 246 227 139 179 163 -9 150 184 235 126 187 246 197 119 152 246 193 194 162 170 255 185 127 314 172 194 191 174 152 198 147 236 190 144 184 151 237 167 172 133 200 200 273 247 131 122 155 149 170 153 161 194 208 120 204 242 232 137 212 236 -9 374 183 181 200 155 188 129 188 351 204 145 240 115 210 251 234 116 175 225 120 189 238 259 180 149 175 125 269 191 176 131 200 145 147 109 208 187 142 134 171 320 205 155 233 194 183 169 256 132 245 274 207 112 236 155 180 -9 245 -9 270 151 260 224 272 191 245 181 259 108 263 104 278 200 253 104 288 315 245 230 -9 150 182 185 233 282 164 270 243 182 177 270 260 188 209 164 155 153 98 283 182 189 230 160 297 229 303 210 -9 121 244 149 322 155 253 170 178 150 204 212 260 194 216 270 213 174 230 168 300 143 235 266 134 320 257 195 229 168 136 176 372 207 177 189 209 164 296 -9 175 298 303 136 188 152 265 119 150 163 196 184 169 260 288 258 190 188 149 234 190 209 256 139 245 278 201 116 254 180 198 242 163 141 111 145 405 163 200 249 227 -9 221 176 131 248 264 121 256 156 138 236 229 260 216 167 304 196 213 207 118 119 201 117 229 187 117 350 293 203 216 316 245 212 206 181 201 176 142 258 227 231 263 205 
1289 602 Han-NChina China EAST_ASIA 126 128 146 135 156 234 142 114 186 98 132 120 148 217 258 233 167 165 220 194 187 149 251 140 218 184 200 140 139 201 189 184 154 173 102 166 126 145 170 180 212 188 249 118 141 129 240 245 280 201 242 96 117 -9 205 291 190 113 98 -9 198 121 138 119 163 147 251 249 91 132 266 113 158 166 112 165 234 155 187 136 190 104 143 133 217 237 247 151 179 169 -9 159 184 247 135 196 252 200 119 144 246 205 202 158 174 263 189 131 342 176 200 203 178 160 206 151 248 194 148 -9 155 241 163 172 145 212 210 277 259 151 122 159 -9 170 157 173 202 216 140 204 258 232 141 228 228 153 374 191 193 204 -9 188 189 204 363 208 145 244 119 218 267 234 120 -9 237 132 185 246 -9 192 149 183 133 277 187 176 147 200 161 147 125 212 195 150 146 171 324 235 155 249 194 199 173 240 148 245 274 227 120 -9 159 180 293 241 187 274 151 264 220 272 199 245 193 -9 108 267 108 270 208 265 104 304 323 249 230 302 174 194 241 233 270 168 274 227 194 185 286 260 184 -9 168 -9 141 106 287 202 193 250 184 305 245 303 222 129 121 252 173 326 -9 253 174 174 158 212 208 260 198 224 270 209 174 230 176 304 169 251 266 150 -9 289 203 257 168 132 180 372 219 193 197 233 192 300 190 183 302 303 144 192 148 273 131 158 187 196 208 181 272 304 282 202 204 149 246 202 213 264 -9 249 282 197 120 278 204 190 246 171 157 115 165 421 167 204 257 231 207 209 176 131 268 264 129 284 160 150 248 233 260 220 167 312 200 185 -9 138 119 205 125 253 -9 129 338 297 191 184 312 241 216 202 177 213 184 146 262 231 231 263 221 
1289 602 Han-NChina China EAST_ASIA 126 126 142 129 142 230 140 112 180 98 132 114 148 217 250 229 165 165 218 194 187 143 247 136 216 184 188 134 119 201 187 176 154 163 102 166 120 143 170 174 212 185 249 115 141 105 231 224 277 195 239 96 117 -9 196 288 184 113 98 -9 195 118 132 116 163 147 239 234 88 126 260 113 152 154 112 165 234 155 187 133 187 104 134 130 208 237 244 139 179 166 -9 150 184 235 126 187 246 200 119 140 246 193 198 158 170 259 181 123 330 168 196 199 168 152 186 135 236 194 144 -9 155 233 155 172 137 208 210 273 259 143 122 155 -9 150 149 165 194 208 124 204 246 228 121 216 228 149 370 187 177 200 -9 184 161 184 355 208 133 240 111 214 259 234 120 -9 225 132 177 242 -9 188 145 175 109 269 183 172 131 196 149 139 105 208 191 142 138 167 320 199 155 241 194 187 169 240 132 225 270 207 116 -9 151 180 293 241 175 258 139 260 220 268 199 241 189 -9 104 259 104 258 200 261 100 288 323 237 230 302 162 190 185 229 266 160 266 239 186 181 278 256 180 -9 160 -9 141 106 287 194 189 250 180 301 241 287 218 125 117 240 153 326 -9 241 170 174 154 200 208 260 190 220 266 209 170 226 168 300 157 239 266 138 -9 257 195 245 156 132 176 368 211 181 189 209 164 296 182 175 302 303 136 176 148 269 127 154 183 188 192 177 264 300 262 202 204 141 238 186 209 252 -9 249 262 197 100 266 180 186 242 163 141 111 141 417 159 200 253 227 207 209 176 131 260 264 125 256 148 142 240 229 260 204 159 304 196 185 -9 118 119 205 123 245 -9 117 334 297 191 180 304 209 212 202 173 201 180 146 262 223 231 255 205 
1290 602 Han-NChina China EAST_ASIA 126 130 142 129 156 236 140 112 188 -9 132 120 148 223 258 233 175 171 218 194 187 143 249 136 204 184 192 138 137 209 174 180 162 167 104 166 124 143 172 180 212 185 252 115 -9 129 234 242 274 204 236 117 132 -9 199 309 190 116 98 241 195 136 132 125 163 150 266 237 88 135 266 116 161 157 112 165 234 152 190 130 187 110 146 130 217 252 247 142 181 166 194 156 193 235 -9 193 252 200 119 156 246 201 166 158 170 263 209 123 338 176 194 203 198 160 210 155 248 210 152 -9 159 241 -9 180 145 228 210 321 255 151 122 163 153 170 157 169 202 204 144 204 242 228 141 228 232 149 390 187 173 204 -9 188 157 208 351 216 153 244 123 222 259 230 120 -9 239 140 213 238 -9 188 -9 199 109 273 195 172 143 204 157 147 113 208 191 142 150 171 320 215 159 241 190 195 169 244 144 245 278 215 116 -9 155 180 297 265 187 270 151 272 224 276 191 253 189 -9 108 263 104 278 216 265 104 304 327 245 234 302 162 198 245 233 298 168 274 239 178 193 282 260 200 -9 164 155 161 108 287 198 193 254 180 305 -9 311 214 133 125 248 169 322 -9 257 174 182 154 212 208 272 202 220 282 227 186 230 180 308 173 259 270 146 324 -9 203 241 168 136 176 368 207 185 197 213 164 296 -9 191 294 303 144 196 156 265 135 158 195 196 184 169 272 324 286 202 188 157 250 198 -9 268 151 253 282 213 116 282 208 194 242 171 153 111 149 429 167 204 245 243 207 209 180 131 268 272 125 288 168 134 196 233 260 224 167 308 202 -9 203 146 123 203 125 245 191 125 366 297 203 180 312 265 216 206 181 209 188 146 266 231 231 271 205 
1290 602 Han-NChina China EAST_ASIA 120 128 124 129 142 230 138 112 182 -9 130 114 148 221 258 229 169 165 218 194 187 143 245 132 204 184 188 138 119 201 174 176 160 165 100 166 120 143 170 180 208 182 246 115 -9 108 231 242 271 201 221 96 120 -9 196 300 187 116 86 238 192 136 132 119 157 147 263 234 88 123 263 110 158 151 112 159 234 152 190 130 178 104 140 127 205 252 247 136 179 163 194 150 184 235 -9 187 249 197 119 148 246 201 194 158 170 263 201 123 326 168 178 199 168 152 202 143 240 194 144 -9 151 233 -9 172 141 208 206 265 255 131 118 151 133 150 157 165 198 204 124 204 238 228 137 228 228 149 382 187 165 204 -9 188 117 204 347 212 141 244 115 210 255 230 120 -9 231 128 201 238 -9 180 -9 175 109 269 187 172 131 196 149 143 113 204 187 142 146 171 320 209 151 233 190 179 169 244 140 245 274 207 112 -9 151 180 297 237 167 262 151 268 216 276 191 249 181 -9 104 263 104 258 204 261 96 304 315 233 230 294 162 194 193 233 286 164 274 239 174 185 278 260 188 -9 156 151 141 102 287 178 193 250 180 301 -9 307 214 125 125 224 153 322 -9 241 166 170 150 204 204 264 198 216 270 215 170 226 180 304 169 235 266 142 312 -9 203 237 160 136 176 364 203 185 189 209 164 296 -9 187 294 303 132 192 148 261 131 154 191 192 184 165 268 292 270 202 188 141 246 186 -9 256 135 249 274 193 112 270 196 190 242 167 145 111 141 421 159 204 245 235 207 209 172 115 260 268 125 256 156 134 196 233 260 224 159 304 200 -9 203 134 111 201 121 245 191 117 354 289 191 180 312 241 216 198 177 209 188 138 258 231 231 263 201 
1291 602 Han-NChina China EAST_ASIA 126 126 146 137 156 234 140 124 188 106 136 120 158 225 260 233 173 163 218 194 -9 147 247 140 230 184 200 134 139 201 183 184 162 163 94 172 -9 173 170 180 212 185 252 118 141 108 234 245 271 210 239 96 126 -9 199 306 190 113 89 241 195 136 144 -9 163 -9 266 234 79 123 266 116 158 157 118 165 234 152 190 133 193 119 146 139 208 240 241 148 179 166 -9 150 190 247 144 190 246 200 125 148 246 201 202 158 170 267 185 131 346 176 194 207 178 152 198 147 244 198 144 -9 151 241 167 176 149 208 208 273 251 151 122 155 153 174 157 173 202 200 128 204 246 -9 141 228 232 149 382 183 177 208 -9 200 197 204 351 204 149 256 119 218 267 238 120 -9 -9 136 -9 242 -9 188 -9 187 113 281 187 184 131 -9 157 147 113 212 195 154 150 175 324 209 159 237 -9 199 173 256 144 237 274 227 112 244 151 180 -9 269 187 274 -9 264 220 284 199 253 189 -9 112 -9 108 278 204 269 100 296 327 245 242 306 162 202 213 233 282 174 270 -9 178 189 282 272 208 -9 164 159 161 -9 287 182 193 250 184 -9 -9 307 222 133 125 244 177 322 -9 249 170 182 158 212 220 272 202 224 278 223 174 234 180 308 169 259 266 154 320 289 203 257 -9 -9 184 372 215 197 189 229 184 292 190 191 302 299 144 196 168 289 119 154 195 192 212 177 268 300 -9 202 204 153 242 -9 213 268 139 245 266 209 116 282 200 198 242 179 161 115 145 425 167 200 -9 239 -9 209 184 139 252 272 125 268 168 150 248 225 260 208 159 308 210 221 203 146 121 205 125 241 -9 129 350 297 203 180 316 265 212 202 -9 -9 184 146 262 235 231 267 -9 
1291 602 Han-NChina China EAST_ASIA 124 116 142 129 156 234 138 112 180 102 130 120 148 217 250 233 147 167 218 194 -9 145 243 136 224 184 192 134 119 199 183 184 154 163 86 166 -9 143 164 180 212 185 249 115 141 108 231 239 268 210 236 96 126 -9 199 297 184 113 86 241 192 121 132 -9 163 -9 263 234 79 120 260 110 155 151 112 165 234 140 187 133 190 107 140 136 202 240 227 139 179 160 -9 150 190 235 138 187 246 197 113 140 246 201 198 158 162 255 177 123 342 168 190 203 168 152 198 147 244 198 144 -9 147 233 159 172 141 208 200 269 251 143 122 151 153 170 157 161 198 196 120 204 242 -9 133 228 228 145 374 183 173 204 -9 188 149 192 351 204 145 240 103 214 263 230 112 -9 -9 132 -9 238 -9 172 -9 179 109 281 187 180 131 -9 153 143 109 212 187 142 146 171 320 195 159 233 -9 195 169 240 144 225 274 207 112 244 151 176 -9 241 175 270 -9 260 220 272 199 241 185 -9 108 -9 104 258 200 257 96 292 319 241 230 294 158 190 189 229 274 164 266 -9 178 177 282 264 184 -9 160 155 141 -9 287 182 181 242 184 -9 -9 303 214 129 121 244 169 322 -9 245 166 182 158 208 220 264 198 220 266 213 174 230 172 296 157 239 266 154 320 289 203 233 -9 -9 176 368 203 185 189 209 164 292 178 187 298 299 140 176 148 265 119 150 171 188 192 169 268 296 -9 194 188 149 242 -9 205 264 135 241 262 197 100 262 180 194 242 167 153 111 141 417 163 200 -9 235 -9 201 172 119 248 272 117 256 168 138 244 221 260 204 159 304 196 209 199 138 117 203 121 233 -9 129 342 293 203 180 312 233 212 202 -9 -9 184 146 254 227 231 263 -9
1292 602 Han-NChina China EAST_ASIA 128 128 146 135 156 234 142 122 182 98 130 120 148 225 260 233 167 167 218 194 -9 143 249 136 228 184 200 138 119 207 183 182 158 163 104 172 120 147 174 180 212 188 252 115 144 126 237 245 271 210 242 108 135 239 196 309 190 113 95 250 192 136 144 119 166 153 263 246 91 126 266 110 158 157 112 165 234 158 202 130 193 107 143 136 208 249 244 139 179 166 179 150 184 253 132 190 252 200 125 148 254 197 206 158 174 259 189 127 342 172 192 207 180 160 202 147 248 198 144 200 155 237 159 176 141 228 210 273 255 155 126 151 157 170 157 -9 210 216 140 212 250 236 121 228 240 145 378 183 197 204 163 192 185 192 355 212 161 240 111 218 263 234 116 183 241 136 205 242 255 188 145 183 129 273 195 176 135 200 161 151 117 212 195 142 146 175 320 -9 159 245 190 207 173 256 144 245 274 231 120 240 155 184 293 261 175 -9 155 264 216 276 187 249 189 271 108 267 -9 -9 220 269 112 300 327 241 238 306 166 198 213 233 294 172 278 223 186 185 274 260 204 223 156 163 157 98 287 182 185 -9 180 -9 -9 311 218 133 133 248 165 330 167 253 166 178 158 212 220 264 206 232 282 221 178 234 180 304 161 235 266 158 320 289 207 237 160 132 180 372 211 205 197 229 172 304 186 183 306 303 148 176 160 289 131 154 179 192 196 173 268 300 290 206 200 149 242 210 209 276 139 253 278 197 112 270 204 206 242 179 161 111 165 417 167 200 257 235 207 213 176 139 260 264 121 256 164 138 248 233 260 208 167 304 202 217 203 146 121 205 127 237 183 117 362 305 203 204 316 269 220 206 181 209 192 146 246 239 239 263 221 
1292 602 Han-NChina China EAST_ASIA 124 128 144 125 142 230 140 120 182 98 130 120 148 217 258 229 147 167 218 194 -9 143 249 136 218 174 188 134 119 203 183 176 158 163 96 166 120 145 170 174 208 188 249 115 141 105 225 224 271 210 221 96 126 239 196 288 187 104 89 241 192 121 132 113 157 150 251 234 88 123 257 107 152 151 109 162 234 140 199 127 190 104 140 121 202 246 230 139 179 163 179 150 184 238 132 181 246 200 119 140 246 197 202 158 162 259 181 123 326 172 188 199 172 160 198 143 244 194 140 176 151 229 151 172 141 220 204 273 255 147 126 151 153 170 153 -9 202 204 136 204 238 228 121 224 236 145 374 183 181 204 151 192 153 184 351 204 137 240 111 218 255 216 112 167 225 120 177 242 255 188 145 179 109 269 187 176 131 196 149 151 117 212 191 142 146 171 308 -9 143 237 182 183 169 240 132 225 266 223 108 236 155 180 293 241 171 -9 147 260 208 268 187 241 185 267 108 263 -9 -9 208 261 100 296 319 241 234 286 158 190 213 233 266 168 270 231 178 173 274 260 192 223 152 159 141 98 287 178 185 -9 180 -9 -9 299 210 133 129 224 153 322 159 253 162 174 150 208 212 264 194 224 278 213 170 230 176 304 161 235 266 146 312 269 207 233 148 136 176 372 203 185 193 229 164 300 170 183 294 303 144 176 152 269 119 150 163 192 192 173 260 296 270 194 188 141 238 190 209 256 132 249 262 197 100 254 204 202 228 167 149 111 149 409 167 200 249 235 207 201 176 115 252 264 121 256 156 138 236 233 256 204 159 304 192 185 199 134 119 199 125 233 181 117 334 293 203 180 312 209 216 198 177 205 192 146 246 231 235 255 209 
1293 602 Han-NChina China EAST_ASIA 126 128 126 129 168 230 140 118 186 102 138 120 156 223 258 235 169 167 220 194 187 143 251 136 228 196 204 138 119 207 191 182 154 173 110 172 126 143 170 180 212 188 249 115 141 108 234 245 274 210 236 111 117 236 199 312 184 113 86 241 195 130 138 113 166 -9 263 234 91 132 260 113 155 157 121 168 234 140 187 130 184 110 140 136 214 249 244 148 179 160 203 165 199 238 141 187 249 200 125 152 246 201 202 166 174 255 185 135 346 172 194 207 202 152 198 147 244 198 144 184 155 237 163 176 141 208 210 -9 255 155 126 159 159 170 153 177 202 208 128 212 242 240 133 228 232 145 394 187 177 204 159 196 157 192 359 208 157 264 111 222 267 234 120 183 251 136 209 242 259 188 149 179 113 281 191 184 139 196 165 151 117 212 187 150 142 171 320 231 155 245 190 195 177 248 152 245 274 215 112 248 163 180 297 257 171 -9 -9 272 224 276 195 249 181 259 112 263 112 282 216 269 108 300 319 245 246 302 166 206 -9 233 298 170 274 239 186 189 286 264 204 211 168 159 149 -9 287 194 193 246 180 309 -9 319 226 129 129 252 169 326 163 253 170 178 154 216 216 260 206 224 282 213 190 -9 180 292 173 239 262 146 328 289 207 241 168 128 180 380 203 197 193 209 176 304 190 187 298 307 140 200 164 289 123 158 179 192 216 173 272 -9 -9 202 204 149 242 -9 209 272 139 249 282 213 116 270 204 194 242 179 157 115 141 425 163 204 245 255 213 213 180 131 260 272 125 264 164 138 244 237 260 216 159 304 200 217 207 138 121 201 129 253 -9 129 366 301 203 216 316 245 216 206 181 213 184 150 262 231 235 267 221 
1293 602 Han-NChina China EAST_ASIA 122 128 124 127 164 230 138 108 180 98 130 118 154 217 250 229 167 165 218 194 187 143 249 132 218 184 190 138 119 203 189 180 154 167 94 172 120 143 166 174 208 185 246 115 141 108 228 242 271 201 230 105 117 236 196 294 184 113 86 241 192 121 138 113 163 -9 257 234 91 123 260 113 155 157 115 165 234 140 187 127 178 104 134 133 202 246 235 139 179 160 179 156 190 235 129 187 246 200 119 140 246 197 194 158 170 251 181 131 322 164 190 195 184 152 186 143 236 194 140 172 155 233 155 172 137 208 210 -9 255 151 126 139 133 166 149 169 198 200 128 204 234 224 121 224 224 145 378 183 177 200 147 192 153 184 347 204 153 252 97 214 267 230 120 183 245 128 177 242 259 188 149 175 113 277 187 176 131 196 157 143 109 212 183 142 134 171 320 209 151 233 190 187 173 240 144 225 270 207 108 240 155 180 297 257 171 -9 -9 268 220 272 175 241 181 255 112 263 112 266 212 265 108 296 315 241 234 302 158 194 -9 233 282 160 262 239 174 185 286 260 196 207 168 151 141 -9 287 186 185 246 164 309 -9 303 210 129 125 224 149 326 163 245 166 170 154 208 212 256 206 220 282 209 174 -9 168 292 143 239 262 142 316 285 203 217 168 128 176 372 203 189 193 209 172 292 186 183 290 303 136 196 148 269 119 150 167 188 208 165 264 -9 -9 202 196 141 234 -9 197 256 139 249 278 201 116 254 200 194 242 167 141 111 141 417 163 200 245 235 209 201 180 131 252 272 121 256 164 134 204 221 260 216 151 304 196 185 199 118 121 201 121 245 -9 117 350 297 203 180 312 233 212 198 177 201 180 146 250 223 235 243 221 
1294 602 Han-NChina China EAST_ASIA 128 126 146 135 164 230 142 120 182 98 142 122 148 217 262 233 173 167 222 198 187 143 249 140 228 184 188 134 139 207 191 188 154 167 106 166 126 175 172 184 212 191 249 115 144 108 234 242 274 207 239 111 132 236 196 297 190 113 95 241 195 136 144 119 166 153 263 246 94 129 260 119 158 157 112 165 234 155 190 136 193 104 143 130 214 249 241 148 178 166 203 156 193 250 144 187 246 200 125 148 254 205 206 162 174 255 189 127 342 176 192 203 172 160 202 147 244 202 140 196 151 245 155 176 141 220 210 305 255 151 130 163 153 174 161 165 218 212 128 216 242 240 141 228 240 149 386 183 189 204 163 192 169 204 359 212 149 240 115 222 267 234 120 183 235 124 201 242 255 172 -9 183 117 281 195 180 135 200 157 163 117 212 191 158 146 171 320 213 155 237 198 199 169 240 152 249 278 207 120 240 163 188 297 245 175 274 159 268 224 276 191 253 189 271 108 263 108 270 208 265 104 300 327 245 246 306 166 206 193 237 278 164 278 235 190 189 278 264 204 231 164 159 141 106 295 198 193 250 180 309 241 315 222 133 133 244 165 322 163 257 170 178 162 208 216 260 202 220 282 223 174 234 172 304 169 239 262 150 320 293 207 241 168 132 180 376 203 193 197 233 168 300 182 187 306 303 144 176 164 273 127 158 187 192 204 177 264 296 294 202 204 153 254 198 213 272 139 249 278 197 120 274 200 202 246 167 149 111 145 405 167 204 261 231 211 217 176 119 268 272 129 284 164 150 244 233 256 216 159 308 202 233 199 138 119 201 131 249 187 129 346 297 203 180 312 265 216 206 181 221 184 146 266 247 235 259 225 
1294 602 Han-NChina China EAST_ASIA 126 116 142 129 142 230 138 112 180 98 132 120 148 213 250 233 173 165 218 194 185 143 247 132 204 184 188 134 119 201 187 178 154 163 94 166 120 147 170 180 208 188 249 115 141 108 234 224 265 201 221 96 117 224 196 297 190 104 89 241 192 121 132 113 160 150 239 234 85 126 257 110 155 151 109 165 234 152 190 130 178 104 140 130 208 243 227 139 176 157 194 150 190 235 126 181 246 197 119 140 254 197 206 158 170 255 189 123 330 172 190 203 168 156 202 143 244 194 140 192 147 237 151 172 137 204 196 269 251 131 126 155 133 150 157 161 198 204 124 204 238 204 121 228 228 145 382 183 173 204 147 192 117 196 351 204 141 240 115 214 263 230 112 175 225 120 193 234 251 172 -9 179 109 269 191 176 131 196 157 143 117 210 187 142 138 159 312 211 155 229 198 183 165 240 144 245 274 207 116 236 155 184 293 241 175 274 151 260 220 276 191 245 185 263 108 263 104 266 200 257 100 292 323 241 230 290 166 194 193 237 278 162 274 239 182 189 278 260 184 215 148 147 137 98 291 182 177 246 180 305 241 295 214 129 125 244 161 314 155 253 170 174 150 204 212 256 198 220 282 209 170 230 168 292 169 239 262 146 316 257 199 241 164 132 176 368 203 185 189 225 164 296 170 175 302 303 140 176 152 261 123 154 187 192 192 177 264 292 266 194 200 141 246 194 209 272 135 249 278 193 104 254 180 198 228 159 145 111 141 405 163 204 249 223 203 213 172 115 268 272 121 264 152 142 236 233 256 208 159 304 196 185 195 118 117 199 121 245 181 129 346 293 191 180 304 241 216 198 177 209 180 146 254 231 231 259 225 
1295 602 Han-NChina China EAST_ASIA 128 128 124 133 158 236 140 122 188 98 130 114 150 217 260 233 173 167 222 194 187 147 255 142 230 200 192 152 119 209 183 180 158 167 110 166 134 147 170 184 212 188 249 115 141 105 234 245 271 201 236 111 132 236 196 291 187 116 95 256 195 124 132 113 160 147 263 246 94 132 263 110 158 157 112 165 240 152 190 136 178 116 146 133 214 252 244 139 -9 166 194 156 184 253 135 187 252 200 125 152 246 209 202 158 162 267 193 127 334 176 198 207 -9 164 206 147 240 198 144 196 159 233 159 176 141 224 210 277 255 147 122 155 152 170 157 177 206 208 128 212 242 228 141 228 232 149 382 187 189 208 151 188 157 204 355 208 153 244 123 222 255 238 120 -9 239 132 193 246 255 192 149 183 113 277 191 184 135 196 165 159 117 214 195 142 150 175 324 227 159 245 198 199 173 256 152 237 278 227 120 -9 155 184 297 261 187 278 159 264 220 276 207 253 185 255 108 267 108 266 208 265 104 304 331 245 230 298 154 210 193 257 278 168 270 239 182 189 290 264 192 215 164 159 153 98 287 202 193 250 188 309 241 311 222 137 125 248 165 326 167 257 174 186 158 208 216 264 210 216 282 223 198 230 180 308 173 255 266 142 324 285 203 229 168 128 184 380 203 189 197 233 196 300 182 191 302 307 144 192 148 289 131 162 195 196 212 177 272 300 266 202 188 153 242 210 213 284 143 253 282 201 120 274 204 198 246 183 157 115 161 409 163 204 253 235 213 225 172 131 268 272 133 268 168 122 196 233 256 216 167 308 200 217 203 146 121 201 133 249 191 117 346 293 203 204 312 273 224 210 181 205 188 150 258 231 231 263 233 
1295 602 Han-NChina China EAST_ASIA 124 128 124 127 144 234 138 120 182 98 130 114 148 217 258 233 173 165 214 194 187 143 245 136 226 184 188 138 119 199 176 178 158 163 104 166 120 143 164 174 208 188 246 115 141 105 234 239 268 201 221 96 117 218 196 288 181 113 95 241 192 118 132 113 157 147 251 246 94 132 260 104 158 157 109 165 234 140 190 130 178 98 140 130 208 240 227 139 -9 160 179 156 184 250 132 187 249 197 119 148 246 205 202 158 162 259 185 123 330 172 192 203 -9 160 206 139 236 194 144 196 151 233 155 168 133 216 206 273 255 131 118 155 149 150 153 173 202 204 124 204 238 224 121 216 228 145 374 183 177 204 147 188 157 188 347 204 141 240 111 214 255 230 116 -9 235 120 181 238 251 172 149 175 109 277 187 180 131 192 153 155 109 212 195 142 146 171 320 199 155 241 198 191 173 256 132 229 274 227 116 -9 155 176 297 241 171 254 147 264 220 264 191 245 185 247 104 263 104 258 204 257 96 300 319 241 230 282 150 170 193 233 266 168 270 243 178 177 278 260 184 211 156 155 137 98 283 186 193 250 180 301 237 307 210 129 121 244 153 322 155 237 170 182 154 204 208 260 190 216 278 209 178 226 176 304 173 239 262 138 320 285 199 229 160 136 180 376 203 185 193 225 168 296 178 187 294 303 144 176 148 265 119 154 195 192 196 169 260 296 266 202 184 149 234 190 209 252 143 249 274 193 116 254 180 198 242 171 149 111 149 409 159 200 249 227 207 221 168 115 260 268 125 256 160 122 196 221 252 216 151 304 198 185 203 142 117 199 125 233 191 117 334 285 203 180 308 269 216 202 173 201 188 142 246 223 231 263 205 
1296 602 Han-NChina China EAST_ASIA 126 128 146 129 166 230 142 118 182 98 132 120 148 217 258 235 169 165 224 194 187 149 249 138 228 184 200 134 119 209 189 184 158 167 110 166 126 175 172 180 212 188 249 118 141 -9 234 245 271 195 242 111 117 230 205 297 187 116 95 241 -9 133 141 122 163 156 251 246 91 123 263 116 158 166 112 165 -9 158 190 130 -9 110 -9 136 211 240 247 148 182 163 179 150 190 247 129 181 246 200 125 152 254 201 206 158 170 259 201 127 334 172 200 207 178 160 206 147 240 194 144 196 155 237 155 172 145 240 206 313 251 147 126 159 153 170 157 173 210 212 128 208 242 240 141 228 232 153 386 183 197 204 151 204 185 196 359 212 161 264 119 218 267 238 120 187 237 128 209 238 -9 188 -9 179 117 277 191 180 131 200 157 163 121 212 191 162 150 171 324 225 159 245 190 199 169 -9 152 245 278 211 124 248 159 184 301 257 175 270 -9 268 220 272 203 253 185 263 116 271 104 278 212 269 100 296 319 -9 242 298 166 190 193 237 290 172 274 215 178 177 278 276 192 219 156 163 157 110 287 198 193 250 184 309 -9 303 230 137 129 240 157 326 163 261 170 178 154 212 216 276 202 224 278 223 178 238 176 304 173 259 266 146 324 293 199 225 164 136 172 380 207 193 197 229 172 296 186 195 302 299 144 176 164 -9 119 158 207 196 212 181 264 304 266 198 208 149 246 198 209 256 143 249 282 197 116 278 204 198 246 179 149 111 145 405 171 200 249 243 209 221 168 131 252 272 125 -9 160 150 244 233 260 -9 151 312 202 213 211 138 121 205 123 241 -9 121 358 301 203 216 312 265 216 206 181 213 180 146 262 235 235 255 241 
1296 602 Han-NChina China EAST_ASIA 126 116 142 129 158 230 140 112 180 98 130 120 146 217 250 229 147 165 218 194 187 147 243 136 226 184 188 134 119 207 183 180 148 161 96 166 120 145 170 180 212 185 249 115 141 -9 231 236 271 195 221 111 117 224 196 297 184 104 95 241 -9 118 132 113 157 144 251 237 91 123 257 110 152 157 112 165 -9 155 190 127 -9 104 -9 133 205 237 235 139 182 160 167 150 184 235 126 181 246 200 116 152 246 201 194 158 170 255 189 127 334 164 194 191 168 156 198 139 240 190 144 172 155 233 155 172 137 216 200 273 251 139 122 155 133 150 145 173 198 212 120 204 238 208 133 212 224 149 386 183 177 200 147 188 157 196 351 212 141 252 115 214 259 230 112 183 225 120 205 238 -9 172 -9 171 109 273 187 180 131 200 153 147 109 208 183 142 138 171 320 209 155 245 190 183 165 -9 144 237 274 207 120 248 155 180 297 245 171 254 -9 264 216 268 195 253 181 263 112 267 104 258 200 257 96 296 319 -9 230 290 150 190 181 233 278 168 274 239 178 173 274 256 188 215 152 159 149 98 283 182 193 242 184 301 -9 303 218 133 125 236 153 318 163 237 166 174 154 208 208 260 202 220 278 209 174 230 172 300 161 239 266 146 324 285 199 225 160 136 172 376 207 193 193 229 172 292 182 183 298 299 144 176 152 -9 119 158 187 192 184 173 264 300 266 190 196 141 242 198 201 252 135 249 278 193 108 270 180 182 242 175 141 111 141 405 159 200 245 227 207 217 164 131 252 256 125 -9 156 138 232 229 256 -9 151 308 200 185 203 118 111 201 121 229 -9 117 346 281 191 180 312 209 208 202 177 205 180 146 258 231 231 255 225 
774 601 Han China EAST_ASIA 126 116 140 135 154 230 142 124 188 98 130 120 148 223 262 235 173 167 218 194 193 149 249 136 228 184 188 134 119 207 183 180 158 175 100 166 120 145 170 180 212 188 249 115 141 120 237 242 271 210 233 111 138 242 199 291 190 116 89 241 192 136 144 116 163 150 263 234 91 132 266 113 155 157 115 165 234 152 -9 136 178 110 146 133 208 252 235 145 182 169 197 156 190 247 135 193 252 200 119 152 246 205 202 158 174 263 189 139 330 176 196 203 182 160 206 147 244 198 148 188 155 237 155 176 141 224 210 273 255 151 122 159 153 182 145 173 210 212 140 208 250 232 141 228 228 149 378 183 189 208 167 192 189 196 371 208 157 260 115 222 267 234 120 187 237 128 219 242 259 192 149 183 113 281 191 184 131 204 157 151 117 208 195 142 138 163 320 223 163 245 190 183 177 260 152 237 278 223 124 248 155 188 297 257 175 270 163 260 224 276 191 249 189 267 112 267 108 286 220 269 96 300 319 241 246 298 162 194 -9 233 286 178 278 239 190 185 282 260 188 215 168 159 153 100 291 198 197 250 180 313 237 303 218 133 121 252 169 326 167 245 174 178 158 212 216 260 198 224 286 209 174 230 180 308 173 255 266 154 320 289 203 265 168 128 184 376 211 201 205 225 184 300 170 183 294 307 144 196 160 289 131 162 203 196 212 173 264 300 266 202 208 153 242 198 217 256 147 253 290 213 112 282 204 198 246 163 161 115 141 421 171 204 249 243 203 221 172 115 268 272 129 288 164 150 236 233 256 224 159 304 202 213 199 142 123 205 125 245 181 117 354 301 191 180 -9 265 216 210 177 217 188 146 266 239 227 275 221 
774 601 Han China EAST_ASIA 126 116 122 129 144 230 140 120 188 98 130 120 148 217 250 229 147 165 214 194 187 145 243 132 204 184 188 134 119 207 183 176 158 173 94 166 120 143 170 180 208 188 249 115 141 105 231 236 265 201 221 96 126 233 196 288 187 116 89 241 192 133 132 113 157 147 251 234 88 123 260 110 155 151 112 162 234 146 -9 118 178 98 134 133 205 249 227 133 178 163 179 156 184 235 126 193 249 197 119 152 246 201 198 158 170 259 189 127 326 172 194 199 174 152 186 147 240 194 144 180 155 233 151 164 137 216 206 265 251 151 118 159 133 170 145 165 202 196 128 204 242 228 137 228 228 149 370 179 181 204 159 188 153 184 363 208 153 244 111 218 263 230 116 167 229 120 173 238 255 188 129 183 109 277 187 176 131 200 153 143 113 208 191 138 134 159 316 201 147 233 190 179 169 256 148 233 274 207 108 248 151 180 293 245 171 258 155 260 220 272 179 237 185 263 104 263 104 274 200 261 96 292 319 233 234 282 154 170 -9 229 270 164 278 239 178 185 282 256 188 203 164 159 153 98 291 194 181 242 176 305 237 299 214 129 121 236 169 318 163 245 162 170 154 208 212 256 190 220 270 209 174 230 168 304 157 235 262 154 316 285 199 233 164 132 176 368 203 185 189 209 160 296 170 187 294 303 144 176 152 261 123 154 195 192 208 165 264 296 258 194 188 141 238 186 205 252 135 245 282 201 100 270 180 178 242 163 157 111 141 409 167 200 245 231 199 201 168 115 252 268 121 264 156 138 236 217 256 220 159 304 192 209 195 138 121 195 125 241 181 117 338 289 191 180 -9 209 216 206 177 209 180 142 266 231 227 255 221 
775 601 Han China EAST_ASIA 126 124 144 139 158 230 140 120 188 102 130 120 156 217 -9 233 165 167 218 194 187 143 255 140 226 184 204 134 119 207 183 182 158 -9 94 174 130 147 170 180 212 188 -9 115 141 105 234 245 274 210 221 111 126 239 199 294 190 113 95 250 198 130 144 116 163 156 269 234 94 132 269 110 158 157 112 168 -9 152 190 130 193 110 134 139 208 252 -9 139 185 160 194 156 -9 250 126 190 246 200 119 152 246 201 198 162 170 259 -9 131 342 176 196 207 -9 168 202 143 240 198 144 196 155 241 163 172 145 228 218 273 259 151 122 159 153 174 157 173 198 208 128 204 246 236 149 228 232 153 374 187 173 204 159 192 157 204 355 212 165 240 115 222 259 238 112 183 235 136 181 242 259 192 149 199 109 281 195 184 131 200 157 151 121 212 191 158 150 175 316 227 159 245 190 199 173 256 148 225 274 211 112 244 155 184 301 257 171 274 155 268 220 276 187 249 185 275 112 267 116 270 212 265 104 296 -9 241 242 294 158 202 189 237 286 168 274 239 178 189 286 264 196 219 164 159 157 110 291 182 197 254 180 305 249 303 214 133 129 252 173 326 167 257 170 170 158 208 216 260 206 216 282 223 178 230 180 308 173 259 266 150 324 289 211 -9 164 128 176 372 215 197 193 229 172 292 186 175 302 307 140 184 168 289 131 158 187 196 212 177 268 296 290 210 200 153 242 202 209 268 139 253 282 213 116 278 -9 206 242 175 -9 115 149 -9 171 204 253 239 203 217 176 135 260 272 121 264 164 134 240 241 260 208 159 308 -9 229 203 146 121 199 -9 245 191 129 358 301 203 180 320 209 220 206 -9 213 188 150 270 235 227 275 221 
775 601 Han China EAST_ASIA 126 116 124 129 142 230 138 120 182 98 130 118 146 217 -9 233 147 163 218 194 187 137 245 128 204 184 188 134 119 199 174 172 148 -9 94 172 126 143 164 180 212 188 -9 115 141 105 228 224 265 207 221 96 126 236 199 288 187 113 95 241 195 118 132 113 160 150 263 234 85 126 269 110 152 151 109 165 -9 149 190 130 193 104 134 133 205 237 -9 136 178 160 179 150 -9 247 126 187 246 197 119 140 246 197 190 158 162 255 -9 127 334 172 190 203 -9 156 198 143 240 198 140 188 151 237 159 168 141 208 206 265 251 147 118 139 133 170 153 165 198 204 128 204 238 232 141 224 228 149 374 183 169 204 147 188 153 200 351 208 137 240 115 218 259 234 112 175 225 128 181 242 255 180 145 179 109 277 191 176 131 200 149 151 117 204 191 158 142 163 316 215 155 245 190 183 173 252 132 225 274 207 112 236 151 180 297 241 167 270 143 264 220 268 183 245 185 263 108 263 108 266 212 257 100 292 -9 233 230 294 154 202 185 225 270 164 266 243 178 177 278 260 188 209 164 155 141 106 287 178 189 246 180 301 237 303 210 129 125 252 145 322 167 253 158 170 154 208 208 260 186 216 266 209 170 230 168 304 169 239 266 142 312 257 199 -9 156 140 172 364 195 185 189 225 168 288 186 175 302 299 140 176 164 289 123 154 183 196 184 173 260 296 270 198 200 141 234 186 209 268 135 249 262 201 112 274 -9 198 242 163 -9 111 141 -9 163 200 245 223 203 201 168 115 260 268 121 264 148 134 232 221 252 204 151 308 -9 185 199 142 107 197 -9 245 183 117 338 293 191 180 312 209 216 198 -9 213 176 146 254 235 227 271 221 
776 601 Han China EAST_ASIA 124 116 124 135 164 236 140 124 186 100 140 120 152 223 266 233 175 165 224 194 191 143 249 132 218 200 188 138 119 207 191 184 158 163 94 166 124 173 172 184 212 188 258 115 150 129 234 239 277 210 236 120 132 236 208 288 190 116 95 238 195 130 138 119 163 150 263 234 91 126 266 119 158 166 118 168 234 155 190 130 193 107 146 136 208 246 -9 154 179 160 194 156 184 247 138 193 255 200 119 156 246 209 206 166 174 259 189 127 346 176 194 203 168 164 198 155 248 194 144 192 155 237 159 172 137 236 206 273 263 151 130 155 153 170 157 177 198 216 124 204 250 232 141 228 232 153 374 187 189 208 163 196 185 192 359 220 157 256 115 226 263 238 120 187 239 136 205 242 259 188 153 179 117 277 195 184 135 200 161 143 113 210 195 150 146 175 324 199 159 245 190 187 173 252 148 237 278 219 124 248 159 184 297 245 187 274 139 -9 220 272 187 253 189 267 112 263 108 278 200 269 104 300 319 241 242 294 162 190 209 237 294 174 278 235 182 189 282 260 208 223 156 159 145 110 295 206 193 250 184 309 237 307 234 129 125 252 173 330 171 257 162 174 158 204 208 260 206 220 274 217 178 238 180 304 161 239 266 142 316 289 203 257 168 132 188 376 207 193 197 213 176 296 186 183 294 307 144 196 164 261 143 154 187 196 196 177 268 300 294 202 208 161 246 198 209 280 139 253 262 201 104 274 208 194 238 167 157 111 145 405 167 204 245 239 207 213 180 131 260 276 121 264 164 138 244 233 268 208 171 304 200 205 199 150 121 201 125 249 191 129 362 301 203 216 -9 265 216 206 -9 221 184 146 254 231 239 267 205 
776 601 Han China EAST_ASIA 124 116 124 129 158 230 138 120 180 98 130 120 148 217 262 233 175 165 220 194 187 141 243 132 208 184 188 138 119 207 189 184 158 163 94 166 120 145 170 182 212 188 252 115 138 129 234 239 271 207 221 96 117 230 205 288 187 116 86 238 195 130 132 119 157 144 263 234 91 123 263 113 152 151 109 165 234 152 187 127 190 98 140 127 205 240 -9 148 179 160 179 150 181 235 132 193 246 200 119 148 246 201 202 158 162 255 185 123 330 172 186 191 168 156 190 135 244 190 144 172 155 237 155 172 137 216 202 273 247 147 126 155 149 170 145 165 198 208 124 204 246 224 133 212 232 145 370 183 185 204 147 192 153 192 351 216 145 244 97 214 255 230 116 183 225 132 197 238 255 180 129 175 109 273 187 176 131 196 157 143 109 208 187 142 138 159 324 199 159 237 190 183 165 244 132 225 274 207 116 240 159 176 293 241 175 270 139 -9 216 260 183 253 185 263 104 263 104 266 196 253 96 292 319 237 242 294 162 190 209 233 290 158 270 239 178 185 278 256 188 211 156 159 141 108 287 190 185 246 184 301 237 307 230 129 113 224 157 322 155 253 162 170 150 204 204 260 202 216 266 209 174 230 176 300 157 239 266 142 316 257 199 241 168 136 176 368 207 193 193 209 168 296 182 191 294 303 140 192 164 261 131 150 159 188 184 177 264 300 274 202 188 149 242 190 201 272 135 249 262 197 100 274 180 194 228 163 141 111 141 405 163 200 241 227 207 201 172 119 252 260 121 256 152 126 236 225 260 204 167 304 198 185 191 134 107 201 123 233 183 117 358 297 203 180 -9 241 212 202 -9 205 176 146 254 227 227 251 201 
777 601 Han China EAST_ASIA 126 124 124 129 168 230 152 -9 -9 106 130 120 148 225 258 239 175 167 218 194 191 149 255 140 226 184 190 142 139 205 183 178 154 173 100 172 120 165 170 182 212 194 258 118 150 108 237 236 277 210 239 111 132 233 199 300 190 116 98 241 192 136 141 116 163 156 263 234 91 132 269 110 155 157 112 162 234 152 190 130 190 110 146 130 211 246 247 139 178 172 197 156 190 235 141 187 -9 200 119 152 246 205 198 158 174 271 193 131 350 176 196 203 -9 160 198 151 248 198 140 196 155 237 163 180 137 240 206 305 259 151 126 159 157 170 161 173 198 212 140 204 246 248 137 228 -9 149 390 187 181 204 151 200 189 196 -9 216 153 252 111 222 259 238 124 183 237 140 197 238 263 188 145 179 125 281 -9 176 139 204 153 159 121 212 195 154 154 179 316 223 155 245 190 207 165 256 144 233 278 215 120 248 -9 188 297 241 179 274 143 268 224 276 195 249 189 259 108 271 108 270 216 261 104 300 323 245 230 306 162 198 193 229 302 170 278 235 186 185 282 260 196 215 164 159 153 102 291 182 193 250 184 305 237 311 214 133 129 252 165 322 163 249 166 178 162 212 212 268 198 220 286 219 198 230 180 312 169 255 266 138 328 293 199 257 168 128 196 368 211 193 197 225 168 300 182 179 298 307 140 200 164 293 131 154 195 192 212 177 268 296 270 194 204 153 242 206 213 280 147 253 282 201 120 254 200 198 250 171 169 111 141 405 171 200 249 235 213 209 172 135 264 276 125 256 164 142 244 237 260 224 167 308 202 185 207 138 119 205 127 245 191 129 370 301 203 204 320 249 216 206 181 213 184 146 266 231 235 263 237 
777 601 Han China EAST_ASIA 126 122 124 129 158 230 138 -9 -9 98 128 120 146 217 250 235 173 165 214 194 191 149 251 138 218 184 188 134 119 205 183 176 148 167 98 166 120 143 170 182 212 185 252 115 147 105 225 236 271 201 221 96 117 233 199 288 184 113 89 241 192 130 132 113 157 147 251 246 88 132 263 107 155 151 109 162 228 140 190 127 178 104 143 130 208 240 233 139 178 157 197 156 190 235 138 187 -9 200 119 148 246 197 190 158 162 259 181 123 334 172 194 199 -9 152 198 143 244 194 136 184 155 233 151 172 129 232 206 269 251 147 114 151 145 170 153 165 194 208 124 204 234 232 133 216 -9 145 358 183 181 204 151 188 117 192 -9 208 137 244 97 214 255 230 116 175 235 128 181 230 255 188 145 179 109 273 -9 176 131 196 153 143 117 208 187 150 154 175 312 215 155 233 190 183 165 240 132 225 274 207 112 244 -9 180 297 241 175 258 143 264 216 272 183 249 181 251 108 267 104 266 196 257 96 288 315 241 226 294 162 190 185 229 282 164 266 239 178 177 274 256 184 211 160 155 141 98 283 178 193 250 180 301 237 307 210 129 121 224 157 322 163 241 162 174 154 204 196 264 190 220 270 209 174 230 168 308 161 235 262 138 320 285 199 245 164 132 176 364 207 185 189 209 164 300 178 191 294 303 136 188 156 289 119 154 187 192 196 177 264 292 270 194 192 141 242 190 209 256 135 245 278 197 112 254 200 198 250 167 161 111 141 397 159 200 249 227 213 209 168 131 252 272 121 256 156 142 240 229 256 212 151 304 198 185 203 134 111 201 127 229 183 129 350 301 191 180 312 209 212 202 181 209 180 138 258 231 227 255 205 
778 601 Han China EAST_ASIA 126 116 146 135 166 234 138 112 186 98 134 118 148 217 262 233 165 165 218 194 187 145 247 136 228 184 208 134 137 205 189 184 162 163 100 172 130 173 172 180 212 188 -9 115 141 129 234 242 271 207 239 105 126 239 196 297 187 113 98 241 195 121 132 119 163 162 251 234 91 132 266 113 155 166 121 165 234 155 193 130 190 107 -9 136 211 249 247 139 179 169 197 150 196 247 138 190 252 200 119 156 246 201 202 166 174 259 189 131 338 176 198 207 -9 164 202 147 252 194 144 196 155 237 163 176 141 228 220 273 255 155 118 163 153 170 161 177 202 204 124 208 246 236 141 228 232 145 386 187 181 204 163 188 165 196 355 208 153 244 119 222 263 234 120 183 237 140 201 242 255 192 149 183 117 281 191 184 147 200 157 163 117 208 -9 142 142 171 320 223 155 245 -9 187 165 260 144 237 278 227 128 244 159 184 297 241 171 274 155 268 216 276 195 253 189 267 104 267 108 270 212 257 -9 312 331 245 242 298 162 202 189 245 -9 170 278 243 186 189 290 260 192 211 172 163 157 106 287 186 193 250 -9 309 249 307 234 133 133 248 -9 334 163 261 170 178 158 204 220 260 198 224 282 209 190 -9 180 308 169 239 262 166 320 285 203 233 164 136 176 372 207 193 197 233 168 300 186 175 306 307 140 192 160 293 131 158 195 192 204 173 268 296 270 198 200 141 250 198 205 256 139 -9 282 209 120 274 208 198 246 167 141 119 -9 421 167 204 253 227 209 209 184 131 260 264 125 268 160 134 244 233 264 220 167 312 202 209 199 138 117 205 127 245 191 129 346 309 203 204 316 265 216 210 -9 209 180 150 258 227 231 263 225 
778 601 Han China EAST_ASIA 126 112 124 135 160 230 138 112 186 98 132 114 148 217 258 229 165 165 218 194 187 145 243 132 204 184 188 134 119 201 174 182 158 163 98 166 126 145 160 180 208 188 -9 115 141 108 231 236 268 201 236 96 117 236 196 288 187 110 89 238 192 121 132 113 157 150 251 234 88 126 260 107 152 157 109 165 228 152 187 127 190 101 -9 121 208 237 244 139 179 166 194 150 181 235 129 187 246 200 119 152 246 197 194 158 170 251 181 127 338 164 194 207 -9 164 202 135 240 194 144 188 151 225 159 172 137 224 206 273 247 147 110 159 133 170 161 173 202 204 124 204 242 228 121 224 228 145 386 183 177 200 151 184 153 192 347 204 145 244 115 210 255 234 116 167 237 128 193 238 255 180 141 183 113 277 191 184 131 196 157 147 117 204 -9 142 126 171 320 219 155 245 -9 187 165 260 132 225 274 207 124 236 155 180 289 241 171 270 151 260 208 276 191 253 185 243 108 267 108 266 200 257 -9 296 323 241 230 294 154 174 185 233 -9 168 262 243 182 189 274 260 188 205 168 151 157 98 287 182 185 250 -9 305 241 299 214 129 129 240 -9 318 163 253 166 174 158 204 216 260 198 220 266 209 178 -9 176 308 143 239 262 150 316 285 203 229 164 136 176 372 195 185 193 233 164 296 182 183 294 303 136 188 152 269 131 158 183 188 184 169 264 292 262 194 188 141 238 190 201 256 135 -9 282 193 112 274 204 190 242 167 141 111 -9 405 163 196 249 227 203 201 180 131 252 260 125 256 156 134 240 233 252 204 159 308 200 185 195 118 111 197 119 241 191 117 346 301 191 180 308 261 212 210 -9 205 176 146 246 223 227 259 221 
779 601 Han China EAST_ASIA 128 126 144 139 156 230 142 -9 182 -9 130 126 148 217 260 233 171 167 216 194 193 147 249 136 218 184 190 136 139 207 191 182 162 165 102 166 134 143 172 184 212 188 249 115 141 105 237 242 274 210 221 105 -9 236 199 306 187 116 95 244 -9 133 144 119 163 153 -9 246 94 126 260 110 155 157 115 165 234 158 190 136 178 110 143 130 208 252 -9 151 179 166 194 153 184 250 141 193 246 200 125 156 246 205 198 162 170 267 185 127 350 176 194 199 202 168 198 147 240 194 144 188 159 241 159 180 145 212 206 277 255 151 126 159 153 170 157 173 206 216 120 216 238 228 141 224 240 145 382 183 -9 204 167 192 193 196 355 208 157 240 115 222 259 234 120 187 239 136 189 242 255 188 149 179 113 281 191 180 131 196 161 159 125 212 198 158 142 171 324 225 159 245 198 187 173 260 148 245 278 227 124 244 151 184 293 241 171 274 147 -9 220 280 187 257 189 267 112 263 108 262 216 269 100 292 335 245 242 294 -9 194 193 233 290 164 270 239 182 181 278 264 200 219 164 159 149 -9 291 198 185 250 180 313 245 311 218 133 129 244 165 334 167 257 174 178 158 204 212 260 206 224 286 209 178 226 172 304 169 239 266 150 320 257 203 237 168 132 188 380 211 189 189 233 172 300 178 179 302 311 144 200 160 261 135 150 187 192 208 173 268 300 294 202 200 157 242 202 209 276 143 -9 282 197 116 254 204 190 246 167 157 115 165 405 171 204 249 243 207 225 176 135 268 276 129 264 156 150 240 233 256 216 167 308 202 209 203 142 119 201 125 -9 191 117 358 297 203 212 308 269 216 206 185 209 184 146 258 231 231 259 245 
779 601 Han China EAST_ASIA 124 114 142 135 142 230 140 -9 182 -9 130 118 148 217 258 229 169 165 214 194 189 147 247 136 218 184 188 134 119 207 189 180 158 163 94 166 126 143 172 180 212 185 249 115 141 105 234 239 271 207 221 102 -9 236 196 288 184 104 89 241 -9 121 141 116 163 150 -9 234 91 126 254 107 155 151 112 165 234 152 187 130 178 104 143 130 205 252 -9 151 179 166 194 150 181 238 129 172 246 200 119 140 246 201 198 158 162 263 185 123 350 176 194 191 174 156 186 147 240 194 144 172 155 237 155 176 141 208 206 273 247 147 118 151 149 170 153 169 202 204 116 204 238 224 137 224 228 133 370 183 -9 204 147 188 193 192 351 204 141 240 111 210 255 230 116 167 229 132 177 238 255 172 149 179 113 281 187 176 131 192 153 151 109 204 187 142 142 167 324 205 155 245 198 183 173 240 132 245 266 227 112 236 151 176 285 241 171 254 143 -9 220 276 183 253 189 259 108 263 104 258 208 265 96 280 323 241 238 290 -9 190 185 233 274 164 270 239 178 177 278 256 192 215 156 155 137 -9 283 194 177 246 180 309 241 303 210 133 121 240 161 314 163 253 166 162 154 200 204 260 186 220 278 209 174 226 168 304 169 235 262 150 316 257 199 237 156 132 176 372 211 185 185 213 164 296 174 187 298 307 140 176 160 261 119 150 159 192 184 169 260 292 270 194 196 149 234 194 205 252 142 -9 274 197 116 254 204 182 238 167 157 111 141 405 163 200 249 227 203 209 172 131 256 264 129 256 148 134 204 229 252 216 167 304 202 185 195 142 119 201 123 -9 181 117 342 289 203 184 308 265 216 198 181 197 180 146 250 223 223 247 221 
780 601 Han China EAST_ASIA 126 116 142 135 160 236 142 112 182 98 132 120 158 225 266 233 173 165 218 194 187 143 259 136 218 184 188 144 139 201 176 180 158 171 102 174 130 145 172 180 212 191 249 121 147 129 237 242 271 210 236 105 138 239 205 309 190 113 98 241 192 121 138 119 -9 162 266 234 91 126 266 119 158 151 109 165 234 155 193 130 187 110 140 130 205 249 244 151 178 166 197 150 184 250 135 187 252 200 125 152 246 205 202 162 170 259 -9 131 334 176 194 199 178 164 202 151 252 194 144 196 155 233 155 176 141 244 206 273 255 135 122 163 157 174 157 173 202 208 128 212 238 232 121 224 232 149 374 183 189 208 159 204 193 204 -9 212 157 240 119 218 263 238 124 187 237 128 181 242 255 196 153 179 113 277 195 180 131 204 157 147 113 212 195 142 150 171 320 217 159 249 194 199 181 248 144 245 -9 227 116 244 163 188 293 261 187 282 159 268 220 268 195 253 189 271 104 267 108 266 208 269 104 300 323 245 242 298 162 202 193 233 282 168 282 239 182 189 282 264 196 219 160 159 153 100 291 202 193 250 180 309 237 311 222 133 125 248 157 322 167 253 170 182 154 212 220 268 -9 224 286 223 202 226 180 304 169 239 266 154 320 285 207 237 164 128 180 372 203 197 197 237 176 300 194 187 294 303 140 192 168 269 131 166 195 192 216 185 272 300 266 198 200 153 246 202 209 268 151 253 262 197 104 258 180 198 242 171 157 115 165 425 167 204 245 227 211 209 176 131 264 280 125 256 156 138 244 233 260 220 159 304 208 185 203 150 119 205 125 241 183 117 350 301 207 180 -9 265 220 210 181 213 184 150 250 255 235 267 221 
780 601 Han China EAST_ASIA 126 112 124 129 144 230 138 108 180 98 130 114 148 223 258 233 165 165 214 194 187 137 245 136 218 184 188 142 139 199 176 176 154 163 100 166 120 143 170 180 208 188 249 115 141 105 237 224 271 201 221 96 132 239 199 297 190 113 89 238 192 118 132 119 -9 153 251 234 88 123 263 107 155 151 106 165 234 140 190 127 178 104 137 127 205 237 227 148 178 163 191 147 184 235 132 181 246 200 125 140 246 201 198 158 166 259 -9 127 330 176 192 199 172 164 186 147 240 190 144 192 151 233 151 172 133 220 206 273 251 131 122 151 149 170 150 165 198 200 124 204 238 232 121 224 228 145 370 183 169 204 159 188 157 196 -9 204 149 240 115 214 255 234 116 187 225 128 181 238 255 188 149 171 113 277 191 176 131 200 153 147 109 208 195 142 138 171 320 215 155 237 190 179 173 240 132 225 -9 207 108 236 151 180 289 253 175 258 147 264 220 264 191 245 185 259 108 263 104 258 200 257 100 296 319 241 230 294 154 198 189 229 250 164 278 243 178 189 274 264 184 209 156 155 137 98 287 194 177 246 180 309 237 307 218 133 125 244 149 318 159 249 166 170 150 204 208 264 -9 216 282 213 174 226 168 284 143 235 266 134 316 257 199 233 160 132 176 372 203 193 189 233 164 296 178 191 294 303 140 192 152 261 123 158 159 192 212 173 260 300 262 194 196 149 246 190 205 264 135 249 262 197 104 254 180 182 242 167 149 111 141 425 163 200 245 227 203 205 172 131 252 276 121 256 156 134 232 225 252 216 159 304 198 185 203 142 119 205 125 233 181 117 318 297 191 180 -9 209 216 202 173 213 180 142 250 231 235 259 205
781 601 Han China EAST_ASIA 126 124 148 129 172 230 140 124 180 106 138 120 152 217 260 235 177 165 218 194 195 149 247 144 226 200 206 150 119 207 191 184 162 167 104 172 130 175 170 182 212 188 249 115 147 105 237 245 274 210 239 111 126 -9 199 315 190 113 95 253 195 136 138 113 163 162 263 246 94 126 266 113 158 157 115 165 234 158 187 133 193 104 146 139 208 246 247 151 -9 169 179 156 190 250 141 193 246 200 125 152 246 205 202 158 174 259 209 131 346 172 198 207 198 156 206 155 240 202 148 200 155 241 159 180 145 248 218 273 251 135 118 155 157 174 153 173 202 216 128 216 254 232 141 224 232 149 390 183 177 204 163 188 157 196 351 208 157 240 115 222 263 234 120 183 255 -9 219 246 255 196 157 183 109 269 191 180 147 196 157 167 117 212 187 142 -9 179 320 215 159 241 190 199 173 252 152 245 274 231 124 240 159 184 301 245 195 274 159 264 208 276 195 253 185 263 112 263 112 262 216 261 108 292 323 249 242 302 166 194 213 241 306 170 274 239 186 189 278 264 196 219 168 159 153 108 291 198 201 254 184 305 245 303 218 137 125 244 169 326 163 257 162 174 158 212 216 264 198 224 286 219 170 234 180 308 169 239 270 142 328 289 207 225 168 132 176 376 207 185 201 233 176 308 -9 175 294 307 140 192 164 273 131 158 183 196 216 177 268 300 290 202 188 153 246 190 209 272 142 245 282 201 116 278 208 190 242 163 157 111 141 405 171 204 245 235 207 213 172 131 252 272 133 264 164 142 244 229 264 224 159 312 202 209 203 142 119 201 125 249 199 129 374 293 203 216 320 269 216 206 181 205 184 146 246 -9 243 263 221 
781 601 Han China EAST_ASIA 120 116 126 129 164 230 138 102 180 98 132 118 146 217 258 233 169 165 218 194 193 143 247 136 206 196 206 134 119 199 187 180 162 161 94 166 130 145 170 180 208 188 246 115 141 105 237 224 265 195 236 96 117 -9 196 288 184 110 95 241 192 121 132 113 157 147 257 234 94 123 254 107 158 151 112 165 234 140 187 127 187 101 146 127 202 240 244 136 -9 160 179 156 184 235 132 172 246 200 125 148 246 201 194 158 162 255 181 131 334 172 192 207 180 152 198 147 236 202 132 196 151 233 155 176 137 220 206 273 247 131 118 139 153 158 149 173 198 208 128 204 246 228 133 216 232 145 386 183 173 204 159 188 117 192 347 204 145 240 97 222 259 218 116 183 227 -9 189 238 255 172 149 179 109 269 187 180 131 196 157 159 113 204 187 142 -9 175 312 215 159 241 190 187 165 244 132 225 270 227 120 236 155 180 293 241 167 274 147 260 208 272 187 245 181 259 108 263 108 258 216 257 100 288 319 241 242 302 154 194 169 233 250 168 270 243 178 185 278 260 192 215 164 159 145 106 287 194 193 230 180 297 241 303 210 133 121 244 161 322 163 245 162 170 154 208 212 260 190 220 282 209 170 226 176 300 157 239 262 134 316 257 195 217 164 140 172 364 199 173 189 209 176 296 -9 179 294 299 140 176 160 269 123 158 183 192 212 177 260 296 290 198 188 149 238 190 209 264 139 245 274 197 116 274 180 186 238 163 141 111 141 405 163 200 245 227 203 213 164 115 252 272 129 256 156 138 240 217 260 220 159 308 200 185 199 118 113 199 125 233 191 121 318 289 199 180 312 265 216 202 177 201 184 138 246 -9 231 255 217 
782 601 Han China EAST_ASIA 126 128 146 131 156 230 140 -9 186 98 136 120 148 223 256 233 173 167 -9 194 187 145 249 140 218 198 188 148 119 201 191 184 154 175 96 166 130 145 170 184 212 188 249 124 141 105 237 245 277 216 236 96 138 236 199 309 193 113 -9 244 198 136 132 116 163 150 251 234 88 126 269 110 152 157 118 165 249 158 205 142 190 113 146 139 214 255 244 148 179 163 200 156 184 247 132 193 252 200 119 152 254 205 202 162 174 267 197 -9 334 176 192 203 198 160 198 147 240 194 144 192 155 241 159 176 137 240 206 273 255 155 122 155 153 -9 161 173 202 212 124 204 234 228 137 228 240 149 382 183 173 204 147 204 197 200 -9 212 157 244 111 -9 255 238 120 183 243 128 173 246 259 -9 153 191 109 281 195 180 143 204 165 147 121 212 195 150 146 171 320 223 159 245 198 -9 169 252 132 245 -9 215 128 244 163 180 297 245 187 270 159 264 224 276 187 249 185 263 108 263 104 282 212 265 104 304 323 245 -9 302 158 210 -9 229 286 174 274 239 182 185 278 264 188 215 164 159 149 106 287 198 185 254 184 309 237 307 218 133 129 248 169 322 163 257 170 178 154 220 216 264 202 228 286 223 182 242 184 308 169 243 266 154 320 285 199 233 160 132 176 376 219 193 189 229 176 300 186 175 294 307 144 196 168 289 119 158 191 200 208 177 268 300 286 202 204 149 242 206 217 280 143 -9 274 209 116 270 184 190 246 167 149 115 -9 425 167 200 253 235 213 213 180 131 252 272 133 264 160 142 244 233 260 216 167 312 204 213 199 142 119 201 125 249 191 117 354 293 203 -9 308 257 216 210 181 217 180 146 258 251 231 267 233 
782 601 Han China EAST_ASIA 124 116 142 129 142 230 138 -9 180 98 130 114 148 217 256 229 165 165 -9 190 187 143 243 128 218 184 188 134 119 193 183 182 148 163 92 166 130 143 166 180 212 188 249 118 141 105 225 224 271 201 221 96 117 227 196 288 187 113 -9 238 195 121 132 113 163 147 251 246 79 120 266 107 152 151 115 165 249 140 187 130 178 98 140 133 214 246 244 139 179 142 197 150 184 247 126 187 246 197 119 148 246 197 202 158 170 255 197 -9 322 172 188 203 186 152 198 147 236 194 144 188 151 237 151 172 121 208 194 265 251 155 122 151 133 -9 157 173 202 204 124 204 234 228 121 216 232 145 378 183 169 200 147 192 193 192 -9 212 157 240 111 -9 251 230 116 175 237 124 173 242 255 -9 149 179 109 269 187 180 131 196 157 147 109 208 191 146 146 159 316 215 151 241 198 -9 165 248 132 233 -9 211 128 240 155 180 293 241 175 258 147 260 220 272 187 245 181 259 108 263 104 250 200 265 96 280 319 241 -9 294 158 194 -9 229 286 164 270 243 182 177 274 264 188 211 156 159 141 98 283 194 173 250 180 301 237 303 218 133 125 244 153 306 163 257 166 170 154 204 208 256 202 220 286 209 178 226 168 304 157 235 266 142 316 257 199 229 160 136 176 364 207 185 185 229 164 296 178 191 282 303 140 188 148 261 119 150 187 192 192 173 268 292 286 198 188 141 242 198 209 276 143 -9 262 201 104 254 184 186 242 167 149 115 -9 401 163 200 253 235 203 213 172 131 252 272 129 256 144 134 236 233 256 216 163 304 196 209 195 134 107 201 121 245 181 117 354 289 191 -9 304 249 216 202 181 201 176 142 258 231 227 263 225 
783 601 Han China EAST_ASIA 126 128 144 -9 156 230 142 128 188 100 132 120 152 223 264 233 -9 167 216 194 193 -9 243 140 222 184 190 134 139 201 -9 178 164 169 94 172 126 145 170 180 212 188 258 115 141 108 231 239 277 201 236 111 138 236 196 297 193 -9 89 241 195 118 138 113 163 153 251 246 91 132 269 113 158 166 118 171 -9 158 190 136 193 110 134 127 217 252 244 151 -9 169 194 150 190 250 138 187 246 -9 125 156 254 205 206 158 170 259 -9 131 338 176 196 203 186 168 206 147 248 194 148 192 159 245 159 176 137 220 210 273 255 155 122 155 157 166 165 169 202 204 132 204 250 228 129 216 228 153 382 187 193 208 155 188 201 212 359 224 165 256 111 222 255 238 120 187 249 128 197 242 259 180 145 183 109 281 191 180 131 196 153 159 121 212 199 142 138 175 320 225 159 245 194 187 173 260 148 245 274 227 112 244 155 184 301 261 175 270 155 268 220 276 187 253 189 259 112 267 104 258 212 273 108 300 323 245 238 294 162 198 189 233 302 168 278 235 178 185 290 264 184 227 168 159 153 98 291 186 193 242 184 305 241 -9 218 129 129 244 169 322 163 253 174 178 162 208 212 260 206 220 282 209 178 230 168 304 169 239 -9 158 320 289 207 257 164 128 180 376 211 189 201 233 184 300 182 175 306 307 144 196 152 269 123 166 195 200 212 181 264 296 266 202 200 153 242 198 205 252 139 249 290 201 120 262 204 194 228 167 161 115 161 -9 159 204 261 231 213 221 172 131 252 268 133 256 160 142 224 237 260 216 167 308 202 221 203 146 119 207 129 249 191 129 -9 301 203 -9 312 269 216 202 177 213 184 146 262 -9 231 263 229 
783 601 Han China EAST_ASIA 126 116 140 -9 156 230 140 114 186 98 130 120 152 217 258 233 -9 165 216 194 187 -9 243 132 218 184 186 134 119 199 -9 176 148 163 92 166 120 145 166 180 208 179 246 115 141 108 222 239 268 195 221 96 126 236 196 294 190 -9 89 238 195 115 138 113 163 147 251 234 91 123 266 107 155 157 109 165 -9 140 190 130 178 110 134 127 208 249 244 139 -9 157 179 150 181 250 132 181 246 -9 125 148 246 201 198 158 170 259 -9 127 334 164 186 203 168 160 198 135 236 190 144 184 151 233 151 172 133 200 206 269 251 151 118 139 153 150 153 169 198 204 124 204 238 224 121 216 228 133 382 183 189 204 147 188 149 200 351 220 157 240 111 198 255 230 116 183 231 124 191 242 255 172 145 175 109 273 187 176 131 192 149 143 117 212 187 142 126 171 316 215 155 245 190 183 169 252 144 225 274 223 112 244 155 184 297 257 171 258 151 264 208 276 175 249 181 259 108 263 104 250 208 261 100 300 319 241 230 294 150 198 185 229 298 164 278 239 174 173 282 260 184 219 160 159 141 98 287 182 189 238 180 305 237 -9 214 129 125 240 153 318 163 249 170 170 162 208 212 260 206 220 266 209 170 230 168 292 147 239 -9 146 316 285 203 233 160 132 176 372 195 185 197 229 168 296 174 183 302 299 140 176 148 261 123 158 191 192 192 177 260 292 262 194 196 149 238 194 201 252 139 249 282 197 120 254 184 186 228 167 161 111 145 -9 159 200 249 227 203 213 164 131 252 268 121 256 160 138 212 233 256 212 159 308 200 213 199 138 119 203 125 245 191 117 -9 293 191 -9 304 241 212 202 177 213 184 146 254 -9 231 259 225 
784 601 Han China EAST_ASIA 126 116 124 129 164 234 146 112 188 98 130 120 156 223 262 233 -9 165 220 194 187 149 251 140 218 200 212 136 119 209 176 186 158 169 108 172 130 143 170 180 212 188 249 115 147 105 234 239 271 207 233 111 120 239 199 309 187 113 95 241 195 121 144 116 -9 147 266 246 91 126 269 113 158 157 118 165 234 152 190 130 193 107 146 133 208 243 247 151 179 166 197 159 184 250 138 193 249 200 125 156 246 205 202 166 166 259 189 135 330 176 194 203 198 164 206 151 -9 194 148 196 159 237 159 176 153 228 212 301 255 155 118 151 153 170 157 173 198 204 128 208 238 232 -9 228 240 149 390 187 185 200 163 200 157 200 -9 216 145 252 123 222 263 -9 124 183 245 132 -9 242 255 192 149 183 109 281 187 184 -9 200 157 155 121 212 195 146 138 175 324 229 159 245 198 195 169 252 152 249 -9 227 112 244 159 184 293 257 171 274 163 268 216 276 195 253 193 259 112 267 104 262 220 265 100 296 323 245 234 286 162 194 -9 233 302 178 278 223 182 185 286 260 196 223 164 159 153 100 287 198 189 250 180 309 241 307 218 133 125 248 161 330 167 261 166 178 162 208 216 260 -9 228 282 223 194 230 176 304 173 251 262 146 320 289 203 237 172 128 176 376 211 193 193 237 188 296 190 187 294 307 144 192 148 261 131 158 195 200 212 173 272 296 290 198 208 149 242 202 209 272 143 245 286 209 120 274 200 194 242 183 157 119 161 421 167 204 249 239 207 209 176 131 260 268 121 256 156 146 236 233 264 216 171 308 202 221 203 138 119 -9 127 249 191 137 370 305 203 204 316 269 216 202 -9 217 180 150 262 235 231 275 225 
784 601 Han China EAST_ASIA 126 116 124 129 144 230 138 112 180 98 130 114 148 217 250 233 -9 165 214 194 187 143 243 128 218 184 190 134 119 193 174 182 156 159 102 166 126 143 170 174 212 185 249 115 141 105 231 224 271 204 221 96 117 236 196 300 178 113 86 241 195 118 132 113 -9 147 263 234 85 126 266 107 158 157 115 165 234 152 187 127 187 104 146 133 208 240 241 148 179 160 179 150 184 247 135 172 246 200 119 140 246 197 202 158 166 255 185 127 326 172 190 195 178 160 202 147 -9 194 144 184 151 233 151 172 141 216 210 273 251 147 110 139 149 146 157 169 198 200 124 204 238 224 -9 216 232 149 370 187 173 200 147 192 153 196 -9 204 141 240 111 198 259 -9 120 175 243 128 -9 238 255 172 145 183 109 277 187 176 -9 196 153 151 113 212 191 142 134 175 320 215 155 241 194 187 169 252 148 245 -9 211 112 232 159 176 289 257 171 258 155 260 208 260 187 245 185 259 104 263 100 262 208 257 96 292 315 237 230 282 158 190 -9 225 294 164 266 247 178 185 278 260 188 211 152 159 141 98 287 182 185 242 176 301 237 303 210 129 121 240 157 322 155 245 166 178 158 208 204 260 -9 224 266 209 170 226 168 300 143 239 262 134 312 285 199 229 164 136 176 364 203 185 189 209 164 296 178 187 294 299 140 188 144 261 123 154 187 196 184 169 268 292 262 194 200 149 242 202 209 264 142 245 262 197 116 270 184 190 238 167 153 115 141 405 167 192 245 235 207 205 168 131 252 268 121 256 156 146 236 233 264 204 167 308 200 185 199 134 111 -9 121 233 181 133 362 305 191 180 312 265 212 202 -9 209 176 138 258 223 227 263 205
785 601 Han China EAST_ASIA 124 124 144 139 144 234 138 120 -9 98 -9 120 152 217 258 233 173 163 218 198 187 -9 249 132 204 -9 190 138 139 209 191 182 158 173 100 166 124 143 172 184 212 185 252 115 141 120 237 245 271 210 236 111 129 233 196 300 190 113 98 253 192 136 144 119 163 156 251 246 91 126 266 110 155 157 109 168 234 158 187 133 190 104 143 136 -9 252 -9 151 188 166 194 159 190 235 132 196 252 200 125 156 -9 205 202 158 174 259 209 131 330 172 194 199 178 164 198 147 244 194 144 196 155 237 159 -9 153 232 210 281 259 151 118 159 133 174 153 177 -9 212 136 208 250 232 121 228 232 153 390 187 177 204 163 192 189 188 363 220 -9 256 97 222 263 238 116 183 233 128 193 238 255 188 153 199 121 277 187 184 135 204 153 163 121 208 191 142 150 179 324 235 163 241 194 195 173 260 148 237 278 231 120 240 167 192 297 261 175 278 155 264 224 276 191 249 189 275 112 263 104 278 224 269 96 300 323 245 242 302 158 202 213 241 286 164 -9 239 186 189 286 264 196 215 164 167 153 108 287 194 189 -9 184 313 245 307 218 137 129 248 153 322 167 265 170 178 154 212 216 264 202 224 282 209 182 234 176 -9 157 239 266 154 320 293 203 257 168 128 176 372 207 185 197 233 176 300 190 187 302 307 148 192 164 293 131 158 191 192 216 177 268 300 266 202 200 149 242 198 217 264 135 253 286 197 116 254 208 194 250 175 153 115 141 413 167 200 253 231 207 221 168 131 264 268 121 292 164 142 240 237 256 212 159 304 200 209 207 138 117 205 127 245 183 117 354 313 203 180 316 245 216 202 181 209 180 146 266 255 239 251 225 
785 601 Han China EAST_ASIA 120 116 124 129 142 234 138 112 -9 98 -9 120 152 217 258 229 173 163 214 194 187 -9 247 128 204 -9 188 134 119 207 187 176 148 167 94 166 120 143 164 174 212 185 246 115 141 105 234 239 271 195 221 96 129 230 196 297 187 113 89 238 192 124 135 119 160 150 251 234 88 123 260 107 152 151 109 165 228 155 187 130 178 104 140 130 -9 252 -9 148 179 160 179 156 184 235 132 190 246 197 125 140 -9 197 202 158 162 255 181 127 322 168 194 191 174 160 190 135 240 194 140 188 147 233 151 -9 137 228 206 273 247 131 134 151 133 170 153 173 -9 204 124 204 246 228 121 228 228 145 370 183 177 204 163 188 117 180 351 204 -9 240 97 210 255 230 116 175 231 124 185 238 255 172 129 183 109 273 187 180 131 196 149 143 117 208 187 138 138 171 316 215 155 237 194 187 169 240 132 237 274 211 120 240 155 188 293 241 171 258 155 264 220 260 187 241 185 271 108 263 104 254 208 257 96 292 323 241 230 298 158 194 213 233 282 164 -9 243 182 189 282 260 188 211 152 147 141 98 287 178 173 -9 176 297 237 303 210 129 129 224 153 322 163 253 170 162 150 204 208 260 190 220 282 209 174 226 168 -9 157 235 266 142 316 285 203 229 164 132 172 372 203 177 193 209 176 300 186 187 302 303 140 176 152 261 115 158 191 188 184 173 260 292 254 198 188 149 234 190 209 252 135 253 278 197 100 254 204 186 246 167 141 111 141 405 163 196 245 231 203 209 168 119 260 260 121 256 160 142 232 233 252 204 159 304 198 185 203 118 111 195 117 233 181 117 350 285 203 168 308 209 216 198 181 197 176 146 262 223 231 251 221 
786 601 Han China EAST_ASIA 126 -9 142 137 160 230 146 124 -9 98 140 -9 146 217 258 235 171 167 218 196 187 145 247 136 228 200 188 136 139 205 191 182 158 167 94 172 130 147 170 180 208 188 249 121 141 123 237 245 271 201 236 96 117 -9 202 288 193 113 95 253 192 121 144 113 157 156 263 246 91 126 266 107 158 157 112 165 234 161 187 130 193 110 143 130 208 249 -9 148 182 166 203 156 202 247 138 187 246 200 119 156 254 205 202 166 170 259 189 131 338 176 196 203 198 164 202 147 244 198 148 192 155 237 159 176 141 240 206 269 255 143 122 147 149 170 161 173 206 208 140 204 254 236 133 228 228 153 386 183 177 204 159 188 173 204 351 220 161 256 119 214 267 -9 124 183 239 128 209 238 255 188 149 183 109 281 191 176 -9 200 165 151 117 212 191 146 150 175 324 229 155 -9 190 195 169 256 132 245 278 227 128 248 159 180 301 261 171 274 167 -9 224 276 195 245 193 267 112 271 112 262 216 -9 108 300 327 245 246 298 158 206 185 233 302 164 -9 235 182 189 286 264 192 215 184 159 153 110 287 182 189 254 180 313 241 311 226 133 133 248 169 326 155 257 166 178 158 204 212 268 202 220 266 213 206 234 180 296 155 239 266 154 324 289 203 241 164 128 176 376 211 185 197 209 176 300 190 179 306 303 140 192 164 269 131 162 191 192 208 169 268 300 274 202 188 153 250 206 213 264 147 249 282 201 120 278 204 190 250 171 165 111 169 409 163 200 253 239 213 217 176 131 260 272 133 256 168 142 256 237 260 220 167 308 202 217 207 134 125 205 127 245 191 121 370 301 203 184 -9 241 216 206 -9 221 184 146 262 231 235 263 229 
786 601 Han China EAST_ASIA 126 -9 124 129 158 230 138 112 -9 98 130 -9 146 217 258 233 169 163 218 194 187 143 245 134 218 184 186 134 119 205 191 180 156 163 94 166 120 143 170 180 208 185 246 115 141 108 234 224 268 198 221 96 117 -9 196 288 187 113 95 241 189 118 132 113 157 150 260 237 88 123 266 107 152 151 112 162 228 152 187 130 193 110 140 130 202 246 -9 139 179 166 194 150 184 247 138 187 246 200 119 152 246 201 198 158 170 247 181 127 330 168 190 199 168 160 198 147 244 194 140 192 151 221 155 176 129 232 196 269 255 139 118 139 133 170 161 173 198 204 124 204 238 232 133 224 228 149 378 183 177 200 151 188 165 192 347 204 153 244 97 214 255 -9 124 175 235 120 177 238 255 180 141 179 109 277 183 172 -9 192 149 147 113 208 183 142 142 159 316 219 151 -9 190 187 165 240 132 241 270 211 116 240 151 180 293 245 171 254 151 -9 216 268 191 245 185 263 108 263 108 254 212 -9 104 300 327 241 242 298 138 190 185 229 294 164 -9 239 174 189 282 260 188 207 148 151 145 98 287 178 177 246 180 297 241 307 214 129 125 244 153 318 155 249 162 178 154 204 208 268 190 216 266 209 198 230 168 292 143 235 262 142 320 285 199 229 160 132 176 372 207 165 189 209 172 296 182 195 294 303 140 192 148 269 119 158 175 192 184 169 264 292 262 198 188 141 242 202 209 256 143 249 262 197 104 270 180 190 228 167 157 111 141 409 159 200 241 231 207 217 168 131 260 268 121 256 156 138 240 237 260 216 155 304 192 213 203 134 115 205 125 241 183 117 362 297 191 180 -9 241 212 206 -9 209 184 142 254 223 231 251 229 
811 601 Han China EAST_ASIA 128 112 124 133 156 230 142 124 188 98 140 118 152 227 260 233 169 167 -9 194 187 147 247 140 226 -9 192 138 139 209 183 184 160 167 102 172 130 175 176 186 212 188 249 118 -9 129 234 242 271 201 239 111 138 239 199 309 193 113 98 238 195 127 132 119 163 153 251 234 88 132 266 116 158 157 118 165 234 161 193 133 193 110 143 127 217 246 241 142 182 172 197 156 196 250 138 187 252 200 125 148 -9 209 198 158 170 259 193 131 334 176 196 203 186 -9 -9 151 248 198 144 184 155 241 163 172 129 244 210 273 251 151 130 151 153 150 161 173 198 212 124 212 246 228 141 228 240 153 386 183 193 204 159 188 197 212 371 212 157 244 119 214 267 -9 116 187 239 128 223 246 255 192 145 199 113 281 191 184 -9 208 157 147 121 208 191 142 150 171 320 215 159 241 194 187 165 260 148 237 278 223 116 232 155 192 301 269 167 274 155 272 216 276 195 249 185 271 112 267 108 278 200 269 104 308 323 237 234 294 154 194 213 249 282 -9 -9 243 182 185 286 264 200 215 160 159 145 98 291 194 181 -9 180 301 241 311 222 133 129 248 153 322 163 249 170 182 158 204 216 260 198 224 286 209 178 234 180 -9 169 255 266 142 324 289 203 241 168 128 180 376 215 197 -9 233 176 296 174 191 294 303 140 184 164 289 135 158 191 192 196 177 -9 300 270 198 204 149 242 206 213 284 143 -9 282 201 120 262 204 190 246 179 145 119 165 417 175 200 249 235 211 217 176 -9 260 272 129 256 164 150 240 237 256 224 167 312 204 221 199 146 113 201 125 245 181 129 350 297 203 204 320 269 216 206 181 213 188 150 270 231 235 267 241 
811 601 Han China EAST_ASIA 124 112 124 129 144 230 138 118 188 96 136 118 148 223 260 233 147 163 -9 194 171 145 247 140 218 -9 188 134 121 195 181 176 158 163 94 166 126 145 170 174 212 188 249 115 -9 108 234 242 271 201 236 96 132 230 196 288 190 113 86 238 195 127 132 113 157 150 239 234 85 126 263 110 143 157 109 165 234 140 190 127 178 98 134 127 208 246 235 142 179 166 179 147 190 247 132 187 246 200 119 148 -9 201 194 158 166 255 181 127 330 172 190 199 174 -9 -9 147 240 198 144 172 155 233 159 172 129 224 210 273 251 131 126 151 149 150 157 169 198 212 120 204 246 224 121 224 228 153 370 183 169 200 147 188 153 200 351 204 157 240 97 210 267 -9 116 183 225 128 177 238 251 188 145 183 109 277 187 176 -9 204 149 143 117 208 191 142 138 163 320 209 155 237 194 179 165 244 132 225 278 219 112 232 151 176 293 261 163 270 151 264 216 272 191 245 181 251 104 263 104 278 196 265 96 288 319 225 230 294 154 190 193 233 266 -9 -9 243 178 177 282 264 196 211 156 155 141 98 287 182 177 -9 176 301 237 287 214 129 125 248 153 326 159 245 170 174 150 204 216 260 198 224 274 209 174 230 172 -9 169 235 266 138 320 289 199 233 164 140 176 368 211 193 -9 209 164 292 170 195 294 299 136 176 164 261 119 154 163 188 192 173 -9 296 262 190 188 149 238 198 201 268 139 -9 274 193 116 254 200 190 246 175 141 115 141 409 163 200 249 227 203 209 172 -9 260 268 121 256 156 134 240 233 256 208 159 304 200 217 199 118 111 201 121 241 181 117 334 293 191 180 312 209 212 198 181 201 184 146 250 227 231 267 221 
812 601 Han China EAST_ASIA 126 124 124 129 174 234 138 124 186 102 134 114 158 225 264 233 165 167 218 194 187 143 249 140 218 184 200 134 119 207 183 184 164 165 112 166 126 145 170 182 212 188 249 118 153 108 237 239 271 201 230 96 126 239 196 297 190 113 95 -9 195 136 144 119 166 162 239 246 91 132 263 110 161 151 112 165 255 155 190 130 184 104 137 133 -9 -9 -9 148 179 172 206 156 190 250 141 190 252 200 122 152 246 197 198 162 170 255 201 131 334 172 200 211 168 156 206 147 248 194 156 188 155 237 163 176 137 208 210 273 259 151 130 159 153 170 161 173 206 208 144 212 246 252 141 228 228 149 370 187 197 204 163 188 153 200 351 212 161 244 111 202 263 238 120 187 225 128 193 242 259 188 145 187 113 281 187 184 131 204 165 163 117 212 195 158 150 175 328 213 151 237 190 187 173 260 148 245 274 211 128 244 155 184 297 241 175 258 151 260 224 268 191 253 185 271 108 267 104 290 220 269 96 296 327 249 242 290 166 198 -9 233 286 174 278 235 190 189 278 260 200 207 156 167 153 110 291 182 189 250 180 305 245 311 218 133 129 248 165 326 171 257 170 182 158 208 216 264 206 232 286 209 170 238 184 304 161 239 266 150 320 289 199 257 168 128 184 372 207 201 197 233 176 300 186 187 298 307 140 188 156 273 131 162 183 200 212 177 268 296 298 194 200 153 242 198 213 280 -9 253 286 201 116 278 204 194 252 163 153 115 165 425 167 204 245 227 213 213 184 135 264 272 125 292 168 154 240 237 264 224 151 308 206 185 199 118 119 201 123 241 187 129 354 297 191 216 312 269 220 202 181 197 184 142 254 235 231 267 217 
812 601 Han China EAST_ASIA 126 116 124 129 156 230 138 114 186 98 130 114 148 217 258 233 147 163 218 194 187 143 247 136 218 184 188 134 119 205 183 182 158 163 104 166 120 143 168 174 212 185 249 115 138 105 234 224 271 201 221 96 126 236 196 288 190 113 89 -9 192 133 132 119 157 153 239 234 88 129 260 110 158 151 112 162 234 152 187 121 178 104 134 130 -9 -9 -9 142 179 166 179 153 184 235 126 181 246 200 119 140 246 197 194 158 166 255 185 127 330 164 190 203 164 152 186 139 240 190 144 184 151 237 159 172 129 200 202 273 251 143 126 151 149 170 161 169 202 208 128 204 238 220 133 212 224 145 370 187 169 204 147 188 117 196 351 204 149 240 107 198 259 234 120 167 225 128 177 234 259 172 129 183 109 281 179 180 131 196 157 147 109 208 191 142 138 175 324 199 147 237 190 179 173 252 132 237 274 207 124 244 151 180 293 241 175 254 147 260 220 268 175 241 185 263 108 263 104 258 212 257 96 292 323 237 230 290 162 174 -9 233 282 164 274 235 174 185 274 256 196 203 152 155 141 98 283 174 185 250 160 301 245 307 214 125 121 224 153 322 163 245 170 170 154 204 208 260 198 220 282 209 166 238 180 300 157 235 266 142 316 289 199 233 156 136 176 372 203 177 189 209 168 292 174 191 294 303 140 184 152 269 127 158 171 192 208 173 264 296 270 194 192 145 238 198 209 248 -9 233 278 197 100 266 184 194 250 163 141 111 141 405 159 204 241 227 203 213 168 135 256 272 121 256 164 134 232 229 248 204 151 304 202 185 199 118 119 201 115 241 183 121 350 293 191 184 312 261 216 202 181 197 184 142 250 227 227 259 205 
813 601 Han China EAST_ASIA 126 -9 142 139 166 234 140 124 182 98 136 120 148 225 260 233 147 -9 218 198 187 143 -9 140 228 184 188 134 139 207 191 182 160 163 94 172 120 145 172 180 212 194 249 118 141 108 234 -9 274 210 239 111 138 230 205 297 187 113 95 241 192 136 144 122 163 156 257 246 91 132 263 113 158 157 112 165 234 155 187 133 178 110 143 136 208 246 -9 148 184 163 194 150 190 250 129 190 252 200 125 156 246 205 194 162 170 271 185 135 334 172 194 207 196 168 198 147 248 194 148 188 155 237 163 176 145 224 210 277 255 135 122 159 153 170 157 177 202 212 120 204 246 236 141 224 228 149 374 183 177 204 159 192 185 212 351 212 161 248 119 222 255 -9 116 187 241 128 201 246 255 180 153 183 113 277 187 180 -9 196 165 163 117 210 199 158 146 171 320 229 159 241 198 183 177 244 132 245 270 231 120 244 159 180 297 265 179 278 147 264 220 276 195 249 185 271 112 263 108 282 216 257 100 300 323 245 238 298 -9 194 197 237 298 174 270 239 182 189 282 260 208 215 152 163 157 108 295 186 189 250 184 313 241 311 222 133 125 248 169 326 155 257 174 182 154 208 220 268 198 224 286 223 190 238 180 308 173 243 262 138 320 289 203 233 164 128 176 376 207 189 197 233 188 296 186 175 298 307 148 192 164 289 135 154 187 196 208 177 264 296 286 202 204 157 242 202 209 276 139 249 282 197 116 278 204 186 250 179 153 115 165 421 167 208 253 235 213 209 180 131 248 272 129 256 164 138 244 233 256 224 167 308 202 217 199 138 121 205 121 253 191 129 366 313 203 180 320 269 220 206 181 217 184 146 258 223 227 259 229 
813 601 Han China EAST_ASIA 120 -9 124 129 162 230 138 120 180 98 130 118 146 217 250 231 147 -9 218 194 187 143 -9 132 204 184 188 134 119 199 189 182 148 163 94 166 120 143 164 180 212 188 246 115 141 105 231 -9 271 201 236 111 117 230 196 297 181 113 89 238 192 121 132 119 160 150 251 234 88 132 260 107 155 151 109 165 234 149 187 127 178 110 134 136 205 237 -9 148 178 157 191 150 184 247 126 184 246 197 122 156 246 197 194 158 162 267 181 131 326 172 190 191 188 168 198 143 240 194 144 176 151 237 163 172 125 216 202 269 247 131 118 155 146 162 153 165 194 196 120 204 246 228 121 216 228 145 370 183 169 200 155 188 153 200 351 208 157 240 115 218 255 -9 116 175 219 120 177 242 251 180 153 179 109 277 187 180 -9 192 153 163 117 208 191 142 142 171 316 227 147 241 198 183 173 240 132 241 270 207 116 240 155 176 297 257 175 270 147 264 208 276 191 245 185 263 104 263 104 258 200 257 100 292 323 241 234 286 -9 194 193 233 294 164 262 243 178 185 278 256 184 203 152 159 141 98 291 178 185 242 184 301 237 295 210 129 125 228 157 322 155 249 170 178 154 204 204 260 186 224 282 209 174 234 168 304 143 239 262 138 316 285 199 217 164 128 176 368 207 185 189 217 168 292 174 187 294 295 140 192 160 277 131 150 163 192 184 177 264 292 270 194 188 149 242 190 201 256 135 245 282 193 116 270 204 186 246 167 145 115 149 409 167 204 245 227 209 209 168 119 248 268 121 256 164 138 240 233 256 204 159 304 198 205 199 138 111 201 121 249 191 117 362 293 191 168 308 209 216 202 177 201 180 146 258 219 227 259 205 
814 601 Han China EAST_ASIA 126 124 146 139 144 238 140 116 186 98 136 120 158 225 258 233 177 167 222 194 193 143 245 136 222 184 200 138 139 201 176 182 158 167 110 172 130 175 170 180 212 188 249 118 144 108 237 242 271 201 242 111 126 239 205 294 187 113 89 253 195 133 144 -9 163 159 263 237 88 123 266 113 -9 157 112 -9 234 161 190 130 190 113 143 136 217 249 -9 148 178 166 206 156 190 256 138 184 246 200 125 156 246 205 198 158 166 259 189 127 342 176 194 203 196 164 206 151 248 198 148 -9 159 241 159 176 141 220 210 273 251 -9 118 151 153 174 157 177 202 208 128 208 258 232 121 228 232 149 386 187 189 204 -9 188 189 204 359 216 161 240 123 218 259 238 124 187 231 132 219 242 -9 188 153 183 109 277 183 172 147 196 157 147 117 212 195 142 150 171 320 221 151 245 198 183 181 256 148 245 278 231 112 248 155 180 301 241 175 258 139 -9 224 276 191 253 185 271 104 263 104 262 212 265 100 296 323 241 246 294 158 206 209 233 282 174 266 243 186 181 282 260 208 211 156 159 165 110 287 186 189 254 184 309 241 307 210 129 129 248 169 334 163 253 170 162 154 212 220 264 206 224 286 209 174 234 168 308 173 239 266 142 320 293 211 233 -9 132 176 376 203 201 -9 233 172 292 182 179 306 307 144 192 164 293 131 158 191 192 192 177 268 296 294 198 208 149 246 198 209 268 151 253 278 197 116 270 204 206 232 175 157 111 169 421 171 204 249 243 207 221 184 131 268 272 121 284 168 142 240 233 260 220 171 308 202 209 211 134 133 205 125 241 181 125 350 297 207 180 316 245 216 206 181 -9 184 138 262 231 231 259 209 
814 601 Han China EAST_ASIA 126 116 124 135 142 230 138 112 180 98 130 114 148 223 258 233 147 163 218 194 187 143 243 130 218 184 188 134 139 199 174 180 158 163 102 166 120 171 164 180 208 188 246 115 141 105 234 236 271 195 221 96 117 224 196 288 187 113 86 238 195 121 141 -9 157 150 251 234 85 123 266 113 -9 154 112 -9 228 140 187 130 187 110 134 130 208 246 -9 139 178 166 197 156 184 247 126 181 246 200 119 148 246 201 198 158 166 259 185 123 330 172 188 199 172 164 190 143 240 194 140 -9 155 233 155 172 137 216 210 269 247 -9 118 151 153 170 149 169 198 204 128 208 242 228 121 224 228 149 378 179 181 200 -9 188 165 184 355 204 141 240 97 210 255 230 120 187 225 128 181 242 -9 172 145 179 109 269 183 164 139 196 149 139 113 210 191 142 142 171 320 215 151 233 190 183 169 248 132 237 274 207 112 240 151 180 289 241 171 258 139 -9 216 276 175 253 185 263 108 263 104 258 196 257 96 288 319 237 222 290 158 190 193 229 266 168 266 247 182 181 278 256 184 209 152 155 137 108 283 178 189 246 180 301 229 303 210 117 121 240 165 322 163 245 170 162 154 212 220 256 202 216 282 209 174 230 168 304 173 239 262 138 320 285 199 233 -9 136 172 372 203 201 -9 213 168 292 174 179 294 303 140 176 152 289 123 154 159 192 184 177 264 292 254 198 188 145 242 190 205 260 151 249 274 197 112 266 204 194 232 175 145 111 141 409 163 196 249 235 203 209 180 131 252 272 121 256 164 134 236 229 252 204 151 308 200 185 199 118 119 205 123 241 181 117 334 289 203 180 304 209 212 206 181 -9 176 138 254 227 231 259 205
815 601 Han China EAST_ASIA 126 122 146 135 158 236 142 112 182 98 140 120 148 223 268 233 167 169 218 194 187 143 -9 136 226 186 212 146 139 207 174 182 162 171 94 166 130 145 170 180 212 188 252 118 147 108 237 245 271 204 236 117 132 236 199 306 190 119 89 241 195 136 144 119 163 -9 251 237 91 126 -9 107 158 151 112 165 234 152 190 130 190 113 143 133 217 249 244 148 184 163 197 150 184 235 135 190 -9 200 119 140 246 205 202 162 170 271 197 131 342 176 -9 207 178 160 202 147 244 198 168 184 151 237 159 180 149 236 210 273 255 155 130 155 165 -9 161 169 198 208 136 212 246 224 137 228 228 149 374 183 173 204 163 192 193 208 -9 204 157 248 115 222 255 242 116 187 255 132 -9 246 255 192 149 183 113 277 191 184 139 200 161 155 117 212 191 142 146 171 320 227 159 241 198 195 181 260 148 245 -9 211 116 244 155 180 297 257 183 282 155 272 220 276 199 253 189 271 112 263 116 -9 212 269 104 296 327 241 234 298 -9 194 213 225 298 174 274 231 186 189 274 260 208 219 160 163 149 -9 291 190 193 250 184 301 245 311 214 129 129 248 165 334 163 257 174 178 158 212 220 264 -9 224 286 209 174 -9 184 304 169 251 266 154 320 293 203 249 164 128 176 380 203 201 197 233 172 304 182 175 298 303 144 196 164 293 131 154 187 192 212 177 268 304 -9 202 188 153 242 198 209 284 151 249 262 201 116 278 208 206 246 171 141 115 165 417 167 208 245 247 209 229 172 135 260 268 125 256 164 142 224 233 256 220 163 304 206 213 203 138 123 201 129 245 191 121 366 297 203 180 320 249 216 206 185 221 188 146 262 231 231 255 237 
815 601 Han China EAST_ASIA 124 116 144 129 156 234 142 112 182 98 134 120 146 217 260 233 147 165 216 194 177 143 -9 132 218 184 188 146 119 207 174 182 158 161 86 166 120 145 164 174 208 185 249 115 141 105 228 239 265 201 221 111 117 230 196 297 181 116 89 241 195 118 144 113 163 -9 239 234 85 126 -9 107 158 151 112 165 234 152 190 127 178 104 140 130 208 240 241 139 182 160 179 147 181 235 129 181 -9 200 119 140 246 201 202 158 166 263 185 123 326 172 -9 203 168 152 198 143 240 194 144 184 151 233 155 168 133 224 210 273 247 147 114 155 149 -9 153 165 198 200 124 204 242 224 133 216 224 133 370 183 169 204 147 188 129 196 -9 204 157 240 97 214 255 234 112 183 229 128 -9 238 255 188 149 179 109 277 187 176 131 196 149 155 117 212 183 142 146 171 316 199 159 237 194 195 169 240 132 245 -9 207 116 240 151 180 289 225 171 270 147 264 212 272 195 249 181 267 104 259 104 -9 208 257 100 292 319 221 230 298 -9 190 189 225 278 164 266 239 182 181 274 260 188 211 156 159 141 -9 283 186 189 246 160 297 233 307 210 129 121 224 153 318 155 245 166 174 150 204 208 264 -9 220 270 209 174 -9 176 300 143 239 262 146 316 293 191 233 164 132 172 376 203 189 193 209 172 300 182 187 294 299 136 184 148 289 131 154 163 188 184 177 264 292 -9 202 188 149 242 190 209 264 143 249 262 193 104 254 204 186 242 167 137 111 161 405 159 200 241 231 203 209 172 119 260 264 117 256 164 130 196 229 256 204 159 304 202 209 199 134 111 197 121 241 191 117 346 293 191 168 316 237 212 206 181 213 176 146 246 231 227 251 229 
817 601 Han China EAST_ASIA 126 116 124 135 160 236 142 122 188 98 142 120 152 223 262 233 173 171 218 194 189 147 -9 136 228 202 192 146 119 211 189 182 156 167 112 166 126 173 172 186 212 185 252 115 144 108 237 239 274 210 230 111 117 239 199 309 190 113 89 241 198 133 141 119 163 153 251 246 88 132 266 113 155 157 115 165 234 158 193 133 187 107 143 136 217 252 -9 148 179 163 200 156 190 250 138 196 252 200 122 152 246 201 206 158 162 267 205 131 338 172 194 199 180 164 206 147 244 202 144 196 155 237 151 172 153 224 210 273 259 151 126 155 133 170 161 173 202 204 128 204 246 228 -9 224 240 157 382 183 173 204 163 188 189 196 347 204 161 240 97 218 263 -9 120 187 235 128 199 242 259 188 149 183 113 281 195 180 -9 196 157 151 109 208 199 142 146 171 316 221 163 245 194 187 173 240 148 249 278 227 120 248 159 188 297 245 175 274 155 -9 220 268 199 253 197 267 -9 263 108 266 220 257 108 292 315 237 246 302 158 202 205 237 298 176 274 239 186 189 282 260 188 215 156 159 141 110 295 194 193 250 184 305 -9 311 226 133 125 224 153 334 167 261 174 178 154 208 216 264 198 220 286 209 174 234 184 304 169 239 266 138 316 289 203 261 168 128 176 376 207 193 197 233 188 296 182 183 310 299 144 196 152 293 123 154 191 204 208 173 268 296 266 202 192 149 250 -9 209 268 143 253 282 201 112 274 204 194 242 175 157 119 145 417 167 200 249 235 207 213 184 131 264 272 133 284 156 146 244 233 264 216 159 304 202 205 203 138 117 203 125 245 191 121 366 321 203 216 -9 253 216 210 181 205 188 146 262 231 231 271 229 
817 601 Han China EAST_ASIA 120 116 124 129 156 230 138 112 182 98 130 118 148 217 260 233 167 163 218 194 187 143 -9 132 218 184 188 134 119 201 189 180 154 163 94 166 124 145 170 182 212 185 246 115 141 105 225 224 271 207 221 96 117 230 196 291 187 113 86 241 192 121 138 116 163 147 251 234 85 123 260 107 152 151 109 156 234 155 190 130 178 101 134 130 205 246 -9 142 179 163 179 150 184 235 135 172 249 197 119 152 246 197 194 158 162 263 185 127 334 168 194 191 168 160 202 143 236 194 144 196 151 237 151 160 125 224 210 273 255 151 110 151 133 166 161 165 202 204 120 204 238 228 -9 224 232 149 374 179 169 200 163 188 153 192 343 204 137 240 97 214 255 -9 116 167 229 128 197 238 255 172 149 179 109 277 187 172 -9 196 149 147 109 208 191 142 134 171 316 215 155 241 190 183 169 240 132 237 274 211 116 236 155 184 297 241 175 258 155 -9 216 268 195 253 181 243 -9 263 104 258 212 257 100 288 311 233 246 298 150 194 205 233 298 160 266 243 182 185 278 260 184 211 156 159 141 98 283 186 181 246 180 301 -9 311 210 129 125 224 153 326 163 261 170 178 154 204 216 260 190 220 286 209 170 226 168 300 157 235 262 138 312 269 199 217 156 136 176 376 195 185 193 229 176 292 174 187 302 299 140 176 148 265 119 146 183 192 184 173 264 296 266 194 188 149 250 -9 205 264 139 253 274 201 104 266 196 186 238 163 145 111 141 417 163 200 245 227 203 209 172 115 252 264 121 256 152 134 196 233 256 216 159 304 198 185 195 138 111 195 123 245 183 117 366 301 191 180 -9 245 212 198 181 201 188 142 258 223 227 271 229 
818 601 Han China EAST_ASIA 126 128 142 135 160 230 142 -9 186 98 136 122 156 223 262 233 147 165 218 194 191 149 249 144 228 184 192 142 119 203 191 178 158 175 106 166 126 145 170 174 212 188 249 118 141 120 234 233 277 201 230 105 117 236 199 309 190 113 98 250 195 127 144 119 163 -9 263 246 91 126 263 110 155 157 118 165 234 152 187 133 187 107 146 127 -9 249 247 151 182 166 203 156 -9 253 126 199 246 200 119 152 246 205 206 166 170 267 189 135 330 172 194 203 -9 152 190 151 248 202 148 200 151 241 159 180 149 224 220 277 251 151 122 159 153 174 153 173 198 204 140 208 246 236 129 228 -9 145 382 183 197 204 151 192 189 204 359 212 141 244 115 218 267 230 120 183 243 132 205 246 259 192 129 183 109 281 -9 -9 143 196 157 147 109 214 195 154 146 175 324 225 159 249 190 187 177 256 144 245 274 219 124 244 -9 184 297 245 187 274 155 264 220 276 203 253 193 263 100 263 104 254 -9 257 -9 300 327 249 238 298 -9 194 193 229 290 170 282 239 194 189 286 264 212 219 164 155 153 -9 291 198 193 254 184 301 245 307 218 129 125 244 169 322 171 265 174 178 150 212 220 260 202 228 278 209 174 238 168 308 173 239 266 138 328 293 207 -9 164 132 184 376 207 193 189 233 168 300 182 187 298 307 144 188 164 261 123 166 187 200 208 177 264 300 -9 202 200 153 242 190 205 284 143 -9 286 201 116 278 204 198 246 175 157 111 -9 -9 167 204 249 239 213 221 180 131 260 268 125 264 168 138 248 233 268 224 159 304 206 213 207 138 -9 205 127 245 191 129 358 301 203 180 320 245 216 210 185 209 180 146 262 231 231 263 209 
818 601 Han China EAST_ASIA 124 112 124 129 142 230 140 -9 182 98 130 120 152 217 258 229 147 165 216 194 187 145 243 132 224 184 188 134 119 201 189 176 154 161 100 166 126 143 168 174 208 185 246 115 141 120 231 224 274 201 221 105 117 236 199 288 187 110 95 238 195 121 144 119 163 -9 251 234 91 126 260 107 155 151 109 162 228 140 187 127 178 107 146 127 -9 237 247 148 182 160 197 156 -9 235 126 193 246 200 119 140 246 205 202 158 162 259 185 131 326 172 194 203 -9 152 186 147 244 194 144 196 151 233 155 180 129 212 210 273 247 151 122 139 153 170 153 169 194 204 124 204 238 236 121 228 -9 145 382 183 173 204 147 188 157 204 359 204 141 240 115 206 263 230 116 175 225 128 205 242 255 172 129 179 109 281 -9 -9 131 188 153 143 109 210 191 142 134 171 324 221 155 241 190 183 169 244 132 225 274 211 120 240 -9 176 297 241 175 270 147 261 220 264 187 245 181 259 108 263 104 250 -9 257 -9 292 319 241 238 294 -9 190 193 225 266 168 270 239 186 185 278 256 184 203 156 139 141 -9 287 182 193 250 180 297 245 303 214 129 121 224 169 314 163 261 166 170 150 200 204 260 190 224 270 209 170 226 168 300 165 235 262 134 324 285 199 -9 160 136 176 372 195 193 189 209 164 296 174 187 294 303 144 176 164 261 111 158 187 196 184 173 260 296 -9 198 188 141 238 190 205 272 135 -9 282 197 100 274 204 198 246 167 141 111 -9 -9 163 200 245 227 207 209 176 119 252 264 121 256 164 138 240 233 260 204 151 304 192 213 195 134 -9 201 121 233 183 121 334 301 191 180 312 241 216 206 181 209 176 146 254 227 219 263 205 
819 601 Han China EAST_ASIA 126 116 142 137 166 236 138 120 -9 98 140 -9 148 217 260 233 167 167 218 198 187 143 253 144 222 196 190 134 139 213 191 182 160 167 104 166 126 145 170 184 212 188 261 115 141 105 225 239 277 213 236 96 138 233 196 300 190 116 98 250 195 133 -9 119 160 159 266 246 91 132 266 110 158 166 115 162 249 155 190 130 190 98 134 133 -9 252 247 151 179 166 200 162 184 250 138 196 246 200 125 140 246 201 202 158 174 267 181 135 334 176 198 207 180 156 206 151 244 206 -9 192 151 233 163 176 145 216 210 273 251 151 126 155 149 170 165 173 202 212 132 216 246 248 137 224 228 149 386 187 193 204 155 188 169 196 351 204 157 244 111 214 263 -9 120 179 229 136 193 246 255 180 153 203 113 277 187 184 -9 208 157 171 117 212 187 158 142 171 324 215 159 -9 -9 195 177 264 144 237 274 231 124 244 159 188 297 261 187 278 151 268 220 -9 199 253 185 263 108 263 104 258 -9 269 104 300 323 241 242 302 162 190 229 229 306 176 274 239 182 189 282 260 208 223 164 163 149 110 295 178 193 250 180 309 241 311 226 129 129 244 173 322 163 257 174 182 150 212 216 272 202 224 286 223 190 226 176 304 165 243 266 154 320 293 203 225 172 136 176 376 219 193 197 237 172 296 194 175 302 303 144 196 152 269 119 154 -9 200 184 169 268 296 298 -9 204 149 234 206 209 280 143 249 282 197 116 266 200 190 242 -9 149 111 161 409 167 204 253 227 213 221 180 131 260 276 129 264 168 138 240 -9 256 216 171 304 202 217 199 138 121 201 123 -9 191 129 374 293 203 180 -9 249 220 206 181 213 176 146 254 231 231 267 217 
819 601 Han China EAST_ASIA 126 116 124 127 160 230 138 120 -9 98 140 -9 148 217 250 233 147 165 218 194 185 143 247 142 218 184 188 134 119 205 183 180 158 159 96 166 126 145 170 174 212 188 249 115 141 105 225 224 274 201 236 96 117 230 196 288 190 113 98 241 195 133 -9 119 157 150 251 234 88 123 260 107 146 151 112 162 234 152 187 130 190 98 134 130 -9 246 244 139 179 166 179 150 181 235 132 193 246 200 125 140 246 197 198 158 170 255 181 127 326 168 192 203 178 152 198 139 240 198 -9 184 151 221 151 172 133 212 210 269 251 147 126 151 133 146 145 173 198 204 128 204 246 228 133 224 228 149 382 183 173 200 147 188 153 196 347 204 153 240 97 214 263 -9 112 171 225 128 189 238 255 180 129 179 109 277 183 176 -9 196 149 151 109 210 187 146 126 163 312 205 151 -9 -9 183 165 244 132 225 274 227 120 240 155 188 293 241 171 274 139 260 208 -9 183 249 181 263 108 263 104 250 -9 265 96 296 323 225 230 298 154 190 193 229 302 168 274 239 178 181 282 260 196 211 164 155 145 98 291 178 185 242 180 297 237 299 210 125 121 244 169 322 151 253 170 174 150 212 212 256 202 220 282 209 174 226 168 296 161 239 262 142 320 285 199 217 168 136 176 372 207 173 193 229 168 292 174 199 298 303 144 192 144 265 119 154 -9 196 184 169 264 296 266 -9 200 141 230 198 205 268 143 245 274 197 100 266 184 186 242 -9 145 111 161 409 159 200 241 227 203 221 168 119 260 276 117 256 160 134 204 -9 252 204 159 304 196 185 199 138 119 201 123 -9 191 117 370 289 203 180 -9 245 216 198 173 197 176 138 246 227 227 255 205 
820 601 Han China EAST_ASIA 126 128 144 129 156 232 138 -9 182 98 130 120 148 225 264 235 165 167 218 196 193 147 251 136 218 184 208 144 139 213 191 184 158 171 90 172 130 145 170 180 212 188 249 115 141 105 237 242 271 210 236 96 138 239 205 300 187 116 98 241 195 136 132 119 163 159 257 252 91 126 266 116 155 166 121 168 234 140 187 130 190 110 146 139 214 252 244 148 179 175 179 156 190 256 135 196 246 200 122 156 246 205 202 158 174 259 185 127 342 176 194 199 204 160 202 147 240 194 144 192 155 241 155 180 133 228 210 277 255 151 130 151 157 166 157 181 -9 212 128 208 258 236 -9 228 232 153 382 187 201 200 159 188 193 204 371 204 141 256 119 226 267 -9 124 183 235 128 193 242 255 192 145 183 109 281 191 180 -9 196 157 159 121 212 199 154 154 171 324 213 159 249 194 187 169 -9 132 245 274 231 120 244 155 192 301 261 183 274 159 268 220 276 203 253 185 263 112 263 104 258 216 261 104 292 323 245 246 302 -9 206 193 233 282 174 278 235 182 189 274 260 188 215 164 159 157 110 287 194 205 250 184 313 245 307 230 133 125 240 169 322 163 253 170 182 154 212 216 264 198 224 266 213 174 226 180 300 173 259 266 150 320 257 199 257 160 132 200 372 203 193 189 233 184 296 182 175 302 307 148 176 164 289 131 158 195 200 204 173 268 296 270 202 204 149 242 198 213 276 135 -9 282 201 116 274 200 198 250 171 173 111 165 417 167 204 249 227 209 213 172 135 260 276 121 256 160 146 244 233 260 224 171 308 202 213 203 142 111 203 129 245 191 121 -9 293 215 180 316 241 216 206 181 209 184 150 250 231 235 259 221 
820 601 Han China EAST_ASIA 120 116 124 129 144 230 138 -9 180 98 130 120 148 217 258 235 147 165 218 194 175 145 251 136 208 184 188 134 119 201 183 178 158 171 90 166 130 145 168 180 212 185 246 115 141 105 234 239 268 201 221 96 132 233 199 297 184 113 89 238 192 133 132 119 160 150 251 234 88 126 263 110 152 157 115 165 234 140 187 127 190 104 143 133 205 240 235 142 179 157 179 156 184 247 132 181 246 200 122 152 246 201 190 158 170 255 181 123 334 176 190 199 198 152 190 143 236 190 144 188 155 233 151 172 129 216 200 273 251 151 126 151 153 166 153 173 -9 212 124 208 242 228 -9 224 224 149 378 187 185 200 159 188 193 196 351 204 141 244 97 216 267 -9 116 167 225 128 193 234 255 188 129 183 109 277 187 176 -9 196 157 143 113 208 195 142 142 159 320 207 155 237 194 187 165 -9 132 237 274 223 120 240 151 184 293 237 175 270 139 264 208 260 191 245 181 259 104 259 104 258 200 257 96 292 323 241 242 298 -9 194 181 233 266 164 270 239 178 173 270 256 184 215 148 143 141 106 283 178 193 242 180 301 237 299 214 121 125 240 165 322 163 245 162 162 150 212 212 260 198 224 266 209 174 226 168 300 165 235 262 146 320 257 199 233 156 136 180 372 203 193 181 229 164 296 170 179 298 307 140 176 148 261 127 154 187 188 192 169 260 292 262 194 204 149 234 190 205 276 135 -9 278 197 116 258 180 190 228 167 141 111 161 417 163 200 249 227 203 209 164 111 260 272 109 256 156 146 240 229 256 204 159 304 200 185 199 138 111 201 125 245 187 117 -9 293 191 168 304 209 216 198 181 201 176 146 246 227 227 255 205 
821 601 Han China EAST_ASIA 124 134 144 129 170 230 138 120 188 98 130 120 152 223 258 233 167 169 222 194 189 143 -9 128 224 200 190 144 139 207 191 180 158 163 102 166 126 143 170 184 212 188 261 115 141 108 237 245 271 210 239 96 126 236 199 297 190 116 98 241 192 121 141 119 163 159 263 249 91 132 266 113 158 157 118 165 234 146 190 133 193 110 140 127 205 240 -9 148 179 169 188 156 199 250 138 190 252 200 125 152 246 -9 202 162 170 259 189 131 338 180 192 207 202 -9 202 147 248 198 152 188 155 237 159 168 137 220 210 277 251 147 130 155 149 166 153 173 202 208 128 208 254 228 149 228 232 153 378 187 177 204 159 192 185 204 359 212 157 240 119 214 255 234 120 187 245 136 193 242 259 188 149 199 109 269 191 184 143 192 157 163 113 212 199 158 146 171 324 215 163 245 194 191 177 260 144 237 278 235 124 248 159 180 301 257 175 274 151 -9 220 264 195 249 185 255 104 263 108 274 224 269 104 300 323 245 230 302 158 198 -9 233 302 174 278 239 186 189 282 260 204 219 164 159 157 106 287 182 193 250 184 309 245 303 214 133 125 248 157 326 159 269 174 178 154 212 216 264 198 220 282 213 190 234 168 304 173 239 270 146 320 289 211 237 164 128 180 376 211 185 197 229 172 304 198 175 306 307 144 192 164 293 131 154 191 200 196 177 272 296 294 198 204 157 246 198 213 268 135 253 282 201 112 274 200 202 246 167 157 115 161 417 175 204 249 235 203 213 180 131 256 268 133 264 164 150 244 229 256 208 159 308 202 213 207 134 119 205 127 245 181 117 370 305 203 204 320 269 216 206 -9 213 188 150 262 227 231 263 225 
821 601 Han China EAST_ASIA 120 124 124 129 142 230 138 120 180 98 130 120 148 217 250 233 167 167 216 194 187 143 -9 128 206 184 190 136 137 207 191 174 154 163 100 166 120 143 170 180 212 185 252 115 141 108 234 224 271 201 221 87 117 227 199 297 187 113 89 241 192 121 132 119 157 156 251 246 91 126 245 113 158 154 115 165 234 140 187 130 178 98 134 127 205 240 -9 148 179 160 179 150 184 235 126 187 246 197 119 152 246 -9 198 162 170 259 185 127 330 176 190 203 168 -9 198 143 248 198 144 184 151 233 155 168 137 200 206 273 251 131 126 139 149 166 146 169 194 204 124 204 242 228 121 212 228 149 374 183 173 204 147 192 173 196 347 208 157 240 111 210 255 230 116 183 233 132 189 238 251 172 129 183 109 269 187 180 131 192 149 151 109 212 187 142 134 163 320 215 159 233 194 187 169 236 132 237 274 207 116 240 155 176 293 241 171 270 143 -9 216 264 187 245 181 247 108 263 100 254 196 257 100 292 323 245 230 294 158 194 -9 229 294 168 270 243 182 185 270 256 192 215 156 155 149 98 287 166 189 250 180 301 233 303 214 133 125 240 153 322 155 241 162 170 150 204 208 264 190 220 282 209 174 234 168 300 143 235 266 130 320 257 203 229 160 136 180 372 195 185 189 209 164 300 190 183 294 303 144 192 144 269 119 150 179 196 184 169 260 292 262 194 192 149 238 198 205 252 135 245 274 193 104 254 180 198 238 167 137 115 145 409 159 200 245 231 199 209 172 131 252 268 121 256 156 142 200 225 248 204 151 304 202 185 207 134 119 201 121 237 181 117 362 297 191 180 320 265 216 206 -9 197 180 138 258 227 227 255 221 
822 601 Han China EAST_ASIA 126 128 124 137 160 234 146 112 -9 98 132 -9 150 223 262 241 147 165 218 200 183 143 245 140 228 184 200 134 139 207 191 186 158 167 110 166 120 147 170 184 -9 191 249 118 150 123 237 242 277 210 236 96 126 239 199 306 184 116 98 241 192 136 138 116 163 159 263 234 91 126 266 107 161 166 124 168 240 158 193 130 190 122 140 139 214 249 241 148 179 172 194 159 199 250 138 193 255 200 119 152 246 205 206 158 166 263 205 127 350 172 196 195 194 164 202 147 244 202 144 188 155 237 155 -9 149 236 206 281 259 147 122 159 161 170 157 173 202 204 128 204 242 228 133 228 236 145 390 187 189 212 163 192 185 212 367 212 149 240 115 218 267 234 120 183 239 136 205 238 263 180 149 183 117 281 191 176 139 204 161 163 -9 216 195 142 154 179 324 229 159 -9 -9 187 173 260 148 233 270 211 116 244 163 180 297 257 -9 274 151 268 220 280 195 -9 189 267 108 263 108 262 200 265 100 296 327 241 238 -9 158 198 213 245 278 168 -9 235 182 185 278 264 188 219 172 159 145 102 295 202 193 250 184 317 241 303 218 -9 133 244 169 322 155 257 170 178 158 208 -9 268 202 220 282 209 190 234 -9 304 161 239 262 154 320 285 199 233 160 140 180 372 203 185 185 233 176 296 182 -9 298 303 144 192 164 293 119 154 183 196 204 177 264 296 270 202 200 157 242 198 209 256 151 253 282 201 116 270 204 190 250 171 169 111 165 421 163 200 257 235 213 221 176 131 256 268 133 264 168 142 236 233 264 216 171 308 198 209 199 138 119 205 129 245 191 117 346 297 203 216 316 209 220 206 181 209 184 146 262 -9 227 259 225 
822 601 Han China EAST_ASIA 126 116 124 129 142 230 140 112 -9 98 130 -9 148 217 258 233 147 165 218 196 177 137 243 128 204 184 188 134 119 201 176 180 158 163 86 166 120 143 164 180 -9 185 246 115 141 108 237 239 274 201 221 96 117 230 196 288 184 113 95 241 192 133 138 113 163 150 251 237 91 123 260 107 152 151 121 165 234 140 187 130 187 104 137 127 208 243 241 148 179 166 179 153 184 250 138 187 246 200 119 152 246 197 206 158 162 259 189 123 330 168 194 191 178 160 190 147 232 198 144 188 151 225 155 -9 141 216 200 273 255 147 122 155 161 170 145 173 202 204 124 204 242 224 129 228 224 145 386 183 173 204 163 188 157 184 351 208 141 240 111 214 263 230 116 183 237 120 197 238 259 172 149 183 109 277 187 176 131 200 161 143 -9 208 191 142 134 171 312 221 155 -9 -9 179 173 244 148 225 270 207 112 240 151 180 297 245 -9 258 147 260 216 272 187 -9 185 263 108 263 108 254 196 261 96 296 323 241 226 -9 158 194 193 233 266 168 -9 235 178 181 278 256 184 215 156 155 145 102 291 182 177 242 180 309 241 299 214 -9 125 224 169 314 155 245 166 174 150 204 -9 264 198 216 266 209 178 230 -9 300 157 235 262 142 316 285 199 225 160 140 176 368 195 181 181 233 176 296 170 -9 294 303 140 176 144 265 115 150 163 192 192 177 264 292 266 198 200 157 234 198 197 252 139 249 278 197 112 270 204 186 228 167 141 111 165 409 163 192 249 231 209 213 172 119 252 264 125 256 164 138 196 229 260 204 167 308 196 185 199 138 111 203 123 241 181 117 334 293 191 180 316 209 216 206 181 201 180 142 262 -9 227 259 225 
971 601 Han China EAST_ASIA 124 116 148 137 144 230 140 124 188 106 130 122 148 217 258 233 165 171 218 194 189 145 251 136 228 184 204 138 139 207 189 184 156 167 102 172 -9 145 170 182 212 191 249 115 147 120 234 245 271 207 236 111 117 233 199 312 187 113 98 241 195 133 144 113 163 153 266 234 88 132 266 116 155 157 115 165 234 158 190 136 193 113 143 133 217 252 -9 148 -9 163 194 156 -9 247 138 187 249 197 119 140 246 205 198 166 170 259 193 131 342 176 204 207 178 168 198 155 244 194 144 188 155 241 159 176 133 -9 206 273 259 147 126 163 157 170 161 165 210 212 128 212 246 228 141 228 228 153 382 183 189 204 163 192 197 200 359 224 157 240 115 218 263 238 116 187 241 132 205 242 259 188 153 187 125 281 187 180 147 204 161 147 117 212 191 142 146 175 324 211 155 245 194 195 169 260 144 245 282 223 116 240 159 188 297 265 175 274 163 -9 216 276 199 245 185 259 108 263 104 262 220 269 108 296 323 245 242 -9 158 202 193 233 306 174 270 227 186 189 278 264 188 219 160 155 149 106 287 186 193 246 184 309 245 319 214 133 125 244 153 334 167 253 170 178 154 208 212 264 198 228 278 209 178 230 168 304 169 235 266 166 324 289 203 233 164 140 176 376 207 193 197 233 180 300 186 183 302 303 144 196 160 265 131 154 171 196 212 177 264 300 266 202 204 153 242 202 213 252 151 253 286 201 116 270 208 198 242 167 153 111 169 405 167 204 249 235 209 217 176 131 264 276 129 264 164 138 244 229 260 224 159 308 202 221 203 138 119 203 127 -9 191 117 374 305 203 216 -9 265 212 206 -9 209 184 146 254 239 235 263 221 
971 601 Han China EAST_ASIA 124 116 124 129 142 230 138 112 188 98 130 120 148 217 250 233 165 167 216 194 187 143 243 128 204 184 188 134 119 205 183 180 154 163 102 166 -9 145 170 174 208 188 246 115 141 108 225 233 271 201 236 96 117 233 199 306 181 113 86 238 195 121 132 113 157 153 263 234 88 123 260 116 155 157 109 165 234 140 187 130 190 104 140 130 208 246 -9 145 -9 160 179 156 -9 247 135 187 246 197 119 140 246 197 194 162 170 255 185 123 338 168 202 203 178 156 198 147 244 190 144 188 151 233 159 172 133 -9 206 273 259 143 122 139 153 150 157 161 194 212 124 204 242 208 121 228 224 149 378 183 177 204 159 188 157 192 351 216 149 240 97 214 255 234 116 175 225 132 177 238 259 180 153 179 109 277 187 176 131 192 157 135 113 208 191 142 138 159 324 209 155 245 194 187 165 260 132 225 278 207 112 240 155 184 297 225 175 258 151 -9 208 276 191 241 185 259 108 263 104 246 200 265 96 292 319 241 230 -9 158 190 185 229 270 172 262 231 178 181 278 260 184 207 160 151 141 102 287 182 185 246 176 301 237 299 214 129 121 240 153 326 163 241 170 174 150 204 208 260 186 216 278 209 174 226 168 304 165 235 262 158 316 285 199 229 152 140 176 376 207 185 185 209 164 300 186 183 302 299 140 192 148 265 127 150 159 188 184 165 256 296 266 198 192 149 238 202 201 252 135 245 274 197 112 270 204 190 242 163 149 111 149 405 159 200 245 227 207 213 168 115 264 268 121 256 156 138 240 221 256 208 151 304 198 209 203 138 119 201 119 -9 181 117 338 301 191 168 -9 209 212 202 -9 197 184 142 246 231 235 263 205 
972 601 Han China EAST_ASIA 126 126 124 129 144 234 142 112 188 98 130 120 152 225 260 233 169 165 218 194 191 -9 247 140 230 184 190 134 119 207 191 180 158 163 104 166 120 145 176 184 208 191 249 127 147 105 240 242 271 210 236 108 132 239 205 309 187 116 98 256 195 127 144 119 166 159 251 249 91 123 266 107 158 157 109 165 237 152 187 133 187 113 143 130 217 252 247 142 179 166 197 156 190 250 138 190 252 197 125 148 246 205 202 158 170 259 189 135 346 176 194 203 178 164 202 147 244 202 144 192 155 237 155 172 145 228 210 273 251 151 126 163 153 150 153 165 198 204 128 208 238 232 -9 228 224 149 386 187 177 204 159 188 185 196 371 204 141 240 119 214 259 234 120 183 237 136 193 242 255 188 153 179 109 281 191 180 131 196 153 159 121 216 199 146 150 175 324 229 155 241 -9 195 185 244 148 237 274 211 132 248 163 188 297 241 171 274 143 260 224 276 199 253 185 267 108 263 108 278 216 257 100 300 323 241 250 302 162 198 193 233 294 164 -9 235 182 189 274 264 204 215 164 159 149 110 291 198 189 250 184 321 245 307 230 133 125 244 -9 330 163 253 170 178 154 208 220 260 206 220 282 213 182 230 -9 308 161 255 262 158 328 285 207 257 164 128 176 376 215 193 197 213 176 304 194 175 302 307 140 196 164 289 119 158 183 192 212 173 268 304 294 198 196 157 246 198 209 268 139 249 282 197 116 258 204 198 246 167 149 115 161 421 159 204 253 231 205 221 176 131 264 272 133 264 168 146 244 233 264 220 167 304 198 185 199 138 121 205 127 245 191 129 362 297 203 180 312 265 216 206 177 217 188 146 262 -9 231 259 217 
972 601 Han China EAST_ASIA 126 124 124 129 142 230 140 112 186 98 130 120 146 217 258 233 165 165 218 194 187 -9 247 138 226 184 188 134 119 207 183 180 158 163 100 166 120 143 170 182 212 188 249 115 141 105 234 224 271 195 221 96 126 236 196 309 184 113 95 241 195 121 138 116 157 150 251 234 85 120 263 107 155 151 106 162 234 149 187 133 178 104 134 130 208 240 227 139 178 160 179 147 190 238 126 187 246 197 119 140 246 197 202 158 162 255 181 131 342 172 190 199 168 160 186 135 240 194 144 192 155 237 155 172 129 224 206 265 251 131 126 155 149 150 145 165 198 200 120 208 238 212 -9 228 224 145 374 187 173 200 151 188 181 192 359 204 137 240 97 214 259 230 116 175 233 120 189 234 243 172 145 175 109 273 183 180 131 196 149 143 113 204 191 142 146 171 320 223 147 237 -9 187 169 244 144 237 266 207 116 236 163 184 297 241 167 258 139 256 208 268 191 253 185 263 108 263 104 270 212 257 100 288 323 229 238 294 158 174 189 233 274 164 -9 239 178 189 270 264 184 205 144 155 141 98 287 186 185 242 180 301 237 299 222 133 121 244 -9 318 163 241 166 170 150 204 208 260 202 216 278 209 174 226 -9 304 143 235 262 146 320 285 203 237 160 128 176 372 215 185 197 209 172 296 170 175 294 303 140 196 164 289 119 154 159 188 212 173 264 296 274 198 188 149 242 190 205 268 132 249 274 197 116 258 180 190 242 163 149 111 145 421 159 196 245 227 203 209 172 119 260 268 125 264 164 134 208 233 260 204 151 304 192 185 199 118 107 201 123 241 191 117 342 289 199 180 296 209 216 202 173 213 176 142 258 -9 227 219 209 
973 601 Han China EAST_ASIA 130 112 144 131 164 236 146 120 188 98 130 122 152 223 262 233 165 165 218 194 187 -9 245 140 226 184 202 138 139 -9 189 180 162 163 106 166 120 145 176 186 212 188 252 118 147 129 231 242 277 201 236 96 117 239 199 312 187 113 95 250 192 136 138 119 163 150 251 246 94 126 263 113 158 166 112 165 240 158 190 133 190 113 143 139 214 249 250 142 182 163 200 156 -9 250 135 193 246 200 119 152 254 205 206 162 170 259 189 131 338 176 196 203 180 168 206 147 244 198 148 196 155 241 163 184 141 232 206 277 251 147 126 151 157 174 165 173 198 208 136 208 254 228 133 228 240 157 386 187 189 208 163 200 201 212 347 212 141 264 119 226 263 234 124 183 239 140 193 238 255 188 145 191 129 277 191 176 139 200 153 159 117 208 191 158 150 175 320 215 159 249 190 207 165 260 148 237 278 231 120 248 167 188 297 249 175 274 163 264 224 276 199 253 189 263 112 263 104 286 216 269 104 300 323 241 246 302 166 194 213 225 274 174 -9 239 186 189 278 260 188 223 160 163 157 110 291 194 189 250 184 305 237 315 214 137 133 240 169 322 167 249 174 178 158 212 212 264 214 228 278 209 178 230 176 304 161 235 266 150 324 289 199 -9 168 132 180 372 211 193 197 233 172 296 190 183 298 303 140 188 148 289 131 150 187 200 192 177 272 300 270 202 188 149 242 198 209 272 139 253 282 201 120 274 208 198 250 171 149 115 169 413 167 204 253 231 207 221 172 131 252 272 129 264 168 146 248 233 260 220 167 312 206 209 199 138 121 205 129 253 187 117 342 297 203 180 -9 265 220 206 181 201 180 146 262 231 231 267 225 
973 601 Han China EAST_ASIA 124 112 124 129 144 234 142 114 182 98 130 120 152 217 258 233 147 165 218 194 187 -9 243 136 204 184 200 134 119 -9 176 178 162 163 86 166 120 143 174 180 212 185 252 115 141 129 228 224 271 195 230 96 117 233 199 300 181 113 89 238 192 121 132 119 157 150 251 234 94 123 260 110 158 151 109 156 234 155 187 130 178 98 134 130 208 246 244 139 179 157 179 150 -9 247 132 193 246 200 119 140 246 197 198 158 162 255 181 123 334 172 190 195 168 152 186 147 244 194 132 192 151 233 155 172 137 220 202 273 247 143 118 151 149 150 153 169 190 208 124 204 230 224 125 224 228 141 382 183 181 204 147 188 193 208 347 208 137 244 115 218 255 230 120 183 225 128 185 238 251 188 129 179 109 273 187 176 135 196 153 139 117 208 187 142 150 171 320 215 155 241 190 183 161 244 132 225 274 207 112 236 155 180 293 241 167 274 159 260 220 276 183 245 185 259 108 263 100 266 216 269 100 292 319 233 246 294 158 190 185 225 266 164 -9 239 182 185 274 252 184 215 152 159 153 98 291 182 185 246 184 301 237 303 210 129 125 224 161 314 155 245 166 174 154 208 204 260 198 224 278 209 170 226 168 292 161 235 262 138 316 289 199 -9 164 136 176 372 207 185 189 229 168 296 174 191 294 303 140 188 148 289 131 150 183 188 184 173 268 296 266 202 188 149 234 186 209 268 139 249 282 193 116 266 184 194 238 163 149 111 165 401 163 200 245 223 199 209 168 115 248 264 125 264 160 138 240 233 256 216 151 308 204 185 199 138 119 201 123 249 181 117 334 297 203 180 -9 241 216 202 181 197 176 142 258 231 227 259 221 
974 601 Han China EAST_ASIA 126 128 142 129 144 230 146 120 188 98 138 120 -9 223 264 233 -9 167 -9 194 187 151 243 140 224 184 -9 142 119 207 187 184 158 167 102 166 124 173 170 184 212 191 249 118 144 108 237 239 277 207 230 96 138 239 196 312 187 113 95 256 195 121 132 119 163 150 251 234 91 123 -9 122 158 157 118 165 234 158 190 133 190 110 146 133 208 252 244 148 178 166 179 156 190 253 138 190 252 200 119 152 246 205 202 162 170 267 189 131 334 168 190 191 202 168 206 151 248 194 148 188 159 237 159 180 141 228 218 273 255 151 122 155 153 170 157 169 202 208 128 204 246 232 141 228 228 153 386 187 193 208 159 188 193 192 367 -9 161 256 111 198 267 234 116 183 241 128 205 238 259 180 149 183 113 281 187 180 147 212 157 151 121 208 195 142 146 179 324 229 151 249 194 183 173 260 148 237 274 211 124 252 155 180 297 245 187 274 151 272 224 276 195 257 189 271 112 263 108 274 216 269 104 300 323 237 246 302 -9 202 -9 241 290 -9 274 235 190 185 278 264 196 215 156 163 157 102 287 194 193 250 184 317 241 -9 226 129 125 244 173 326 163 253 166 178 158 216 224 264 202 220 282 213 170 234 180 300 173 239 266 154 324 289 199 257 164 128 176 372 211 197 197 233 188 304 178 175 298 310 140 200 160 293 123 154 199 204 208 165 272 300 270 210 204 153 238 206 213 260 143 253 282 201 100 270 196 190 250 167 169 115 165 421 163 200 253 235 207 213 172 131 264 276 125 264 156 142 244 245 264 224 171 308 202 213 203 138 119 -9 131 245 191 117 358 309 203 180 -9 261 216 206 181 209 184 150 266 231 231 263 241 
974 601 Han China EAST_ASIA 126 124 124 129 142 230 142 114 186 98 132 120 -9 217 262 233 -9 167 -9 194 185 143 243 132 218 184 -9 134 119 207 183 180 158 161 94 166 124 143 168 180 212 191 249 118 141 105 234 224 271 204 221 96 126 236 196 294 187 110 89 253 192 121 132 113 157 150 239 234 85 120 -9 110 152 157 109 165 234 158 187 130 190 104 134 130 205 243 227 139 178 163 179 150 181 247 132 187 246 200 119 140 246 201 202 158 162 251 185 123 322 168 186 191 178 156 186 147 244 194 144 188 155 233 155 172 137 212 206 273 243 147 118 151 133 170 153 169 198 192 124 204 242 224 129 224 228 145 374 187 177 204 147 184 157 192 347 -9 137 240 97 198 263 234 116 183 231 120 201 238 259 180 129 183 109 281 187 164 143 196 157 151 117 208 191 142 142 171 316 199 151 245 194 183 165 240 144 225 270 211 112 244 155 176 293 241 179 270 151 264 220 268 179 253 189 259 112 259 104 250 212 265 100 292 319 233 234 294 -9 194 -9 233 290 -9 274 243 186 185 278 260 188 207 148 159 153 98 287 182 185 246 180 301 237 -9 218 129 125 240 153 322 163 249 162 174 154 204 216 256 198 220 282 209 162 230 168 300 161 235 266 142 316 285 199 241 160 132 176 364 195 193 185 229 172 296 174 179 298 303 136 192 152 269 119 154 187 192 184 173 260 300 266 194 200 153 238 198 213 256 135 245 282 197 100 266 196 190 228 167 165 111 145 405 163 192 253 235 207 209 168 119 248 264 121 256 152 134 236 233 252 220 151 308 202 185 203 118 111 -9 125 245 183 117 358 305 203 180 -9 209 216 206 173 209 184 146 258 227 231 255 221 
975 601 Han China EAST_ASIA 126 128 142 129 156 236 142 126 -9 106 140 120 152 217 258 233 167 165 220 200 187 -9 247 132 226 -9 204 148 139 -9 189 182 162 167 108 166 130 147 174 180 212 191 249 115 141 108 234 245 271 201 221 111 138 233 199 300 190 113 95 250 195 121 144 113 163 153 266 246 91 123 266 110 158 154 115 165 234 158 190 136 190 104 146 133 217 255 247 148 185 172 200 156 190 250 141 193 255 200 125 152 -9 197 -9 166 166 259 189 131 338 168 192 203 186 160 198 147 244 206 156 188 -9 237 167 176 141 224 214 277 251 151 126 163 161 170 157 181 206 204 132 208 238 228 -9 228 228 149 390 187 173 204 163 196 157 200 355 204 157 256 119 226 263 234 120 183 243 -9 197 242 255 192 153 195 109 281 191 180 131 196 153 147 113 212 191 146 146 175 324 229 -9 237 198 187 169 260 152 245 274 215 116 248 151 184 297 261 175 274 167 268 216 276 207 253 189 263 116 263 112 278 212 265 104 296 323 241 230 294 166 210 185 233 290 164 -9 239 182 185 286 264 204 227 152 163 161 108 287 186 185 -9 184 301 237 303 210 137 133 244 -9 326 163 261 174 186 150 208 220 264 214 224 286 223 190 234 -9 308 173 239 270 162 320 293 199 261 164 128 184 372 207 185 189 209 176 300 182 175 294 303 144 188 164 289 131 158 187 196 208 169 264 296 286 202 188 149 246 202 209 284 151 249 290 213 116 266 200 202 -9 183 157 115 145 421 167 208 257 235 213 213 172 139 268 264 125 256 168 142 236 233 260 220 171 308 202 205 203 138 117 201 127 249 181 129 358 297 203 180 308 209 216 206 181 205 184 146 262 235 235 275 225 
975 601 Han China EAST_ASIA 118 116 142 129 142 230 140 112 -9 98 130 118 152 217 250 233 147 165 218 194 183 -9 243 128 218 -9 188 134 119 -9 189 176 152 167 94 166 126 147 168 180 212 188 249 115 141 105 231 224 265 195 221 96 132 230 196 297 184 113 86 238 192 121 132 113 163 150 239 234 91 120 257 107 155 151 109 156 234 158 187 133 187 104 146 130 214 249 241 142 179 163 179 156 190 235 138 193 246 197 119 148 -9 193 -9 162 166 255 185 123 330 168 186 199 168 156 194 143 236 198 144 188 -9 233 167 176 133 220 206 273 247 147 122 139 153 166 153 173 206 196 124 204 238 228 -9 212 228 145 378 187 173 200 163 188 153 192 347 204 153 240 97 214 255 234 116 183 237 -9 189 238 255 188 149 175 109 281 191 180 131 188 153 143 113 204 187 142 142 171 320 215 -9 237 190 187 165 256 132 229 274 211 116 240 151 180 297 241 167 270 151 268 216 272 195 245 185 259 108 263 104 254 212 257 104 288 323 237 230 290 150 194 185 233 274 164 -9 239 182 185 278 260 184 219 148 151 141 106 287 178 185 -9 184 297 229 299 210 129 125 240 -9 314 163 241 162 178 150 204 212 260 198 220 286 209 178 234 -9 296 173 239 262 150 320 257 199 233 164 128 172 368 199 185 185 209 168 296 178 195 294 303 132 176 164 265 127 154 183 192 184 169 264 288 270 198 188 141 238 202 205 264 142 245 262 197 100 262 180 198 -9 171 141 111 141 417 163 204 245 231 203 209 168 119 252 260 125 256 164 142 204 225 256 216 167 304 200 185 195 126 111 201 127 245 181 117 342 289 191 180 296 209 216 198 177 201 176 142 246 231 227 259 225
976 601 Han China EAST_ASIA 124 128 146 135 164 230 140 120 186 98 138 120 156 217 258 235 175 167 218 194 187 -9 257 136 218 184 190 134 119 -9 189 184 158 163 94 172 126 147 172 184 212 188 249 115 141 126 231 236 271 213 239 111 141 236 205 315 187 116 95 253 195 127 132 116 163 153 266 249 91 132 266 110 155 157 109 165 234 140 187 130 190 107 143 139 217 252 244 142 188 169 203 156 190 247 138 193 252 200 125 152 250 205 202 158 166 259 193 131 342 176 200 207 178 152 202 143 244 198 148 200 155 241 163 180 141 212 210 273 255 147 118 163 153 170 157 177 198 208 140 212 246 232 -9 228 232 157 390 187 193 204 155 188 165 196 367 212 161 240 119 218 263 -9 120 187 243 -9 181 242 255 192 145 183 121 281 187 184 -9 204 161 151 121 212 183 142 154 183 324 217 159 245 190 187 177 244 144 245 282 219 124 244 159 184 293 245 187 270 155 268 220 276 195 253 185 271 112 263 104 282 216 273 104 296 331 241 230 294 158 194 189 233 290 168 278 239 182 189 278 268 208 215 152 159 153 104 295 190 185 250 188 309 249 307 214 133 129 248 -9 326 167 257 170 182 154 212 224 268 202 224 278 223 190 238 168 308 165 263 266 154 320 293 203 233 168 128 176 376 219 193 197 245 184 300 190 183 302 307 144 196 164 293 131 162 187 192 212 177 268 300 266 202 208 153 246 198 209 268 147 249 282 201 116 262 184 206 242 167 161 115 161 417 163 208 249 231 213 217 184 131 260 272 121 284 172 134 240 237 260 216 159 308 202 209 199 134 121 205 129 249 183 129 358 301 203 180 320 261 216 206 177 209 188 146 258 235 231 267 241 
976 601 Han China EAST_ASIA 120 116 142 129 144 230 140 114 186 98 130 114 148 217 258 235 173 167 218 194 187 -9 245 136 218 184 188 134 119 -9 185 182 154 161 92 166 120 143 170 180 212 185 249 115 141 108 231 224 271 210 236 96 117 233 205 300 181 116 95 241 195 118 132 113 157 153 251 234 85 123 266 107 155 154 109 162 228 140 187 127 190 107 140 136 208 252 227 139 179 160 182 156 184 229 129 190 243 200 119 152 250 201 202 158 162 255 181 127 334 176 194 207 168 152 198 143 240 194 144 184 155 225 159 172 141 200 202 265 243 147 110 151 153 170 157 165 198 204 128 204 242 228 -9 216 228 141 370 183 173 204 151 188 117 192 351 204 157 240 97 214 259 -9 116 175 237 -9 173 238 255 188 145 175 109 281 187 184 -9 192 149 143 117 210 183 142 146 171 324 215 147 241 190 187 177 240 132 225 274 211 112 240 151 184 293 241 171 270 155 268 212 272 195 245 185 263 108 259 100 254 200 269 96 292 327 237 230 290 150 170 189 233 286 168 274 239 178 185 278 260 192 215 148 155 153 98 287 178 185 250 184 297 237 303 210 133 125 244 -9 314 155 249 166 178 150 204 216 268 190 220 266 209 178 226 168 308 143 235 266 146 320 289 199 229 160 136 172 372 199 185 193 209 176 296 190 187 298 303 140 176 152 261 119 162 171 188 208 165 268 292 262 202 188 149 242 190 201 252 135 245 274 197 116 254 180 202 234 163 137 115 141 405 163 200 245 227 207 201 176 119 252 272 117 256 160 134 196 233 256 208 159 304 202 185 199 134 111 197 125 245 181 117 354 293 191 180 308 209 216 202 177 209 176 142 254 231 223 259 221 
977 601 Han China EAST_ASIA 124 128 124 141 156 236 142 120 182 104 130 118 152 225 262 233 173 167 218 194 187 -9 243 144 230 184 188 146 -9 -9 183 184 158 165 -9 166 130 145 168 180 212 188 249 115 150 105 234 224 274 213 221 105 141 239 205 306 190 110 95 256 195 121 132 119 157 153 251 234 91 129 266 116 158 157 124 -9 234 158 190 133 193 107 140 127 208 246 244 148 -9 160 197 156 190 253 138 196 252 200 125 152 254 197 202 158 170 259 189 127 342 176 194 207 204 160 202 151 252 194 144 196 155 237 159 176 141 216 210 -9 255 151 122 163 153 178 161 169 202 204 144 208 254 224 141 224 228 145 374 183 177 204 163 196 189 196 351 220 165 244 111 218 263 238 124 175 239 -9 193 246 259 192 149 183 125 281 195 180 143 196 153 159 109 212 191 146 154 159 324 205 159 249 190 187 173 256 132 237 282 219 120 236 155 188 297 241 175 274 155 268 220 276 195 245 185 263 112 263 108 262 212 261 -9 292 323 245 234 298 162 202 185 -9 286 178 266 235 190 193 286 264 192 211 164 163 157 106 287 190 189 -9 180 309 241 303 214 133 125 244 -9 330 155 261 170 178 158 208 212 268 214 224 290 209 174 234 -9 -9 155 259 270 146 -9 285 203 241 164 136 -9 372 207 193 197 233 172 300 190 183 298 303 144 196 164 281 127 150 163 192 208 177 268 300 282 198 200 153 246 198 205 268 143 249 282 201 112 270 200 198 246 167 161 115 165 413 163 204 253 231 207 221 176 131 256 268 129 256 164 150 200 237 260 224 171 308 200 213 199 142 121 205 129 249 191 -9 354 301 203 212 320 269 220 202 189 213 184 146 266 227 235 263 241 
977 601 Han China EAST_ASIA 124 116 124 129 142 230 140 112 182 98 130 114 146 223 250 233 147 165 216 194 187 -9 243 142 218 184 188 134 -9 -9 176 182 158 163 -9 166 120 145 164 180 208 188 246 115 141 105 225 224 271 201 221 102 117 233 196 306 184 110 89 241 189 121 132 119 157 153 239 234 88 123 263 110 143 157 109 -9 234 152 187 130 190 104 140 127 208 240 227 139 -9 157 179 150 181 241 126 190 246 200 119 148 246 197 198 158 166 255 189 119 330 176 190 207 186 160 202 147 240 194 144 192 151 225 151 176 129 200 210 -9 251 147 122 139 133 170 157 169 194 200 128 204 246 216 141 224 224 145 374 183 177 204 163 192 161 196 351 204 145 240 97 214 255 230 120 175 237 -9 177 242 255 180 149 179 113 277 183 180 131 196 153 143 109 212 183 142 142 159 324 203 151 245 190 187 169 248 132 233 270 211 120 224 151 176 293 241 167 270 151 264 216 268 191 241 185 263 108 259 104 262 212 253 -9 292 323 245 230 290 154 198 185 -9 282 164 266 235 182 177 282 260 188 203 156 163 141 98 283 186 185 -9 180 301 237 299 214 129 117 240 -9 314 155 245 166 166 154 208 212 260 202 220 286 209 170 226 -9 -9 143 239 262 142 -9 285 203 225 156 136 -9 368 207 189 197 209 168 296 178 191 294 303 140 192 148 261 119 146 163 188 204 165 260 296 270 190 188 141 234 186 205 264 139 245 262 197 112 270 184 190 242 163 149 111 161 405 159 200 253 227 203 209 168 119 248 260 125 256 156 142 196 217 260 216 159 304 200 205 199 134 119 203 123 229 187 -9 350 289 203 180 316 265 216 202 181 209 180 146 254 223 227 259 221 
1021 601 Han China EAST_ASIA 128 130 142 129 156 234 142 124 186 98 136 118 150 227 262 235 173 167 218 194 191 145 245 144 218 204 192 134 139 201 -9 180 156 167 106 166 124 145 170 184 212 194 255 115 141 129 237 239 271 213 236 111 117 239 196 306 193 113 95 241 195 133 144 116 163 156 251 234 91 126 -9 110 158 160 115 165 234 158 -9 127 193 110 143 136 208 252 -9 148 179 163 197 156 190 250 141 193 252 197 119 152 246 205 202 166 166 263 193 127 334 176 194 207 184 164 202 147 252 202 148 196 155 241 163 176 149 236 210 277 255 155 122 167 149 174 161 169 202 204 124 208 250 232 141 228 232 149 382 187 189 204 163 192 193 196 -9 -9 157 252 123 214 267 238 120 183 243 120 205 250 259 192 149 183 109 281 191 184 131 196 157 147 117 210 195 158 142 171 320 225 155 241 190 195 173 240 148 245 -9 223 124 236 163 180 293 261 175 274 155 -9 220 272 191 249 189 259 108 267 108 262 200 257 108 300 327 245 246 298 162 202 193 237 298 172 278 239 182 189 278 272 188 215 164 167 149 98 291 182 181 246 188 309 241 315 214 137 133 248 177 326 163 261 166 182 158 212 216 264 198 224 282 219 190 226 180 304 161 255 266 166 320 289 199 229 168 128 184 372 215 193 193 237 172 296 182 187 310 303 144 192 164 289 131 158 195 196 208 177 272 296 270 198 200 149 250 202 213 280 142 253 282 201 116 274 204 194 242 167 173 115 149 417 167 204 249 227 209 225 184 135 280 268 129 284 -9 142 200 237 260 216 159 304 200 209 203 138 121 205 123 245 191 117 366 297 203 204 320 265 216 210 181 205 184 138 262 231 243 255 225 
1021 601 Han China EAST_ASIA 122 128 124 129 156 230 142 122 186 98 130 114 150 217 258 233 171 167 218 192 187 143 243 140 208 184 188 134 119 199 -9 172 154 163 94 166 120 143 164 174 212 188 246 115 141 129 234 224 268 210 236 96 117 239 196 306 190 110 89 238 192 130 132 113 157 150 251 234 91 117 -9 110 155 157 112 165 234 155 -9 127 178 101 140 130 205 240 -9 145 179 157 179 150 190 241 138 190 246 197 119 148 246 197 198 158 166 259 181 123 334 176 192 203 178 164 198 143 240 198 144 192 147 237 159 172 137 228 206 273 255 151 122 159 149 166 146 169 202 196 124 204 238 212 121 212 228 141 378 183 169 200 159 188 149 188 -9 -9 157 244 115 206 259 234 120 183 239 120 181 238 255 188 145 179 109 273 183 180 131 196 153 143 113 210 183 150 138 171 320 205 155 237 190 187 165 240 132 237 -9 223 120 232 155 176 293 241 167 270 151 -9 208 272 187 249 185 259 108 263 104 262 200 253 100 288 319 241 242 274 158 202 189 233 282 164 266 243 182 185 278 256 172 215 160 159 141 98 287 178 181 242 184 305 237 311 214 129 129 244 153 322 163 245 166 182 150 208 212 260 198 216 270 213 174 222 168 296 143 235 262 134 320 289 195 225 164 128 176 372 215 189 185 233 172 296 170 195 302 303 140 176 148 273 127 146 183 196 184 169 264 296 262 194 200 141 234 198 205 252 135 245 282 197 112 258 204 190 228 167 153 111 141 405 163 200 245 223 203 221 172 131 252 264 121 256 -9 138 196 233 260 212 159 304 198 185 203 134 111 203 119 241 181 117 350 297 191 180 300 209 216 206 181 201 184 138 262 231 227 251 221 
1022 601 Han China EAST_ASIA 126 118 142 139 166 234 140 124 182 98 -9 120 148 225 260 233 147 169 218 198 187 143 247 140 230 184 188 134 139 207 191 182 160 163 94 172 120 145 172 180 212 194 249 118 -9 108 234 245 274 210 239 111 138 -9 205 297 187 113 95 241 192 136 144 122 163 156 257 246 91 132 263 113 158 157 112 165 234 155 187 133 178 110 143 136 208 246 244 148 -9 163 -9 150 190 250 129 190 252 200 125 156 246 205 194 162 170 271 185 135 334 172 194 207 196 168 198 147 248 194 148 188 155 237 163 176 145 224 210 277 -9 135 122 159 152 170 157 -9 202 212 120 204 246 236 141 224 228 149 374 183 177 204 159 192 185 212 351 212 161 248 119 222 255 234 116 -9 241 128 201 246 255 180 153 183 113 277 187 180 139 196 165 163 117 210 199 158 146 171 320 -9 159 241 198 183 177 244 132 245 270 231 120 -9 159 180 297 265 179 278 147 264 220 276 195 249 185 271 112 263 108 282 216 257 100 300 323 245 238 298 158 194 197 237 298 174 270 239 182 189 282 260 208 215 152 163 157 108 295 186 189 250 184 313 -9 311 222 133 125 248 169 326 155 257 174 182 154 208 220 268 198 224 286 223 190 238 180 308 173 243 262 138 320 289 203 233 164 128 176 376 207 189 197 233 188 296 -9 187 298 307 148 192 164 289 135 154 187 196 208 177 264 296 286 202 204 157 242 -9 209 276 139 249 282 197 116 278 204 -9 250 179 153 115 165 421 167 208 253 235 213 209 180 131 268 272 129 256 164 138 244 233 256 224 167 308 202 217 199 -9 121 205 121 253 191 129 366 313 203 180 320 269 220 206 181 217 184 146 258 223 227 259 229 
1022 601 Han China EAST_ASIA 120 116 124 129 162 230 138 120 180 98 -9 118 146 217 250 231 147 163 218 194 187 143 245 132 204 184 188 134 119 199 189 182 148 163 94 166 120 143 164 180 212 188 246 115 -9 105 231 224 271 201 236 111 117 -9 196 297 181 113 89 238 192 121 132 119 160 150 251 234 88 132 260 107 155 151 109 165 234 149 187 127 178 110 134 136 205 237 241 148 -9 157 -9 150 184 247 126 184 246 197 122 156 246 197 194 158 162 267 181 131 326 172 190 191 188 168 198 143 240 194 144 176 151 237 163 172 125 216 202 269 -9 131 118 155 145 162 153 -9 194 196 120 204 246 228 121 216 228 145 370 183 169 200 155 188 153 200 351 208 157 240 115 218 255 230 116 -9 219 120 177 242 251 180 153 179 109 277 187 180 131 192 153 163 117 208 191 142 142 171 316 -9 147 241 198 183 173 240 132 241 270 207 116 -9 155 176 297 257 171 270 147 264 208 276 191 245 185 263 104 263 104 258 200 257 84 292 323 241 234 286 150 194 193 233 294 164 262 243 178 185 278 256 184 203 152 159 141 98 291 178 185 242 184 301 -9 295 210 129 125 228 157 322 155 249 170 178 154 204 204 260 186 224 282 209 174 234 168 304 143 239 262 138 316 285 199 217 164 128 176 368 207 185 189 217 168 292 -9 175 294 295 140 192 160 277 131 150 163 192 184 177 264 292 270 194 188 149 242 -9 201 256 135 245 282 193 116 270 204 -9 246 167 145 115 149 409 167 204 245 227 209 209 168 119 248 268 121 256 164 138 240 233 256 204 159 304 198 205 199 -9 111 201 121 249 191 117 362 293 191 168 308 209 216 202 177 201 180 146 258 219 227 259 205 
1023 601 Han China EAST_ASIA 126 128 144 137 156 240 138 122 182 98 130 120 152 227 266 237 165 167 218 198 187 145 251 -9 226 184 204 138 139 207 183 180 160 169 102 172 126 145 170 182 212 188 252 115 147 108 237 242 277 207 221 96 132 236 205 -9 190 116 89 250 198 136 144 119 157 162 266 234 94 132 263 110 155 157 115 165 234 155 193 136 190 101 143 139 208 249 244 148 179 160 200 159 190 250 141 -9 252 200 119 148 246 205 202 162 170 255 189 131 350 168 192 195 168 164 202 143 248 198 148 188 159 241 159 176 137 228 206 281 255 155 130 163 153 170 157 169 202 204 136 204 246 228 137 228 -9 149 390 187 189 208 163 192 173 208 355 212 161 244 119 222 259 234 116 187 229 128 201 242 255 192 149 179 113 277 -9 180 131 208 161 143 117 216 195 154 150 171 320 221 155 241 194 199 173 256 144 241 274 211 120 244 -9 180 297 265 175 274 159 268 224 280 195 253 185 263 108 267 104 286 216 269 100 292 323 241 246 298 162 202 197 233 298 170 278 231 178 189 290 260 208 223 156 155 149 110 291 182 189 246 184 301 249 303 -9 133 129 244 169 322 163 245 174 186 158 208 220 264 198 232 282 223 182 234 168 304 169 239 262 138 320 293 199 229 168 132 180 372 211 201 189 233 176 300 190 191 302 303 140 196 164 265 123 158 199 200 212 173 264 292 298 202 188 153 238 206 205 268 143 253 278 201 116 278 204 194 246 179 165 115 169 421 163 200 253 243 209 213 180 131 264 280 125 268 172 150 228 237 264 224 167 308 202 209 203 142 119 205 125 245 191 133 366 297 211 216 312 269 216 206 185 213 180 142 258 235 227 267 233 
1023 601 Han China EAST_ASIA 124 128 140 129 144 234 138 120 180 96 130 114 146 225 250 233 147 167 216 196 187 143 249 -9 220 184 190 136 139 201 183 172 148 163 86 166 120 143 170 180 208 185 249 115 141 108 234 242 274 204 221 96 117 227 196 -9 190 116 89 241 195 121 132 113 157 150 239 234 85 126 260 107 155 151 115 165 234 152 190 130 178 98 140 136 208 243 235 142 179 160 194 150 190 247 129 -9 246 200 119 140 246 201 198 162 166 251 185 123 342 168 190 195 168 156 202 143 244 194 144 184 155 233 155 172 129 200 206 269 251 131 114 155 133 170 153 161 202 204 128 204 238 220 121 228 -9 149 374 183 185 204 159 188 157 192 355 204 149 240 119 218 255 230 112 175 225 124 193 238 255 188 149 175 113 273 -9 180 127 204 153 139 113 212 195 142 146 171 308 205 151 237 194 183 169 256 132 237 270 207 120 240 -9 180 297 257 175 258 155 260 216 268 175 245 185 259 108 263 104 266 196 269 100 292 323 233 230 290 162 170 197 233 294 164 274 235 178 189 274 260 184 215 152 155 141 106 287 178 185 242 180 297 237 299 -9 129 129 240 157 318 155 237 170 182 154 204 216 260 198 224 266 209 170 226 168 304 161 239 262 134 316 289 199 225 168 136 176 372 211 193 185 229 168 296 186 191 298 303 140 196 152 261 119 158 159 192 184 169 260 292 258 198 188 149 234 202 201 252 143 249 274 201 104 278 204 194 238 167 149 115 149 405 163 196 241 227 207 201 172 131 244 272 117 264 148 150 200 233 252 216 159 304 192 185 203 118 117 201 125 233 191 129 362 297 207 180 312 261 212 198 181 197 180 142 254 235 227 247 225 
1024 601 Han China EAST_ASIA 128 128 144 135 156 230 140 -9 188 104 130 120 150 223 264 233 173 165 222 198 187 143 243 136 218 184 208 134 119 205 189 184 158 169 100 166 124 173 174 184 212 188 249 121 141 129 234 236 271 210 221 111 -9 239 199 309 190 116 95 250 195 136 141 125 157 156 -9 246 91 123 266 113 161 157 118 168 -9 155 190 130 190 104 146 133 208 246 -9 139 182 166 200 159 184 235 126 196 246 197 122 152 246 201 202 158 174 255 -9 139 342 172 190 207 -9 164 202 147 244 194 160 200 155 237 167 180 149 220 204 281 259 151 126 155 157 174 165 165 202 212 136 208 242 232 141 224 228 153 386 187 193 212 163 200 161 196 -9 212 157 252 119 218 267 238 120 187 237 128 201 246 255 192 157 195 113 289 195 180 131 200 153 143 121 212 195 142 146 175 320 229 159 253 198 187 177 260 148 249 -9 227 124 244 155 176 297 245 187 274 139 268 220 276 187 245 193 275 108 263 108 270 216 265 -9 296 327 241 238 294 -9 198 -9 241 298 172 274 239 186 189 286 264 212 219 160 163 157 108 287 198 193 250 184 313 237 311 214 129 129 244 177 326 171 261 174 174 162 208 216 264 198 224 286 213 178 238 180 304 165 239 266 146 320 289 203 233 168 128 184 376 207 193 201 209 180 304 186 175 298 307 144 196 160 269 131 158 207 192 208 169 260 304 270 198 200 153 254 206 209 280 139 -9 278 201 116 278 -9 198 242 175 153 123 -9 -9 163 204 245 239 213 205 180 119 264 272 129 256 164 142 240 233 260 212 167 308 200 185 195 138 -9 201 125 241 191 121 366 309 191 208 316 269 216 206 181 209 180 146 258 231 231 271 221 
1024 601 Han China EAST_ASIA 126 124 124 135 142 230 138 -9 180 98 130 120 148 217 260 233 147 165 218 194 187 137 243 132 204 184 188 134 119 201 183 184 154 167 94 166 120 145 170 180 208 185 249 118 141 108 225 224 265 207 221 96 -9 218 196 294 190 116 89 238 192 130 132 113 157 153 -9 234 79 123 263 107 158 157 112 165 -9 155 187 130 187 101 134 133 208 237 -9 139 179 160 179 156 184 235 126 181 246 194 119 152 246 197 198 158 162 255 -9 127 338 172 190 195 -9 152 202 143 232 194 144 184 155 233 159 176 133 200 204 277 247 147 122 155 153 150 153 165 194 208 124 208 242 232 133 224 220 145 374 183 193 204 151 188 157 192 -9 204 153 244 119 210 255 230 116 183 225 128 197 234 251 188 149 183 113 277 187 180 131 196 149 139 117 212 195 142 142 171 316 217 155 237 198 187 169 260 148 245 -9 219 112 240 151 172 297 241 175 258 135 264 220 268 183 237 189 247 104 263 100 262 200 265 -9 288 319 241 230 290 -9 198 -9 229 266 164 274 239 174 185 278 260 204 215 148 159 157 108 287 194 185 242 180 301 237 311 214 121 125 224 177 322 159 249 170 170 150 208 208 260 198 216 266 209 178 226 168 300 143 235 266 138 316 269 203 233 164 132 176 372 203 185 193 209 176 296 182 175 298 299 140 180 148 265 123 158 191 188 192 169 260 296 262 198 188 153 246 198 205 256 135 -9 278 201 104 262 -9 190 238 171 149 111 -9 -9 159 200 245 227 207 201 176 115 260 268 125 256 164 134 224 233 260 208 151 304 192 185 195 134 -9 201 125 241 183 117 334 301 191 168 316 241 208 202 177 197 176 146 254 227 227 251 205 
1233 608 Hezhen China EAST_ASIA 126 128 140 137 158 230 140 -9 186 100 136 120 156 223 258 -9 167 165 218 -9 189 145 245 138 226 184 200 154 119 207 183 182 162 181 106 172 -9 145 170 180 212 188 249 118 147 129 240 242 271 213 230 96 126 239 199 300 190 113 95 241 192 133 141 119 163 150 263 246 91 132 257 113 158 160 118 165 234 152 190 136 193 104 -9 136 217 252 244 151 179 169 194 159 190 250 138 196 246 200 119 156 246 201 202 166 170 267 185 135 350 176 -9 203 -9 164 198 155 240 198 140 188 159 241 163 176 145 252 210 273 255 159 118 151 157 158 165 169 202 200 136 204 250 212 145 220 228 145 378 187 177 204 159 188 157 200 355 208 161 240 111 -9 267 238 116 187 241 132 189 242 -9 188 -9 179 125 277 191 180 143 196 157 167 117 208 191 142 150 163 328 215 163 241 -9 203 189 256 148 225 278 211 128 248 163 184 297 241 175 270 159 272 224 280 187 253 189 271 108 263 112 286 212 261 -9 296 323 241 246 298 -9 194 209 245 310 168 274 231 182 189 290 272 208 207 164 159 145 106 287 198 189 246 184 301 -9 303 214 129 133 248 173 318 155 253 170 178 154 208 220 268 198 228 278 209 170 234 180 300 173 -9 270 158 320 269 199 229 168 128 176 376 211 197 197 229 172 296 190 191 298 -9 144 200 168 293 127 158 203 196 196 173 264 296 290 206 200 149 242 202 209 276 143 -9 282 213 120 258 204 194 250 167 -9 115 -9 405 171 204 253 239 211 213 176 139 260 272 125 256 152 142 244 237 260 224 167 304 204 213 203 138 117 205 125 249 191 125 378 305 207 180 316 249 216 210 181 217 180 150 258 227 231 267 241 
1233 608 Hezhen China EAST_ASIA 124 116 124 129 142 230 140 -9 186 98 130 120 150 217 258 -9 163 165 218 -9 187 143 251 132 218 184 190 142 119 201 176 176 154 163 94 172 -9 143 170 180 212 185 249 115 141 108 228 239 271 207 221 96 126 236 196 291 187 113 86 241 192 121 132 119 157 150 254 246 91 126 257 110 149 154 112 162 228 140 187 127 193 98 -9 133 202 249 244 142 179 142 194 150 184 235 126 190 246 200 119 152 246 197 202 162 166 263 185 127 326 168 -9 199 -9 160 198 147 240 194 136 184 155 237 155 176 141 216 206 269 247 151 118 139 133 150 165 165 198 196 128 204 246 208 121 216 228 145 370 183 173 200 155 188 157 188 343 204 153 240 111 -9 255 238 112 187 237 124 181 234 -9 188 -9 175 117 269 187 172 131 192 153 139 109 204 191 142 150 159 320 203 135 233 -9 187 165 248 144 225 274 207 124 232 151 180 289 241 171 258 151 264 220 272 187 253 185 259 104 263 108 258 196 257 -9 296 319 241 238 294 -9 186 185 233 266 168 274 239 178 181 282 264 188 203 152 155 141 100 283 182 185 242 180 297 -9 287 214 129 125 244 169 314 155 245 170 174 154 208 216 256 198 220 266 209 170 230 172 292 169 -9 262 138 320 257 199 225 164 132 176 372 207 185 189 213 164 296 178 183 294 -9 140 196 136 289 123 154 195 192 184 173 264 296 270 202 200 145 234 198 205 260 139 -9 282 201 104 254 204 190 242 159 -9 111 -9 405 163 200 245 227 203 205 160 131 252 260 121 256 152 134 200 229 260 204 151 304 198 213 195 134 111 201 119 249 181 117 334 297 191 168 312 209 212 194 173 213 180 146 258 227 231 267 237 
1234 608 Hezhen China EAST_ASIA 124 126 144 141 160 236 142 124 186 100 130 120 152 217 260 -9 163 165 218 198 187 -9 245 136 226 184 208 134 -9 -9 176 184 162 167 106 172 124 143 170 186 212 188 264 115 141 129 234 236 271 213 233 111 117 233 196 312 193 113 95 256 195 118 138 119 163 150 263 246 97 126 266 110 158 157 109 162 246 155 190 133 178 110 146 136 208 252 -9 145 179 160 -9 159 -9 235 138 193 252 200 119 156 246 205 198 162 170 263 197 135 346 176 198 207 194 160 -9 151 248 198 144 188 155 241 159 176 145 200 210 273 251 147 126 159 -9 170 153 173 206 212 140 204 242 236 129 228 228 153 370 191 181 204 159 192 153 196 351 216 157 256 107 222 263 234 120 187 241 124 181 246 263 172 149 183 121 277 195 180 135 200 157 159 121 208 191 142 150 175 324 227 155 241 194 195 177 256 132 249 278 211 124 240 155 184 301 261 175 270 151 268 224 276 187 249 189 267 108 263 108 258 216 269 -9 -9 323 249 234 294 162 198 185 241 274 166 -9 239 182 189 278 264 188 219 164 163 145 100 295 194 197 250 184 309 237 311 218 133 133 248 157 326 159 257 170 178 162 208 224 266 202 220 278 227 -9 238 -9 300 169 259 266 154 -9 289 199 -9 164 128 176 376 215 185 197 233 172 300 190 183 298 -9 148 200 168 269 131 150 195 192 212 173 264 324 -9 206 208 153 246 198 217 284 151 249 -9 197 116 278 200 198 236 175 153 119 161 417 163 200 245 231 213 217 -9 131 264 272 -9 256 164 130 240 237 260 208 167 308 202 221 203 150 121 203 125 253 191 133 -9 309 191 180 324 265 212 202 181 217 184 142 258 231 231 267 233 
1234 608 Hezhen China EAST_ASIA 124 116 124 129 160 234 138 112 180 98 130 118 152 217 258 -9 147 163 218 194 187 -9 245 134 218 184 188 134 -9 -9 174 184 148 167 86 166 120 143 166 174 212 185 249 115 141 105 225 224 271 201 221 96 117 230 196 297 190 113 95 256 192 118 132 119 163 144 254 234 88 123 266 110 158 151 109 156 228 152 187 133 178 104 143 127 208 246 -9 136 179 160 -9 156 -9 235 126 175 246 200 119 152 246 197 198 158 170 259 185 131 346 172 196 191 168 156 -9 143 240 194 144 172 151 233 159 172 141 200 206 273 247 131 122 155 -9 150 153 165 198 196 140 200 238 236 121 228 224 141 370 187 177 204 155 188 129 192 347 204 149 244 97 222 263 230 116 187 225 120 173 242 263 172 149 175 117 273 195 176 127 200 157 151 117 208 191 142 142 175 320 215 147 241 194 187 169 256 132 245 266 207 112 240 155 180 297 257 175 270 147 264 224 276 187 245 181 263 104 263 108 258 220 257 -9 -9 319 249 230 294 162 190 185 237 270 164 -9 243 178 177 278 260 184 215 160 155 137 98 291 186 189 250 180 301 237 287 210 117 125 244 153 322 155 245 170 178 146 204 212 256 198 216 266 209 -9 238 -9 292 143 251 262 134 -9 285 199 -9 164 128 176 372 211 165 185 213 168 296 186 179 298 -9 144 176 148 261 119 146 191 192 184 173 248 296 -9 202 200 149 246 194 201 252 143 249 -9 197 116 270 200 198 228 167 145 111 137 409 159 200 245 227 207 205 -9 131 260 268 -9 256 164 130 240 229 252 204 151 304 200 209 203 138 117 203 123 249 181 121 -9 301 191 168 312 265 212 202 177 197 184 142 258 227 227 263 233 
1235 608 Hezhen China EAST_ASIA 126 128 140 137 158 230 140 124 186 100 136 120 156 223 258 241 167 165 218 -9 189 145 251 138 226 184 200 154 119 207 183 182 162 181 106 172 130 145 170 180 212 188 249 118 147 -9 240 242 271 -9 230 96 126 239 199 300 190 113 95 241 192 133 141 119 163 150 263 246 91 132 257 113 158 160 118 165 234 152 190 136 -9 104 143 136 217 252 244 151 179 169 194 159 190 250 138 196 246 200 119 156 246 201 202 166 170 267 185 135 350 176 196 203 178 164 198 155 240 198 140 188 159 241 163 176 145 252 210 273 255 159 118 151 157 158 165 169 202 200 136 204 250 212 145 220 228 145 378 187 177 204 159 188 157 200 355 208 161 240 111 230 267 238 116 187 241 132 189 242 259 188 149 179 125 277 191 180 143 196 157 167 117 208 191 142 150 -9 328 215 163 241 -9 203 189 256 148 225 278 211 128 248 163 184 297 241 175 270 159 272 224 280 187 253 189 271 108 263 112 286 212 -9 108 296 323 241 246 298 162 194 209 245 310 168 274 231 182 189 290 272 208 207 164 159 145 106 287 198 189 246 184 301 245 303 214 129 133 248 173 318 155 253 170 178 154 208 220 268 198 228 278 209 170 234 180 300 173 259 270 158 320 269 199 -9 168 128 176 376 211 197 197 -9 172 296 190 191 298 311 144 200 168 -9 127 158 203 196 196 173 264 296 290 206 200 149 242 202 209 276 143 253 282 213 120 258 204 194 250 167 153 115 165 421 171 204 253 239 211 213 176 139 260 272 125 256 152 142 244 237 260 224 167 -9 204 213 203 138 117 205 125 249 191 125 378 305 207 180 316 249 216 210 181 217 180 146 258 227 231 267 241 
1235 608 Hezhen China EAST_ASIA 124 116 124 129 142 230 140 112 186 98 130 120 150 217 258 231 163 165 218 -9 187 143 245 132 218 184 190 142 119 201 176 176 154 163 94 172 126 143 170 180 212 185 249 115 141 -9 228 239 271 -9 221 96 126 236 196 291 187 113 86 241 192 121 132 119 157 150 254 246 91 126 257 110 149 154 112 162 228 140 187 127 -9 98 134 133 202 249 244 142 179 142 194 150 187 235 126 190 246 200 119 152 246 197 202 162 166 263 185 127 326 168 196 199 168 160 198 147 240 194 136 184 155 237 155 176 141 216 206 269 247 151 118 139 133 150 165 165 198 196 128 204 246 208 121 216 228 145 370 183 173 200 155 188 157 188 343 204 153 240 111 222 255 238 112 187 237 124 181 234 255 188 145 175 117 269 187 172 131 192 153 139 109 204 191 142 150 -9 320 203 135 233 -9 187 165 248 144 225 274 207 124 232 151 180 289 241 171 258 151 264 220 272 187 253 185 259 104 263 108 258 196 -9 96 296 319 241 238 294 162 186 185 233 266 168 274 239 178 181 282 264 188 203 152 155 141 100 283 182 185 242 180 297 241 287 214 129 125 244 169 314 155 245 170 174 154 208 216 256 198 220 266 209 170 230 172 292 169 239 262 138 320 257 199 -9 164 132 176 372 207 185 189 -9 164 296 178 183 294 307 140 196 136 -9 123 154 195 192 184 173 264 296 270 202 200 145 234 198 205 260 139 253 282 201 104 254 204 190 242 159 153 111 165 405 163 200 245 227 203 205 160 131 252 260 121 256 152 134 200 229 260 204 151 -9 198 213 203 134 111 201 119 249 181 117 334 297 191 168 312 209 212 194 173 213 180 150 258 227 231 267 237 
1236 608 Hezhen China EAST_ASIA 126 128 142 139 144 236 146 120 -9 98 136 -9 156 217 262 233 163 167 216 194 171 147 251 136 226 184 190 148 119 213 191 184 162 173 108 166 126 173 170 182 212 191 249 121 -9 108 240 242 -9 210 239 105 117 -9 199 297 187 113 98 241 192 133 132 119 163 156 251 246 91 123 263 113 -9 157 112 165 234 152 202 133 193 113 140 139 211 252 247 145 185 163 194 150 184 235 141 193 252 200 125 148 250 205 206 158 178 271 189 131 342 176 198 199 198 160 -9 143 244 194 148 192 155 241 163 176 141 212 214 273 255 135 130 155 153 174 157 173 202 212 128 212 250 232 141 228 240 153 382 183 177 212 163 192 189 200 359 204 161 240 115 222 263 238 120 -9 237 -9 197 238 263 192 153 183 117 281 191 188 135 -9 157 167 117 208 195 146 154 171 320 223 159 -9 190 187 173 256 148 225 274 227 116 -9 155 188 297 241 175 258 151 276 224 276 199 249 185 259 108 263 108 286 220 273 100 296 323 245 242 294 -9 194 189 233 -9 172 274 239 190 189 -9 260 192 215 164 167 153 100 291 182 193 250 184 -9 241 303 226 133 129 224 153 330 167 257 170 174 154 208 216 268 202 228 286 223 198 234 180 308 165 255 266 158 324 289 207 257 168 136 184 376 215 197 193 237 176 296 -9 191 298 307 140 200 168 293 -9 158 195 192 208 173 268 300 270 206 204 153 250 206 201 272 143 253 286 201 120 270 208 202 246 175 153 115 169 417 167 212 -9 235 207 213 176 139 260 272 129 256 164 150 244 233 272 216 167 308 206 209 207 138 119 205 123 245 191 121 370 309 203 204 316 265 216 206 173 213 184 150 266 231 231 263 237 
1236 608 Hezhen China EAST_ASIA 120 126 126 129 142 218 138 112 -9 98 130 -9 132 217 260 229 163 163 214 194 171 137 239 136 204 184 188 136 119 205 191 172 162 167 102 166 120 143 166 174 212 188 249 115 -9 105 228 224 -9 201 221 96 117 -9 196 297 187 113 89 238 192 133 132 116 157 150 239 246 79 123 263 110 -9 154 112 165 234 140 187 130 187 104 140 133 208 252 227 139 182 160 194 150 184 235 132 187 246 197 119 140 246 201 202 158 170 259 185 127 334 172 194 195 176 160 -9 143 240 194 144 188 155 233 159 172 133 208 206 265 251 131 126 151 153 166 145 165 198 212 124 204 242 212 129 216 228 145 378 183 169 200 147 184 165 188 343 204 133 240 111 214 263 230 116 -9 225 -9 193 238 259 188 149 179 113 269 187 176 131 -9 149 151 113 204 191 142 146 163 320 211 151 -9 190 183 173 256 144 225 270 211 112 -9 151 180 297 241 175 254 147 264 220 276 195 245 185 259 108 259 108 266 200 269 96 292 319 241 230 290 -9 194 185 233 -9 164 270 239 182 177 -9 256 184 215 156 163 149 98 291 178 189 246 180 -9 237 299 210 125 129 224 153 322 163 249 166 174 154 208 208 260 190 220 278 205 174 226 168 304 143 235 262 154 320 285 203 233 160 140 172 372 207 193 189 233 176 292 -9 175 298 303 140 192 164 261 -9 154 167 192 208 165 268 296 270 190 200 141 234 198 201 256 143 253 278 201 116 270 200 198 242 167 137 115 161 417 159 200 -9 227 207 209 168 131 252 264 121 256 164 126 200 229 260 208 167 304 204 209 207 118 119 205 119 241 183 117 362 301 203 180 308 245 216 202 173 209 184 146 254 231 231 263 209 
1237 608 Hezhen China EAST_ASIA 128 128 124 129 164 236 140 -9 186 98 138 114 152 223 262 233 165 165 -9 194 187 -9 251 136 218 184 200 134 139 -9 183 184 154 171 86 172 126 173 170 186 212 188 249 115 141 132 225 239 271 210 239 96 117 236 208 297 190 113 86 241 192 133 132 119 163 156 263 246 103 126 266 110 152 157 121 162 249 155 190 133 196 116 140 133 208 249 244 148 185 160 197 -9 184 235 135 190 252 200 119 148 254 201 206 158 178 267 189 131 342 172 -9 191 -9 168 198 151 248 194 144 -9 155 241 155 180 141 236 214 273 259 131 122 155 149 170 161 169 206 216 140 204 250 232 137 228 232 153 374 187 177 -9 -9 200 185 196 351 212 161 256 115 214 267 230 120 199 239 132 197 246 -9 188 153 179 117 277 187 180 135 196 161 159 117 212 195 158 158 171 320 213 151 249 198 183 169 256 132 241 274 227 120 240 151 184 297 245 171 274 159 264 224 276 187 257 185 267 112 267 108 286 216 273 108 292 331 245 242 294 162 190 197 233 -9 172 266 231 182 189 278 260 200 215 160 163 157 100 291 194 193 246 184 313 241 307 222 137 129 248 169 326 163 249 166 182 166 212 216 264 198 224 286 223 170 234 -9 304 169 -9 266 162 316 289 207 233 168 136 176 376 211 189 201 229 176 300 186 187 298 303 140 192 164 269 127 150 195 196 208 177 268 300 274 198 208 141 238 202 209 276 143 -9 278 197 116 274 180 198 240 171 -9 119 145 -9 167 204 253 243 207 213 176 -9 260 264 -9 264 164 142 248 233 256 204 167 304 204 213 199 138 121 203 127 245 191 129 358 309 203 204 316 265 216 206 177 213 184 146 258 231 231 271 245 
1237 608 Hezhen China EAST_ASIA 120 126 124 129 164 234 140 -9 186 98 130 114 148 217 258 229 163 163 -9 194 185 -9 249 134 218 184 190 134 119 -9 183 176 148 161 86 166 126 163 166 174 212 185 249 115 141 105 222 236 271 201 236 96 117 236 199 297 184 113 86 241 189 127 132 119 157 141 239 246 94 120 260 110 152 151 109 162 234 149 190 133 193 110 137 127 205 246 235 139 179 160 194 -9 184 235 126 190 249 197 119 148 246 197 202 158 174 263 189 127 338 168 -9 191 -9 160 190 143 244 194 132 -9 151 225 155 176 129 212 206 269 247 131 118 151 149 170 145 161 206 204 124 204 238 232 121 224 228 149 370 187 177 -9 -9 192 117 192 351 208 157 240 97 206 259 222 116 187 231 128 177 238 -9 172 149 175 113 269 183 180 131 196 157 143 113 204 187 142 142 171 320 213 147 241 198 183 165 236 132 237 270 207 120 236 151 180 289 241 171 270 151 260 212 276 187 245 181 263 108 263 108 266 200 269 108 292 319 237 238 294 154 190 193 233 -9 164 262 243 182 177 278 260 184 215 160 155 137 98 287 182 193 242 180 301 233 303 214 125 121 240 169 326 159 241 166 178 150 208 212 260 198 220 286 205 170 230 -9 300 165 -9 262 158 316 289 207 229 160 140 176 368 207 189 189 229 172 296 170 175 298 303 136 176 148 269 119 150 191 192 204 173 268 296 262 194 204 141 234 190 209 256 131 -9 274 197 100 254 180 186 228 163 -9 115 141 -9 167 200 253 231 203 209 172 -9 252 264 -9 256 148 134 204 229 256 204 151 304 202 209 199 138 119 197 125 245 181 117 358 293 191 180 312 209 216 198 173 197 184 142 254 227 231 259 205 
1238 608 Hezhen China EAST_ASIA 128 128 144 135 160 230 140 124 188 106 130 120 152 223 264 -9 173 171 218 198 191 -9 249 132 226 184 206 152 -9 -9 -9 176 154 165 102 172 130 145 170 186 212 194 261 118 147 105 237 -9 274 201 221 96 132 -9 199 294 187 116 89 250 195 127 138 113 163 156 251 246 88 132 263 110 155 151 115 165 234 158 190 133 190 110 140 130 217 252 -9 148 179 160 -9 156 184 253 132 190 246 200 119 156 246 205 206 166 178 259 193 127 330 172 -9 211 182 168 -9 143 244 198 144 196 155 241 159 172 157 232 210 277 251 151 126 159 -9 166 153 177 206 216 140 212 246 220 121 228 232 149 378 187 177 204 147 192 157 204 351 216 161 240 115 214 263 230 120 183 231 120 201 242 267 192 149 183 109 277 191 176 139 208 157 167 117 212 195 146 146 171 324 219 151 245 202 187 181 256 144 245 278 219 120 240 163 -9 301 241 187 274 151 -9 224 272 195 253 189 267 112 267 108 262 216 273 108 296 319 245 242 298 166 194 209 241 290 168 -9 239 178 189 278 264 188 227 164 159 153 106 287 198 193 246 180 309 245 307 218 133 129 248 169 322 163 245 -9 174 162 208 212 264 210 232 286 215 174 230 180 300 173 239 266 154 324 285 199 233 168 132 184 376 215 193 197 209 176 -9 182 183 306 303 140 200 168 269 127 158 199 196 192 177 264 300 270 206 208 149 246 202 205 268 151 253 -9 213 116 278 -9 198 250 175 -9 115 161 421 167 204 257 235 213 217 -9 131 264 272 -9 264 164 142 240 233 252 212 167 308 -9 185 211 138 119 205 -9 245 181 129 354 305 203 180 312 265 220 206 181 209 188 146 266 235 231 263 237 
1238 608 Hezhen China EAST_ASIA 120 116 124 127 156 230 140 112 180 98 130 114 132 223 258 -9 167 167 218 194 189 -9 247 132 218 184 190 144 -9 -9 -9 172 154 161 100 172 126 145 168 174 212 182 246 115 141 105 228 -9 271 195 221 96 126 -9 196 288 187 116 86 241 192 121 132 113 157 147 239 234 79 123 263 107 152 151 112 162 234 152 187 130 190 101 134 130 208 240 -9 139 179 160 -9 150 184 235 126 172 246 200 119 156 246 197 202 166 162 255 189 123 318 168 -9 199 174 164 -9 143 236 194 144 188 155 237 155 172 133 200 196 273 251 131 122 155 -9 150 153 169 202 212 124 204 246 208 121 228 228 149 370 183 177 200 147 188 157 200 347 212 149 240 111 214 259 230 116 175 225 120 181 242 259 188 145 179 109 277 179 172 131 200 149 147 117 208 191 142 138 167 320 215 151 233 190 187 165 240 144 245 274 219 116 236 155 -9 293 225 171 274 151 -9 224 272 187 249 181 259 112 263 104 250 196 261 96 288 315 241 230 294 162 194 189 233 286 164 -9 239 178 185 270 260 184 211 152 155 149 100 287 198 193 242 180 305 237 303 214 129 125 224 157 314 163 245 -9 174 154 208 208 264 194 216 282 209 174 230 172 292 157 239 262 134 316 285 199 233 156 132 172 372 203 189 197 209 176 -9 178 175 302 303 136 188 148 261 119 154 199 192 172 169 264 296 266 194 188 141 242 190 205 252 139 245 -9 209 116 266 -9 186 228 167 -9 111 161 417 159 200 241 231 209 209 -9 127 260 264 -9 264 148 134 196 233 252 204 151 304 -9 185 199 138 117 197 -9 245 181 117 358 297 203 168 308 241 216 202 181 209 184 142 266 231 227 247 221 
1239 608 Hezhen China EAST_ASIA 126 128 126 129 160 230 142 112 182 104 130 114 156 223 264 233 169 165 218 194 187 147 -9 138 228 184 200 134 139 199 191 182 164 163 110 172 130 173 170 180 212 188 249 121 141 -9 240 242 271 201 221 96 138 236 205 315 184 116 95 241 195 136 144 119 163 156 257 234 91 132 269 -9 161 166 115 168 240 155 190 136 -9 113 140 136 208 252 244 151 179 166 179 156 196 250 141 190 252 200 119 156 246 197 202 162 174 263 189 131 334 172 194 211 182 160 -9 147 248 198 144 188 151 241 155 176 149 228 210 273 255 151 122 151 156 170 153 173 210 212 136 216 238 228 141 228 236 149 374 183 181 204 163 192 165 208 347 216 161 240 123 218 267 238 -9 183 239 128 197 242 255 192 149 187 125 269 191 188 143 204 161 147 121 204 191 158 146 171 320 233 151 249 -9 187 173 252 148 249 274 227 120 248 163 184 297 253 171 270 155 264 220 276 195 245 193 263 112 267 108 270 216 265 100 292 323 245 242 298 166 190 209 241 298 174 274 239 182 185 286 276 192 223 160 159 141 106 283 186 193 250 180 309 241 307 222 129 137 244 173 322 167 257 -9 182 154 216 220 272 198 224 286 217 174 234 176 300 173 259 266 154 320 289 207 241 164 128 180 376 211 185 197 229 172 296 174 191 302 311 140 196 164 -9 127 166 199 196 204 177 268 292 266 202 204 149 242 206 209 288 143 249 262 209 116 254 -9 198 246 163 157 115 149 405 163 200 249 235 213 213 176 119 268 272 121 256 164 138 244 233 252 216 167 308 202 209 207 142 123 201 129 249 191 129 366 305 203 180 320 269 216 206 181 221 180 146 266 231 227 267 241 
1239 608 Hezhen China EAST_ASIA 124 116 124 129 158 230 138 112 180 102 130 114 146 217 258 229 147 163 218 194 187 143 -9 136 218 184 188 134 119 193 183 178 162 163 104 172 122 143 164 174 212 188 249 118 141 -9 225 239 271 195 221 96 138 236 202 300 184 113 95 241 192 121 141 113 157 153 251 234 79 129 260 -9 158 166 112 162 228 140 187 133 -9 104 137 136 202 240 244 148 179 163 179 147 184 250 126 187 246 200 119 140 246 193 202 158 170 263 181 119 326 176 194 199 178 160 -9 147 240 194 144 184 151 237 155 172 133 212 206 273 251 131 122 151 153 166 153 169 210 212 124 208 238 228 141 228 228 145 374 183 177 192 151 192 157 200 347 208 145 240 115 214 263 234 -9 175 225 120 177 238 255 172 129 183 117 269 183 180 131 196 153 147 113 204 191 142 146 159 312 229 151 237 -9 183 173 244 132 245 274 211 112 236 155 180 297 241 163 270 139 260 220 280 191 241 181 263 108 267 108 258 216 257 96 280 319 237 234 290 154 170 185 229 266 168 266 243 178 181 278 264 188 207 156 159 141 100 283 182 177 246 180 309 237 303 210 129 125 224 165 314 163 241 -9 174 154 208 212 260 186 220 286 209 170 230 168 300 169 239 266 146 316 285 203 233 164 132 172 372 207 185 181 213 168 296 170 175 294 307 140 196 160 -9 119 158 179 192 184 177 264 292 266 198 188 145 242 202 205 272 135 245 282 197 112 254 -9 198 242 163 137 111 141 405 163 200 241 227 203 209 176 115 264 264 121 256 164 138 208 233 248 208 159 304 198 185 195 118 121 201 127 245 181 117 334 297 203 180 312 241 212 206 177 197 180 146 250 231 227 255 225 
1240 608 Hezhen China EAST_ASIA 128 128 140 129 166 236 138 124 186 98 130 120 152 217 258 233 165 167 222 194 189 147 249 140 218 208 188 134 119 201 189 180 162 167 106 166 124 147 170 184 212 191 258 115 141 129 237 242 271 213 239 96 138 236 199 297 184 -9 95 250 192 127 144 119 163 150 251 234 91 123 266 110 161 157 109 165 234 152 190 136 190 110 143 139 205 246 244 154 179 172 200 156 193 256 144 196 246 200 119 156 246 197 202 166 178 263 205 135 346 172 194 207 194 164 198 147 240 198 144 192 155 241 163 176 141 208 210 269 259 151 122 159 133 170 157 177 206 216 140 216 250 228 141 228 232 149 382 191 169 212 163 192 157 208 355 216 161 256 -9 222 263 238 116 187 235 -9 189 242 259 188 153 191 121 277 195 184 131 204 161 147 117 212 191 142 150 175 320 223 155 241 194 195 169 260 144 249 278 211 124 248 155 184 305 257 175 270 155 268 224 276 195 249 189 263 112 267 108 258 216 269 112 300 323 241 234 302 166 194 197 249 286 178 282 223 190 177 278 268 208 207 164 159 149 98 283 194 193 246 184 313 237 303 218 133 129 252 173 322 155 261 162 178 154 212 220 260 202 224 278 223 174 238 168 304 169 239 262 138 324 289 203 241 160 128 176 376 203 189 197 229 168 300 194 187 302 307 144 196 -9 265 131 158 199 196 212 165 272 296 290 202 204 153 246 206 213 260 139 249 282 201 116 274 204 198 246 171 149 119 165 421 167 212 253 235 213 221 168 131 260 268 129 260 148 134 236 233 260 208 167 312 202 213 203 150 117 205 123 249 181 133 354 301 203 204 324 245 220 206 177 217 188 142 258 231 231 271 241 
1240 608 Hezhen China EAST_ASIA 128 116 124 129 164 230 138 112 180 98 130 118 148 217 258 229 147 165 218 194 187 143 245 134 218 184 186 134 119 199 183 176 148 167 102 166 120 143 170 174 212 188 249 115 141 108 225 224 271 210 221 96 117 233 196 291 184 -9 95 241 192 121 132 119 160 144 251 234 91 123 266 107 152 151 109 165 228 152 190 133 178 101 143 127 205 246 230 139 179 160 197 156 184 235 141 193 246 197 119 152 246 197 194 158 162 259 189 131 338 172 194 207 184 156 186 143 240 194 140 188 151 237 159 172 137 200 206 265 247 147 122 155 133 162 157 173 198 204 124 204 250 224 141 216 232 149 370 187 169 208 151 184 153 196 347 204 141 244 -9 218 255 230 116 187 225 -9 173 238 255 188 149 183 109 273 187 176 131 200 153 147 109 204 191 142 142 159 320 211 135 241 194 183 165 240 132 225 278 207 112 236 155 176 297 241 175 258 155 264 216 268 195 245 185 259 108 263 104 258 196 253 108 296 319 241 230 294 162 186 197 233 278 168 262 235 186 177 278 264 188 203 152 159 141 98 283 182 181 242 160 301 233 303 218 129 125 240 157 322 155 253 162 174 154 204 212 260 202 224 278 219 174 230 168 300 169 235 262 130 320 257 203 237 160 136 176 368 203 185 197 213 168 296 186 175 294 299 140 192 -9 265 119 158 191 192 192 165 268 296 258 190 204 149 242 190 201 256 139 249 282 197 104 254 184 194 242 167 141 111 161 409 163 200 253 227 207 213 160 131 252 268 125 256 148 130 208 221 256 204 151 308 198 213 195 138 117 201 121 245 181 117 346 297 191 180 312 209 216 202 177 213 184 142 254 227 227 259 205 
1241 608 Hezhen China EAST_ASIA 126 -9 146 131 164 234 146 112 188 98 -9 120 160 217 262 233 167 165 -9 194 187 147 249 142 228 198 208 -9 139 205 191 176 158 161 114 172 122 147 170 180 212 188 249 115 141 120 -9 239 277 210 239 111 135 239 199 297 187 116 89 256 192 133 144 119 -9 162 263 246 -9 126 -9 -9 158 157 -9 171 234 158 190 133 193 113 143 133 214 249 247 151 182 166 194 150 -9 250 126 190 255 200 119 152 246 205 198 178 170 263 189 139 338 180 -9 203 178 160 -9 151 248 194 152 188 155 237 163 176 -9 256 210 281 255 147 130 151 153 170 157 177 -9 208 144 208 250 236 121 224 -9 153 386 187 189 204 159 196 157 196 -9 220 161 248 123 218 263 230 120 195 251 136 197 238 259 188 153 195 117 273 191 180 139 200 153 155 113 212 191 154 154 175 324 225 151 241 190 203 177 264 148 241 -9 211 124 240 167 188 305 249 171 274 155 268 224 280 199 249 185 267 112 263 108 282 208 273 108 300 323 249 238 294 158 202 193 237 294 168 274 239 178 -9 282 -9 188 219 172 159 149 98 295 202 193 250 180 305 241 307 214 137 129 248 169 322 163 257 -9 178 158 208 220 264 -9 228 286 217 178 230 168 304 173 -9 270 138 324 293 203 -9 168 136 180 376 203 197 -9 237 176 308 186 183 298 311 140 192 164 289 135 154 191 192 212 177 272 296 270 206 208 149 246 198 205 260 151 249 282 205 116 254 180 202 246 167 -9 111 161 -9 167 200 249 243 209 221 172 139 252 268 -9 268 -9 146 224 237 260 220 171 -9 204 209 207 146 123 203 125 245 191 133 362 301 203 180 320 265 216 214 181 -9 -9 146 262 235 231 267 233 
1241 608 Hezhen China EAST_ASIA 126 -9 124 129 144 230 138 112 182 98 -9 118 148 217 260 229 167 165 -9 194 187 143 249 138 204 184 188 -9 119 205 183 176 148 159 102 166 122 145 170 174 212 182 246 115 141 105 -9 224 274 201 239 96 117 230 196 288 184 113 89 241 192 130 138 113 -9 150 251 246 -9 120 -9 -9 155 157 -9 165 234 152 190 130 187 110 134 127 202 246 227 145 179 163 179 147 -9 247 126 187 246 200 119 148 242 201 194 158 170 255 189 127 330 172 -9 199 168 156 -9 143 244 194 140 184 155 237 155 172 -9 236 210 277 251 143 126 151 133 150 153 173 -9 196 140 204 242 224 121 212 -9 149 382 187 177 200 155 188 117 188 -9 212 161 240 97 206 263 230 116 183 243 120 193 238 255 188 149 191 109 269 187 172 131 196 149 147 109 208 191 142 150 175 324 221 151 237 190 195 161 256 132 225 -9 207 120 236 155 180 297 245 167 274 143 268 216 272 187 245 181 259 108 263 104 250 200 257 96 288 323 241 230 290 150 198 189 229 286 168 270 239 174 -9 278 -9 188 211 164 159 137 98 291 194 193 250 176 301 241 307 210 133 125 236 153 318 155 249 -9 174 158 208 216 260 -9 224 266 209 170 226 168 304 147 -9 266 134 324 285 203 -9 160 136 176 376 203 193 -9 213 176 300 170 179 294 299 136 176 164 269 119 150 187 192 208 173 264 292 266 206 204 149 238 194 205 252 135 245 278 193 108 254 180 190 242 163 -9 111 145 -9 159 200 245 223 203 213 176 119 252 268 -9 264 -9 138 204 233 256 208 159 -9 198 185 199 134 123 201 121 245 181 133 354 289 191 180 316 209 212 198 177 -9 -9 142 246 235 235 263 225
1242 608 Hezhen China EAST_ASIA 126 124 150 131 144 234 138 124 186 102 130 120 148 221 258 233 177 165 216 194 187 147 249 136 226 184 200 138 119 207 191 182 148 165 94 172 120 143 172 184 212 188 261 115 141 -9 234 242 277 213 239 105 117 239 199 297 187 113 95 241 195 130 144 116 163 141 263 246 91 126 269 122 158 151 109 165 249 155 187 133 -9 110 143 133 217 246 244 154 185 160 194 150 190 250 141 190 255 200 125 156 246 205 202 158 162 263 189 135 342 176 190 207 180 168 -9 155 248 194 144 192 155 241 167 176 145 220 210 277 263 151 134 155 133 170 157 173 198 212 128 216 250 224 137 228 228 149 382 187 173 200 159 188 157 208 351 204 161 244 115 226 267 238 120 183 229 132 193 242 259 192 153 183 113 281 191 180 131 208 153 155 113 212 195 154 154 175 324 223 155 241 198 187 181 256 144 245 270 211 128 244 151 180 297 265 187 270 155 268 -9 276 195 253 185 259 112 267 108 274 216 253 104 300 323 245 238 306 158 194 213 249 298 174 278 239 182 185 278 264 196 215 168 163 141 -9 291 202 193 250 184 309 237 307 230 137 133 244 173 326 167 245 -9 178 154 212 216 268 202 220 282 223 182 234 168 304 169 259 266 142 328 297 207 241 164 136 172 376 211 193 197 233 188 300 186 191 294 311 144 192 168 -9 135 162 187 196 220 185 264 324 286 202 208 149 242 202 209 260 139 249 278 213 116 274 204 206 242 179 169 115 173 -9 163 204 253 243 217 201 176 131 264 268 125 272 -9 146 244 233 260 224 167 308 206 213 203 142 123 205 127 245 191 133 366 293 207 216 312 269 220 210 181 209 184 146 258 235 231 271 213 
1242 608 Hezhen China EAST_ASIA 120 122 126 129 142 230 138 112 180 98 130 118 148 217 250 233 147 165 216 190 187 145 245 134 226 184 188 134 119 205 189 176 148 163 86 172 120 143 164 174 212 185 249 115 141 -9 234 236 265 204 221 99 117 236 196 288 181 113 89 238 192 121 132 116 163 141 251 246 88 120 257 110 152 151 109 162 234 155 187 127 -9 104 134 133 205 243 244 148 179 160 179 150 187 235 126 187 249 200 119 148 246 197 198 162 162 259 185 119 342 168 186 195 174 148 -9 143 240 194 144 188 143 241 159 176 145 200 206 273 255 135 126 155 133 158 153 165 194 204 128 204 238 220 129 216 228 141 382 183 169 200 147 188 117 204 351 204 157 240 111 214 259 230 116 175 225 128 185 238 259 192 149 179 113 281 187 176 131 204 153 155 109 212 183 146 150 159 316 223 151 241 190 187 169 240 132 237 270 207 120 244 151 176 289 245 175 258 151 260 -9 268 191 241 185 259 108 267 100 258 216 253 96 296 323 241 234 286 158 174 193 233 298 168 270 243 174 181 278 264 188 211 168 159 137 -9 283 178 189 246 160 301 233 299 210 129 113 224 157 322 163 245 -9 170 154 204 212 260 202 216 270 219 178 230 168 296 143 235 266 138 320 289 207 237 160 136 172 372 207 193 185 233 168 296 182 183 294 303 140 192 148 -9 119 150 167 192 192 169 264 304 270 202 188 149 234 190 197 256 135 249 274 209 100 254 204 198 238 163 149 111 141 -9 159 200 245 227 207 201 168 131 260 264 125 268 -9 138 244 221 260 216 159 304 198 185 199 138 119 201 125 241 191 129 366 289 191 180 312 261 216 206 173 205 180 138 258 231 227 267 205 
1317 611 Lahu China EAST_ASIA 126 116 124 141 160 236 138 124 186 98 130 120 156 217 262 233 167 167 222 200 189 143 255 144 230 196 204 138 119 201 -9 182 162 169 102 172 130 143 174 186 212 191 255 121 141 108 234 239 271 207 236 111 126 236 205 297 193 116 98 250 195 133 138 113 163 150 254 237 79 126 266 119 161 157 115 165 252 155 190 133 193 110 143 136 208 252 247 151 179 169 179 156 -9 256 135 187 252 200 125 152 246 201 202 158 162 263 189 127 334 172 200 199 172 168 206 147 248 206 148 188 155 233 159 172 149 244 202 277 251 131 130 151 157 170 153 177 210 208 144 208 254 228 137 216 228 149 382 187 193 204 159 188 153 192 351 204 141 240 123 218 263 230 120 183 239 132 189 250 259 192 149 195 129 277 195 184 135 208 157 143 121 212 199 154 146 171 324 225 159 241 190 187 169 260 132 249 278 227 124 248 151 188 305 241 175 274 155 268 220 276 187 249 189 263 108 267 108 282 212 261 100 296 323 245 234 306 158 206 213 233 310 174 274 239 182 189 278 268 208 223 164 155 157 110 287 198 197 250 180 309 237 311 226 133 125 248 157 326 167 249 166 174 158 208 220 264 194 -9 290 213 182 234 184 308 157 243 266 146 328 285 207 -9 164 136 180 372 211 193 193 229 180 300 198 191 306 307 140 180 172 261 135 154 163 192 208 173 264 304 294 198 208 153 234 194 209 280 139 249 286 205 116 274 204 194 246 163 -9 115 161 417 159 204 257 239 207 217 176 131 256 268 121 256 172 134 244 237 252 220 159 304 202 185 203 138 119 201 125 245 191 125 378 297 203 180 316 273 216 202 181 217 184 146 262 231 231 267 229 
1317 611 Lahu China EAST_ASIA 126 116 124 129 158 230 138 120 182 98 130 118 152 217 258 233 147 165 222 194 187 143 249 132 218 184 192 136 119 201 -9 180 162 163 102 166 126 143 166 180 208 188 249 115 141 108 231 224 268 201 230 96 117 230 199 297 187 113 95 238 192 121 132 113 163 150 239 234 79 123 260 116 155 154 109 162 234 152 190 130 178 98 140 127 205 252 241 145 179 157 179 147 -9 250 135 181 252 200 119 152 246 201 194 158 162 259 181 127 334 172 192 191 168 164 190 143 240 198 144 184 155 233 159 172 137 228 196 269 251 131 118 151 153 166 153 173 198 200 128 204 250 224 121 216 224 145 370 183 169 200 147 188 117 192 347 204 141 240 111 210 255 230 116 167 225 120 181 242 255 180 145 179 113 269 187 180 131 200 153 163 117 206 195 142 142 171 316 215 155 241 190 183 165 240 132 241 270 211 124 240 151 180 297 241 175 274 139 268 216 252 187 245 189 259 104 263 104 278 200 253 100 288 319 241 234 298 154 174 205 229 274 164 270 239 174 181 274 260 200 211 152 155 145 110 287 194 189 246 180 309 237 299 214 125 125 240 153 326 159 249 162 174 154 208 216 260 190 -9 282 209 182 226 168 308 143 239 266 138 316 257 199 -9 160 136 176 372 207 185 189 229 172 292 190 179 302 303 136 176 148 261 119 150 163 192 208 173 264 300 266 198 204 153 234 190 205 256 135 249 278 201 116 262 180 190 246 159 -9 111 145 405 159 204 245 231 203 213 176 131 252 268 121 256 164 126 236 233 248 204 151 304 196 185 199 118 117 201 121 245 183 117 342 289 191 180 308 209 216 202 177 209 180 146 258 223 231 267 205 
1318 611 Lahu China EAST_ASIA 128 112 124 129 164 234 142 122 186 98 130 118 152 217 262 -9 -9 167 216 198 187 153 251 134 218 184 204 136 139 207 191 182 148 167 102 166 126 173 -9 184 212 188 249 121 150 120 234 242 271 -9 236 96 117 233 205 294 190 113 95 244 -9 133 141 113 163 153 251 234 91 126 -9 113 161 154 118 165 234 152 190 133 190 98 143 136 208 252 241 148 182 169 179 150 184 247 132 190 246 200 128 152 246 201 166 166 174 259 189 127 334 176 190 199 202 164 -9 147 244 202 144 196 155 241 159 176 149 240 -9 281 251 151 126 151 157 170 153 173 198 208 128 212 254 232 137 228 236 145 382 187 189 208 147 192 117 196 347 212 161 240 115 226 263 230 120 179 229 128 193 242 259 172 153 183 109 281 191 188 143 208 157 143 113 212 195 154 134 171 316 225 155 253 190 187 165 260 132 -9 270 239 124 248 151 188 297 241 171 270 151 260 220 276 191 249 189 271 108 263 104 262 212 273 104 296 327 245 230 298 166 190 193 237 298 168 274 239 -9 181 -9 260 208 211 164 159 145 110 287 198 185 250 180 325 237 311 210 129 125 244 153 -9 163 265 -9 178 154 208 216 272 206 228 290 223 174 230 184 304 173 255 266 154 320 289 199 233 168 140 180 372 211 193 197 229 172 304 190 187 294 303 148 176 148 289 123 154 199 192 216 177 268 300 270 206 200 153 246 202 213 -9 139 249 282 201 116 274 180 202 246 171 165 111 161 417 167 200 249 239 217 213 -9 131 260 268 121 268 160 138 236 233 252 224 151 304 202 209 203 138 119 203 123 245 195 125 366 289 207 204 308 -9 216 206 177 209 188 150 262 231 231 267 205 
1318 611 Lahu China EAST_ASIA 126 112 124 129 140 234 140 120 186 98 130 118 148 217 258 -9 -9 167 214 194 187 149 247 132 218 184 188 134 119 199 189 176 148 163 92 166 120 145 -9 174 212 188 249 118 144 105 225 233 265 -9 221 96 117 230 205 291 190 113 86 238 -9 121 141 113 157 150 251 234 79 123 -9 107 152 154 118 162 234 152 187 130 187 98 140 136 205 249 241 139 179 163 179 147 184 235 129 190 246 197 119 152 246 201 202 166 170 259 181 127 334 176 190 199 198 164 -9 147 236 194 144 184 147 233 159 172 133 224 -9 273 251 131 118 143 133 170 149 169 198 204 124 204 242 228 133 216 224 145 370 183 177 200 147 188 117 192 347 204 157 240 97 226 255 230 120 167 221 124 189 238 255 172 129 179 109 269 191 180 131 208 157 147 109 208 191 142 134 171 316 215 155 241 190 183 165 248 132 -9 270 223 108 240 151 176 289 241 167 266 151 260 208 268 183 245 185 263 112 259 100 250 212 253 100 296 323 241 230 298 158 190 169 237 262 168 270 235 -9 173 -9 260 188 211 164 155 141 98 283 198 185 246 180 301 233 311 210 129 121 224 153 -9 155 245 -9 174 154 208 212 264 202 216 282 209 170 226 168 300 147 239 258 142 312 285 199 225 160 128 176 368 207 193 181 229 160 300 170 179 290 299 144 176 148 273 119 150 163 192 184 173 264 292 266 198 192 149 234 202 209 -9 139 245 282 197 104 270 180 202 242 163 137 111 141 409 163 200 241 227 203 209 -9 115 256 264 121 256 148 138 200 233 252 216 151 304 198 185 199 138 111 203 121 237 191 117 330 285 191 180 308 -9 212 202 173 209 180 142 258 223 231 259 205
1319 611 Lahu China EAST_ASIA 122 132 124 -9 168 230 142 124 186 98 130 120 156 217 264 233 173 167 218 198 195 149 251 138 218 -9 204 138 139 207 191 182 158 167 104 166 130 145 166 184 212 191 252 121 144 108 234 242 274 -9 221 111 141 -9 196 309 187 116 98 238 -9 133 144 125 163 153 266 249 91 132 266 110 158 157 115 165 -9 155 193 133 193 107 146 130 205 252 247 142 179 169 179 150 190 253 138 193 252 200 125 152 246 205 202 158 178 263 181 127 342 176 194 203 198 164 206 143 240 198 144 188 155 241 163 180 133 244 210 273 259 151 118 163 161 174 169 181 198 212 128 208 242 240 141 224 228 149 370 183 193 204 147 192 117 200 355 204 161 248 119 226 263 236 124 187 233 132 189 242 259 192 149 191 113 281 191 180 131 196 157 151 121 212 191 142 142 175 328 235 155 241 194 183 169 256 148 -9 274 219 120 244 163 180 301 241 175 274 163 268 216 272 187 245 193 -9 112 263 104 278 212 -9 104 300 323 245 230 298 -9 190 193 233 294 174 274 239 -9 185 282 260 212 -9 164 155 145 106 291 198 193 246 184 321 241 307 214 133 129 248 169 326 -9 253 166 182 162 208 220 264 202 224 282 209 190 234 180 308 169 243 266 150 328 289 199 233 164 128 176 376 211 197 197 237 176 296 186 183 298 303 144 200 164 297 131 154 187 192 208 173 264 -9 294 202 212 153 238 198 213 -9 139 249 286 201 120 266 204 198 242 167 161 111 161 425 167 200 253 235 213 213 172 143 260 272 121 -9 168 138 240 237 260 216 -9 304 198 221 199 138 119 213 125 245 187 129 362 301 203 204 312 269 216 206 177 217 192 146 250 231 231 259 229 
1319 611 Lahu China EAST_ASIA 120 112 124 -9 160 230 142 122 186 98 130 120 156 217 262 231 147 163 218 194 187 143 245 136 204 -9 188 138 139 199 191 180 154 163 106 166 126 143 164 180 212 185 249 115 141 105 234 233 271 -9 221 111 117 -9 196 297 181 113 98 238 -9 127 144 116 157 150 251 234 88 132 263 104 155 151 112 165 -9 152 190 130 178 101 146 127 199 237 244 142 179 160 179 147 184 235 135 187 246 200 119 152 246 197 198 158 170 255 181 127 330 172 190 187 178 164 202 143 240 194 140 184 155 233 159 168 129 216 210 273 251 135 118 139 157 170 161 173 198 200 116 204 238 224 133 224 228 141 370 183 189 200 147 188 117 196 347 204 141 240 97 218 263 230 116 187 229 128 177 230 255 172 149 179 109 277 187 180 131 196 153 151 117 206 187 142 130 175 320 215 155 241 190 183 165 248 148 -9 270 219 112 236 163 176 297 241 175 270 139 260 216 272 183 245 177 -9 112 263 100 266 196 -9 100 292 319 241 230 294 -9 186 185 233 282 164 266 239 -9 173 270 260 188 -9 152 155 141 98 287 178 193 246 180 313 237 307 210 125 125 244 157 322 -9 245 162 182 150 204 212 260 202 220 278 209 174 226 180 292 161 235 262 146 324 285 199 229 156 128 176 372 207 193 193 209 172 292 178 183 298 299 144 196 156 269 131 154 163 192 204 169 260 -9 266 190 204 145 234 194 205 -9 135 245 282 197 116 254 200 186 242 163 149 111 149 405 159 200 253 231 203 197 172 131 248 268 121 -9 160 134 236 233 260 204 -9 304 198 209 199 138 113 201 119 241 181 117 350 297 203 180 308 261 212 198 173 209 176 146 246 231 231 259 221
1320 611 Lahu China EAST_ASIA 126 124 124 141 168 236 140 -9 182 98 132 120 152 217 258 243 -9 165 218 194 189 143 249 136 216 184 188 134 119 207 191 176 154 167 106 172 126 177 170 174 208 188 258 118 147 108 231 239 271 -9 239 96 -9 236 205 318 190 116 95 256 195 136 141 119 157 156 266 246 91 126 266 116 158 157 115 162 234 155 190 130 187 110 143 136 223 246 241 148 179 169 191 156 190 253 135 190 246 197 125 152 246 197 194 158 166 267 209 127 342 176 194 207 172 164 194 147 -9 194 144 192 151 241 163 180 141 224 -9 281 251 151 122 151 161 174 153 165 202 212 124 204 246 232 133 228 232 153 386 183 -9 208 155 192 157 208 347 224 161 240 115 218 263 238 120 195 241 132 -9 234 255 192 149 179 -9 281 191 188 143 208 161 139 117 216 191 142 150 175 324 205 155 241 190 187 181 256 144 245 278 211 116 240 167 184 297 241 187 258 163 268 216 280 -9 253 201 251 112 263 108 262 216 257 100 296 323 245 242 294 158 202 209 233 310 174 274 243 186 189 278 264 204 223 164 159 153 110 291 182 193 246 184 309 245 311 218 133 125 244 173 322 163 253 170 182 158 216 208 260 198 224 286 219 178 238 180 304 161 259 262 154 320 289 199 261 164 128 188 376 211 193 197 233 180 296 190 179 298 307 144 180 168 297 135 -9 195 192 208 177 272 292 286 198 200 157 242 202 209 264 151 253 282 201 116 270 180 198 242 171 161 -9 165 421 159 204 253 235 207 217 172 131 252 272 125 264 164 134 240 233 260 224 159 308 202 233 199 134 119 197 123 245 191 121 378 293 207 204 308 249 216 214 189 213 180 146 -9 247 231 -9 225 
1320 611 Lahu China EAST_ASIA 126 124 124 129 156 234 140 -9 180 98 128 114 148 217 258 233 -9 165 218 188 187 143 249 128 204 184 188 134 119 203 185 176 148 165 86 166 126 143 170 174 208 185 249 115 141 108 228 239 265 -9 236 96 -9 233 196 291 184 113 95 238 192 118 132 113 157 153 263 234 91 126 266 107 155 154 109 156 234 140 187 127 178 104 134 136 205 246 227 139 179 166 182 150 184 247 135 190 246 197 119 140 246 197 194 158 162 263 209 123 334 168 190 203 168 160 186 143 -9 190 136 184 151 233 159 168 129 224 -9 273 247 143 122 151 133 154 153 165 198 208 116 204 242 228 129 228 228 149 382 183 -9 204 147 188 117 196 347 204 145 240 111 218 255 234 116 183 239 132 -9 230 255 188 149 179 -9 269 191 176 143 196 153 155 109 212 191 142 146 175 320 205 155 237 190 187 173 240 132 237 266 207 112 240 155 184 297 241 175 258 155 268 212 272 -9 245 177 251 112 263 104 258 196 253 96 288 323 233 230 290 158 190 193 233 282 168 274 243 182 189 278 260 184 211 160 155 145 110 287 182 189 246 180 297 237 307 210 125 125 224 161 322 163 249 166 178 158 212 204 256 198 224 286 209 174 226 180 300 143 239 262 138 316 257 195 233 160 124 180 376 199 189 197 213 164 296 182 175 290 303 140 180 148 289 123 -9 191 188 184 173 268 292 262 198 188 153 242 190 201 256 151 253 278 197 116 266 180 186 228 167 153 -9 145 421 159 200 249 227 203 201 172 111 252 256 117 256 152 134 204 233 252 204 159 304 192 221 199 118 119 197 121 241 191 117 350 289 203 180 308 245 212 206 177 209 176 142 -9 231 219 -9 205 
1321 611 Lahu China EAST_ASIA 126 124 146 135 142 234 140 122 188 98 138 126 156 225 264 241 -9 169 220 196 189 143 249 136 218 196 186 142 119 207 191 184 164 163 106 172 120 143 172 180 208 191 255 118 141 120 234 239 271 -9 236 96 -9 239 196 318 190 113 95 256 -9 136 132 122 163 159 266 237 94 135 260 -9 158 157 118 165 252 158 187 130 193 113 146 133 211 252 244 148 182 163 179 147 193 253 144 190 246 200 125 152 246 205 206 166 174 259 209 123 342 176 198 207 196 168 202 147 244 198 152 200 151 237 159 180 145 224 -9 273 255 143 130 155 157 174 161 173 198 212 124 204 246 228 137 228 228 149 374 183 193 208 167 192 185 200 351 204 157 260 119 226 263 236 120 183 239 132 -9 242 259 192 153 183 117 281 191 180 131 208 153 147 113 208 199 150 150 175 328 221 159 237 190 195 181 256 148 237 270 227 116 244 163 184 297 241 171 274 159 272 220 264 195 249 201 263 108 263 104 262 212 265 104 280 323 249 234 306 166 174 189 237 282 178 274 239 178 189 286 260 208 219 168 159 157 98 291 210 193 246 180 297 241 307 210 125 129 240 153 322 167 257 178 174 154 216 224 264 202 228 270 223 174 234 168 308 173 259 262 158 324 289 203 225 164 136 176 376 211 193 197 233 188 304 190 187 298 307 144 184 164 297 123 162 191 192 208 177 272 292 286 198 208 153 242 -9 213 -9 139 245 282 201 116 278 204 202 246 171 149 111 145 421 167 204 261 231 207 221 172 115 260 268 121 256 164 138 240 237 256 224 159 304 204 185 203 138 121 201 125 245 191 129 350 301 203 204 316 245 216 210 177 201 180 150 262 231 231 263 225 
1321 611 Lahu China EAST_ASIA 124 116 124 129 142 234 138 112 186 98 130 120 148 217 258 233 -9 165 218 194 187 143 247 132 218 184 184 138 119 207 183 176 158 161 104 172 120 143 168 174 204 185 249 115 141 108 234 233 271 -9 221 96 -9 239 196 303 181 113 89 238 -9 121 132 113 163 144 260 234 91 123 257 -9 158 154 115 162 234 140 187 127 190 104 143 127 205 240 241 139 179 160 179 147 181 247 132 187 246 200 119 152 246 197 202 162 166 259 189 123 334 164 190 203 178 164 198 147 244 198 144 196 147 237 155 176 141 212 -9 273 251 143 122 151 153 174 153 169 194 200 120 204 246 224 133 228 224 149 370 183 177 204 147 188 117 180 347 204 145 244 119 222 263 234 116 179 239 124 -9 242 259 192 149 179 109 273 191 172 131 196 153 147 113 206 195 142 142 159 324 215 151 237 190 195 169 240 144 237 262 211 116 236 151 176 289 241 167 258 155 264 208 260 183 249 185 263 104 259 104 258 212 257 100 280 319 245 230 302 162 170 169 229 262 178 274 235 178 185 274 260 184 207 152 155 157 98 287 186 185 246 168 297 237 303 210 121 125 240 149 314 159 245 166 170 154 216 216 264 190 220 266 213 170 230 168 300 169 235 262 158 312 257 203 213 164 128 176 372 203 193 197 209 168 296 178 179 290 303 144 176 148 273 119 158 187 192 208 173 260 292 270 198 188 153 238 -9 209 -9 139 245 278 193 116 278 180 190 242 167 141 111 145 405 159 200 245 227 203 209 172 111 256 268 121 256 164 130 240 237 252 208 159 304 202 185 199 118 111 197 123 241 181 117 330 297 191 180 312 245 212 198 173 201 180 146 258 223 231 255 205 
1322 611 Lahu China EAST_ASIA 122 128 144 129 160 234 148 124 186 98 138 120 152 231 260 243 -9 165 218 198 187 145 251 134 218 200 204 138 119 207 191 180 148 163 104 172 126 145 170 180 212 -9 255 115 144 120 234 239 274 -9 236 96 -9 236 205 309 181 116 95 241 195 136 141 122 157 153 251 246 88 126 260 116 158 157 115 162 252 152 190 136 187 110 146 136 205 240 247 148 -9 166 191 156 190 250 144 190 246 200 119 152 246 205 166 158 170 259 197 123 342 180 192 203 198 168 202 147 244 194 144 196 -9 233 163 180 149 -9 212 273 251 143 126 163 161 -9 165 173 198 204 128 204 254 228 137 224 228 149 390 183 189 204 155 192 -9 200 359 204 145 256 119 226 263 230 120 179 229 132 189 246 255 192 149 183 133 281 191 188 139 208 157 143 121 212 195 150 150 171 324 215 155 245 194 187 181 252 132 245 274 223 120 248 155 188 297 241 187 270 159 260 208 268 195 249 189 263 108 275 108 266 220 257 100 300 327 245 234 298 166 202 193 233 286 168 278 239 186 189 282 276 -9 219 168 155 153 -9 291 198 197 250 184 325 241 311 210 133 133 244 153 -9 167 249 -9 182 150 212 208 264 202 228 286 223 190 234 180 300 173 243 262 158 316 293 203 241 168 128 176 372 211 193 197 229 172 296 190 179 306 -9 140 196 168 285 119 154 183 192 216 177 268 -9 298 198 208 149 242 -9 217 288 151 249 278 213 116 262 204 202 250 167 157 115 169 421 167 200 261 -9 215 213 -9 135 256 276 121 264 164 138 236 237 264 216 159 304 204 225 199 146 119 203 125 245 191 125 354 301 207 180 316 -9 216 202 181 209 184 142 254 227 231 259 205 
1322 611 Lahu China EAST_ASIA 120 116 124 129 156 232 140 122 180 98 130 114 132 217 250 231 -9 165 214 194 185 143 243 134 204 196 186 138 119 203 174 178 148 163 106 166 126 145 166 174 208 -9 249 115 141 105 234 233 271 -9 236 96 -9 230 205 291 178 113 86 238 192 121 132 116 157 150 239 246 88 126 257 113 155 157 115 156 234 152 187 127 178 98 134 127 205 237 241 139 -9 160 179 147 184 247 135 187 246 197 119 152 246 197 190 158 162 259 181 123 334 176 192 187 172 160 190 147 236 194 144 184 -9 233 159 172 133 -9 206 273 251 131 118 143 137 -9 157 165 198 200 124 204 242 228 133 216 224 145 386 183 173 204 147 188 -9 180 347 204 141 244 111 226 255 230 120 175 225 120 177 238 255 180 129 183 129 277 191 180 131 196 149 155 117 212 191 142 138 171 324 215 151 241 190 183 169 248 132 237 274 219 108 248 151 184 289 241 175 254 139 260 208 268 183 249 185 259 108 259 100 258 200 253 100 288 323 233 234 294 158 174 193 221 262 168 266 239 182 177 282 264 -9 211 164 155 141 -9 283 182 189 246 180 301 237 307 210 125 125 244 153 -9 163 245 -9 178 150 208 204 256 198 220 270 215 174 234 168 300 143 239 258 146 312 285 199 233 168 124 172 372 203 185 189 229 172 296 178 179 302 -9 140 188 148 273 119 150 163 192 192 169 272 -9 278 194 204 141 238 -9 213 276 139 245 278 197 116 254 180 186 242 167 137 111 149 417 163 200 241 -9 207 201 -9 115 252 268 121 256 164 134 200 237 260 204 159 304 204 213 199 118 117 201 123 245 191 117 330 285 203 180 308 -9 216 198 177 205 180 142 254 223 231 259 205 
1323 611 Lahu China EAST_ASIA 134 128 142 129 160 234 140 -9 182 104 130 120 152 225 262 241 173 165 218 194 187 149 251 142 218 184 204 136 139 209 191 178 160 165 108 172 120 173 170 180 212 188 252 118 141 108 243 242 271 210 236 96 141 230 196 309 184 116 95 241 -9 136 141 119 163 159 254 246 91 126 266 113 155 157 109 165 249 158 196 127 190 107 140 130 217 252 244 148 179 160 179 156 184 241 141 187 255 200 119 160 246 205 198 162 178 263 197 131 346 176 194 207 202 152 206 159 248 194 144 196 155 237 159 176 137 240 210 273 255 151 126 155 157 174 153 173 218 208 136 208 250 232 149 228 232 145 386 187 193 204 163 192 177 196 371 212 157 248 111 218 255 238 116 183 239 128 193 246 255 192 153 183 133 277 191 184 131 196 153 139 121 216 191 142 154 159 320 221 155 237 194 203 173 260 144 241 278 235 112 244 155 188 297 241 175 278 159 268 224 272 187 257 189 271 112 263 104 -9 220 257 100 296 323 249 238 298 158 206 193 237 286 170 274 239 182 189 278 260 188 219 160 -9 165 98 291 206 197 250 184 309 241 307 218 133 125 252 169 314 159 249 174 178 154 204 212 264 202 228 282 209 198 234 176 304 147 259 266 138 320 289 203 233 164 136 188 376 207 197 201 229 184 300 178 199 298 303 148 192 168 285 119 158 203 200 208 177 276 300 274 202 200 149 242 202 209 -9 143 -9 278 201 116 274 204 202 228 171 157 115 -9 425 163 204 253 235 205 217 -9 131 252 268 121 268 156 138 244 233 260 220 159 304 208 213 -9 146 119 201 125 249 191 117 354 297 203 168 320 245 220 202 181 201 188 150 254 231 231 259 217 
1323 611 Lahu China EAST_ASIA 126 112 124 129 156 234 138 -9 180 98 130 114 146 225 258 235 147 165 214 194 185 143 247 136 204 184 188 136 119 199 183 176 148 163 110 166 120 143 164 180 208 188 249 115 141 105 225 224 271 204 221 96 117 230 196 297 181 116 95 238 -9 118 132 113 157 156 239 234 79 123 263 107 146 151 109 162 234 155 190 127 178 98 134 127 214 243 241 145 179 160 179 156 181 235 135 187 246 200 119 156 246 197 194 158 170 263 189 127 330 176 192 203 168 152 202 147 236 190 144 196 151 233 151 172 129 240 204 269 251 143 126 151 148 166 145 161 198 204 124 204 242 228 141 224 228 145 382 183 173 204 155 188 117 192 347 204 157 240 97 198 255 234 116 179 225 124 189 242 255 184 129 183 117 277 187 180 131 196 153 147 109 208 187 142 142 159 316 215 155 233 190 203 165 256 144 237 274 211 112 240 151 180 297 241 167 270 155 260 208 252 183 245 181 267 112 259 100 -9 196 253 100 292 323 241 234 294 154 194 189 233 262 168 274 235 178 189 278 256 184 209 160 -9 157 98 287 182 189 246 180 301 233 299 218 129 121 240 153 314 155 245 170 170 154 204 212 260 198 220 282 209 174 230 176 300 143 255 266 138 316 257 199 229 160 128 176 368 207 193 193 225 168 292 170 175 294 299 144 176 156 273 119 154 187 192 208 173 264 300 262 202 188 149 238 190 205 -9 135 -9 262 201 104 258 180 186 228 171 137 111 -9 421 159 200 253 227 203 213 -9 119 252 264 117 256 144 138 240 229 260 204 159 304 200 209 -9 138 119 199 125 245 191 117 330 297 203 168 312 241 216 198 177 201 180 142 254 231 231 259 205 
1324 611 Lahu China EAST_ASIA 130 128 144 129 156 236 142 112 186 104 130 120 166 225 258 241 -9 167 218 194 189 149 251 140 218 184 188 138 139 209 183 176 160 165 110 172 130 143 170 180 212 188 249 118 141 108 243 -9 271 -9 239 111 -9 236 205 309 193 116 98 241 195 136 141 119 160 156 251 246 91 126 266 119 152 157 118 165 249 158 190 130 190 107 134 136 217 246 244 148 179 169 179 159 190 241 135 187 252 200 125 160 246 205 202 162 170 263 189 131 346 176 196 211 202 168 202 159 236 194 144 196 155 237 163 176 149 240 210 273 255 147 126 159 153 170 149 173 198 204 124 204 250 232 141 228 232 149 386 187 -9 204 163 188 177 196 351 220 157 244 111 214 255 238 120 179 239 128 189 246 255 192 153 183 121 277 187 184 131 -9 157 155 117 216 195 150 154 171 324 215 155 233 190 203 173 260 144 245 274 211 112 248 155 184 305 241 175 270 155 268 224 268 187 257 185 271 112 263 104 282 220 -9 104 292 323 249 242 298 166 194 193 237 294 170 274 239 182 189 282 260 188 219 160 163 165 98 287 206 193 246 184 -9 241 315 218 129 125 252 157 334 163 249 174 178 154 208 220 264 202 220 286 209 178 230 176 304 165 259 266 142 320 289 203 233 160 136 176 376 207 197 201 229 172 300 194 179 298 299 148 176 168 273 119 154 203 200 208 177 264 300 274 202 204 153 242 202 213 256 135 249 274 201 116 274 204 202 -9 175 157 115 165 425 167 204 253 243 209 213 172 131 256 268 121 268 152 138 244 233 260 220 159 304 208 209 203 146 119 -9 129 249 191 129 362 297 203 180 320 265 216 198 181 213 188 150 262 231 231 259 217 
1324 611 Lahu China EAST_ASIA 126 128 124 129 156 234 140 112 180 98 130 114 146 217 258 241 -9 165 218 194 187 143 249 136 218 184 188 136 119 199 183 176 148 163 92 172 120 143 164 180 208 185 249 115 141 108 234 -9 250 -9 236 96 -9 230 196 297 181 113 95 238 192 118 132 113 157 147 239 234 91 126 266 107 146 151 109 165 234 158 190 127 178 104 134 127 208 243 241 145 179 160 179 156 184 235 132 187 246 197 119 156 246 197 198 158 166 259 185 131 342 172 192 203 184 152 202 151 236 194 144 192 155 237 159 172 129 224 204 273 255 143 122 155 148 166 145 173 198 196 124 204 246 208 137 228 228 145 378 187 -9 204 155 188 153 192 347 212 157 240 97 198 255 230 116 175 219 120 177 242 251 184 145 171 117 277 187 176 131 -9 153 167 109 212 187 142 142 159 320 215 151 233 190 187 169 240 132 241 274 211 108 240 151 180 297 241 175 270 155 264 208 252 183 245 181 267 112 259 100 270 212 -9 100 288 323 237 238 290 154 186 189 233 286 170 274 239 178 185 278 256 188 207 160 159 145 98 287 190 189 246 180 -9 237 307 210 129 121 240 153 326 155 245 170 174 154 204 212 264 202 220 282 209 174 230 168 300 147 235 258 138 312 289 199 233 160 128 172 368 203 193 193 225 168 296 170 175 294 299 148 176 152 261 119 154 187 192 208 177 260 296 274 198 200 149 234 190 209 252 135 249 262 201 104 254 180 190 -9 171 149 115 165 421 159 200 253 227 203 213 168 119 252 264 121 256 144 138 236 229 260 204 159 304 196 185 199 138 111 -9 125 245 181 117 354 297 203 168 312 241 216 198 177 201 184 146 254 231 227 251 205
1325 611 Lahu China EAST_ASIA 126 124 146 139 164 238 140 120 186 100 130 120 156 217 264 241 -9 165 218 194 189 149 249 136 218 184 204 138 137 207 189 184 156 165 104 166 126 143 172 184 212 191 249 115 150 120 243 239 277 -9 236 102 126 239 196 318 190 116 98 256 192 130 144 119 163 159 266 234 94 126 260 107 158 157 109 162 252 158 -9 127 190 113 146 130 208 249 -9 148 182 169 179 147 193 253 132 190 252 200 125 156 246 209 206 158 170 259 197 127 334 176 190 211 178 168 206 143 248 198 152 196 151 237 159 180 137 240 214 277 255 151 126 155 157 174 161 173 198 200 140 204 254 228 137 232 228 149 386 183 193 208 167 192 177 200 355 204 149 260 119 226 263 234 120 183 239 128 195 242 259 188 149 179 113 281 191 172 135 208 161 147 113 212 195 150 150 171 328 221 159 241 190 187 181 256 148 241 270 227 120 244 163 184 297 241 187 274 151 -9 220 276 199 253 185 263 108 263 116 262 212 265 100 296 323 245 234 302 158 194 189 233 -9 178 274 239 178 185 278 260 192 207 168 159 153 100 287 210 193 246 180 309 241 311 222 -9 129 248 169 322 167 257 178 182 154 216 216 260 202 228 286 223 174 238 180 308 173 243 262 158 316 -9 203 237 164 128 188 372 207 193 197 209 172 300 198 179 302 307 144 184 164 297 119 158 191 192 204 173 272 300 286 198 196 157 238 190 -9 280 143 245 286 197 116 278 204 202 246 175 141 115 169 421 167 200 245 231 207 225 172 131 260 268 121 268 168 138 240 237 256 216 -9 304 204 209 203 138 121 201 125 245 191 117 350 297 207 204 316 245 216 202 181 213 180 150 262 231 231 263 225 
1325 611 Lahu China EAST_ASIA 124 116 124 129 142 234 138 112 186 98 130 118 148 217 250 235 -9 165 214 194 187 147 247 136 218 184 186 138 119 193 183 176 154 163 106 166 126 143 170 180 212 191 246 115 141 108 234 224 271 -9 236 96 117 230 196 297 187 116 89 238 192 121 132 119 157 144 260 234 91 123 260 107 158 151 103 162 234 152 -9 127 178 113 146 130 205 246 -9 139 182 160 179 147 181 235 132 187 246 197 119 152 246 205 198 158 166 259 189 127 334 164 190 207 174 168 202 135 244 194 140 192 147 233 155 172 133 224 212 273 247 131 126 151 153 170 153 169 194 196 128 204 246 228 121 228 224 149 370 183 181 204 147 192 117 192 351 204 145 240 119 218 263 230 116 179 237 128 195 234 255 188 149 179 109 273 187 164 131 208 153 151 113 206 191 142 142 159 324 215 155 237 190 187 169 256 144 237 262 211 116 240 151 176 289 241 167 266 139 -9 208 276 195 249 185 247 104 263 100 254 212 265 100 296 319 245 234 294 154 190 169 229 -9 178 270 239 178 185 266 260 184 203 152 155 153 98 287 202 189 246 180 297 237 303 210 -9 125 244 149 314 159 249 170 170 150 204 216 260 190 220 266 213 174 226 168 304 143 235 262 150 312 -9 199 225 160 128 176 372 203 185 197 209 168 296 190 175 294 303 144 176 160 297 119 154 183 192 184 173 260 292 266 198 188 149 238 190 -9 272 139 245 278 193 104 274 204 190 242 171 141 111 145 417 159 200 245 227 207 221 168 131 256 268 121 256 152 130 240 233 252 208 -9 304 204 185 199 134 111 201 121 241 181 117 350 293 203 180 316 237 216 198 177 201 180 146 258 223 231 255 205 
1326 611 Lahu China EAST_ASIA 130 128 -9 135 164 236 142 -9 190 98 136 128 158 223 260 -9 -9 167 224 194 189 143 249 140 226 184 186 138 119 207 191 182 154 165 104 174 126 145 170 180 212 188 252 115 150 129 234 245 277 201 236 111 -9 230 196 312 193 -9 104 256 192 136 144 125 163 153 263 237 94 132 266 113 158 166 115 168 249 158 193 133 193 107 146 139 214 252 244 145 179 163 -9 156 190 235 141 193 246 200 119 160 246 201 202 158 162 -9 189 131 330 180 194 207 196 168 202 147 240 198 144 192 155 237 159 176 149 232 -9 281 255 155 126 151 153 174 150 169 206 204 140 212 242 228 133 224 236 149 386 187 -9 204 151 192 189 196 359 204 157 240 119 218 263 242 116 183 239 128 205 238 255 188 149 179 -9 277 187 184 147 196 153 139 117 216 195 158 154 175 324 235 159 253 198 199 181 244 148 -9 274 207 116 248 155 188 297 249 175 274 163 272 228 276 191 245 189 263 112 263 116 266 212 265 100 292 323 245 234 290 162 194 193 233 302 170 274 239 182 189 -9 260 188 207 168 163 145 98 303 186 197 250 180 309 245 311 218 129 129 244 157 330 163 253 174 178 154 212 216 264 198 228 286 223 174 238 176 304 157 239 266 162 320 293 203 257 164 132 188 372 211 173 197 229 164 296 190 179 302 -9 148 196 168 265 135 -9 183 192 204 177 268 300 266 194 204 149 238 198 209 268 151 249 286 209 116 266 204 198 -9 167 165 111 169 421 167 204 249 235 215 209 -9 131 268 264 121 276 164 142 244 237 256 224 167 308 202 213 203 146 119 -9 125 245 191 129 370 297 203 180 312 273 216 -9 181 205 180 150 -9 247 235 267 205 
1326 611 Lahu China EAST_ASIA 126 124 -9 129 156 230 140 -9 188 98 130 114 148 223 258 -9 -9 167 218 194 183 143 243 132 218 184 180 134 119 193 191 176 148 161 92 166 126 143 170 174 212 188 249 115 141 105 234 242 271 195 221 96 -9 230 196 309 190 -9 86 241 183 121 132 119 157 147 263 234 91 123 260 113 155 154 109 162 234 152 190 127 178 107 146 130 214 249 226 142 179 160 -9 150 184 235 138 187 246 197 119 140 246 197 198 158 162 -9 181 131 322 176 190 203 178 164 190 143 236 194 144 180 147 229 151 172 129 224 -9 273 247 151 122 151 133 146 145 169 202 204 128 204 242 204 133 220 228 141 370 183 -9 200 147 188 157 192 355 204 141 240 119 218 255 238 116 167 231 128 173 238 255 180 145 179 -9 269 187 184 147 192 149 155 117 212 187 142 138 159 320 225 151 253 198 187 181 244 132 -9 274 207 112 240 155 184 297 241 171 270 155 272 216 260 183 241 181 263 112 263 100 262 200 253 96 288 323 241 234 290 162 198 189 233 274 168 274 235 178 185 -9 260 188 207 152 151 141 98 295 186 193 242 180 305 245 307 210 125 125 244 149 326 163 253 170 170 150 208 212 260 190 224 286 213 174 226 172 292 146 235 262 142 316 285 199 241 160 128 176 372 211 173 185 229 160 292 182 175 294 -9 140 196 148 261 123 -9 163 188 192 177 264 296 262 194 204 145 234 198 209 256 139 245 274 209 116 262 180 190 -9 163 161 111 145 405 159 200 245 231 207 201 -9 131 264 264 121 264 164 138 240 229 256 204 167 304 200 209 199 118 113 -9 125 245 181 117 342 297 203 180 304 237 212 -9 177 197 180 146 -9 231 231 259 205
1189 612 Miao China EAST_ASIA 128 116 142 129 156 232 140 118 186 98 130 122 152 223 258 233 147 167 218 194 187 143 251 132 228 184 190 138 119 207 189 184 160 165 102 172 130 147 170 184 212 188 249 115 141 -9 240 239 277 -9 236 105 132 233 199 300 184 116 95 -9 195 136 132 119 163 159 263 246 91 123 260 119 158 157 109 165 249 152 190 139 -9 98 143 133 208 249 227 142 182 166 194 150 187 250 141 196 255 200 119 152 246 205 202 162 174 255 213 131 342 172 194 207 180 152 202 147 248 194 144 192 155 241 159 176 149 228 -9 265 251 147 126 151 153 174 157 173 202 212 140 204 242 228 133 232 232 149 374 187 177 204 163 192 189 212 347 208 161 240 111 218 267 230 124 183 229 128 189 246 259 192 157 191 113 277 191 184 135 196 161 143 121 208 199 142 146 171 324 215 155 245 -9 203 173 260 144 245 278 223 120 244 163 180 301 261 175 274 159 272 220 276 203 253 181 267 108 263 108 286 220 273 100 296 319 245 238 294 162 194 213 233 302 170 274 235 182 177 282 260 192 215 160 159 153 106 287 198 197 250 184 305 237 303 210 133 133 256 173 322 163 257 174 178 162 216 220 264 202 224 286 209 178 238 168 308 173 255 262 154 -9 297 -9 237 168 140 180 372 203 197 197 229 192 304 190 179 298 307 144 192 164 -9 135 -9 199 204 208 177 264 296 270 198 204 153 242 206 217 272 -9 253 278 197 120 278 204 198 242 175 169 115 141 421 163 200 253 235 207 217 172 135 260 268 125 256 164 150 240 237 260 204 159 304 204 221 207 142 121 205 125 241 191 129 370 301 203 204 320 265 216 206 181 209 184 146 -9 227 235 267 237 
1189 612 Miao China EAST_ASIA 126 112 124 129 142 230 140 112 180 98 130 120 148 217 250 233 147 163 218 194 185 143 249 132 218 184 188 138 119 207 183 180 154 161 102 172 128 145 168 174 208 188 246 115 141 -9 234 224 271 -9 233 96 117 218 196 297 184 110 89 -9 195 118 132 113 157 141 251 234 91 123 260 116 158 151 109 162 234 140 187 136 -9 98 140 133 208 246 227 139 179 166 179 147 184 247 129 187 246 200 119 148 246 201 198 158 170 255 185 119 338 172 190 203 168 152 202 143 240 194 140 184 155 237 159 172 137 212 -9 261 251 147 110 151 149 162 153 165 198 200 128 204 242 221 129 228 232 149 374 183 177 200 159 188 181 196 347 196 157 240 97 214 255 230 120 183 229 120 189 242 255 188 129 175 109 269 183 176 131 192 149 135 117 208 187 142 138 159 312 215 151 233 -9 187 169 256 132 245 274 207 112 244 151 180 297 241 171 270 155 260 220 268 183 245 181 263 104 259 100 278 212 257 100 280 319 241 230 286 154 194 193 233 266 164 274 239 178 173 270 260 184 211 156 159 145 98 283 182 181 246 164 301 237 299 210 129 125 240 165 318 163 245 170 174 154 204 216 260 190 220 266 209 174 234 168 304 143 239 262 130 -9 257 -9 229 168 140 172 368 203 189 193 225 160 296 178 175 294 307 140 176 164 -9 123 -9 183 196 184 173 264 292 262 194 188 145 238 202 209 272 -9 249 278 197 116 258 204 190 242 167 153 111 141 405 163 200 253 227 203 209 172 131 256 264 121 256 148 138 196 233 256 204 159 304 202 209 203 134 117 201 121 241 191 117 334 289 191 180 308 209 216 202 181 209 180 150 -9 223 227 255 205 
1190 612 Miao China EAST_ASIA 126 124 124 141 162 232 138 120 186 98 136 120 148 225 260 235 173 167 218 -9 187 145 243 136 218 184 192 134 119 207 189 182 158 163 106 166 126 145 172 182 212 185 255 115 147 -9 240 236 274 216 239 111 132 236 196 306 184 113 104 256 195 127 141 116 157 156 266 246 91 120 266 -9 161 151 115 165 249 155 190 136 -9 104 143 136 214 252 244 145 182 163 197 156 -9 253 141 187 246 200 125 140 246 205 202 162 174 255 189 131 338 172 194 203 -9 164 202 151 240 194 152 200 159 237 167 176 145 228 206 305 259 151 126 151 149 174 165 173 202 208 124 212 242 244 141 232 232 153 386 183 197 204 163 192 185 192 367 212 161 248 115 218 267 234 116 187 237 140 197 254 255 192 149 191 109 277 191 184 135 196 157 155 117 212 195 142 146 171 320 229 147 241 194 203 185 240 144 245 278 219 120 248 163 188 297 241 175 274 151 260 220 276 187 249 189 259 112 263 108 270 216 269 108 296 323 241 234 298 -9 194 193 233 298 174 274 239 182 189 278 260 192 215 164 159 153 110 295 198 189 250 184 309 245 307 214 129 125 244 169 326 163 249 170 178 154 208 220 272 202 220 278 209 190 234 176 304 161 255 262 158 324 289 207 -9 160 128 180 372 215 -9 197 233 188 296 170 183 302 303 144 192 156 261 135 154 203 192 184 177 272 300 294 198 200 153 242 198 217 272 143 253 286 201 116 282 204 202 246 167 -9 115 161 421 167 200 245 235 207 209 176 131 256 268 -9 264 172 142 252 233 -9 216 159 304 206 213 207 138 121 203 125 253 191 117 366 297 203 184 316 269 216 202 177 213 184 146 254 227 231 267 241 
1190 612 Miao China EAST_ASIA 124 116 124 127 144 230 138 112 184 98 130 120 148 217 250 233 167 167 216 -9 187 143 243 132 218 184 188 134 119 205 176 180 158 163 102 166 124 143 170 180 212 185 246 115 141 -9 231 233 271 210 221 105 132 236 196 306 184 110 95 241 195 118 132 113 157 150 251 234 79 120 260 -9 158 151 109 162 249 140 187 130 -9 98 134 127 208 252 244 145 179 160 194 150 -9 247 126 172 246 197 119 140 246 201 194 158 170 255 185 131 338 168 192 191 -9 160 202 143 240 194 144 188 155 233 159 172 133 208 202 265 255 151 126 151 133 170 157 173 194 204 124 204 238 232 133 228 232 145 378 183 173 204 159 188 181 192 363 204 157 240 111 214 259 230 112 183 225 136 193 242 255 192 149 175 109 277 187 184 131 192 153 147 113 210 183 142 146 171 320 219 147 237 194 203 173 240 144 237 274 207 112 240 163 188 289 241 175 258 151 252 208 276 175 245 181 247 108 263 108 250 200 257 96 292 323 233 234 286 -9 178 181 233 294 168 258 239 182 181 274 256 184 207 156 159 149 98 287 186 185 242 184 301 241 303 210 129 125 244 165 322 155 249 166 178 154 204 208 264 186 216 278 209 174 230 168 304 157 243 262 146 316 285 203 -9 160 132 176 364 211 -9 189 209 184 292 170 179 298 303 140 188 148 261 131 150 183 188 184 173 268 296 262 194 188 149 234 190 217 252 135 245 278 197 112 254 184 186 236 167 -9 111 145 405 163 200 245 231 205 205 168 131 252 268 -9 256 156 134 236 229 -9 204 159 304 192 209 199 134 119 201 121 249 183 117 362 297 191 180 312 241 212 198 173 201 184 146 246 223 227 259 221 
1191 612 Miao China EAST_ASIA 124 128 124 129 160 236 142 118 188 102 130 120 154 223 264 -9 171 165 224 194 187 149 243 136 226 184 202 134 119 199 183 180 158 167 102 166 126 143 170 174 212 191 255 115 141 123 231 245 277 210 242 117 117 239 199 303 184 113 95 250 192 127 144 113 163 162 251 237 91 123 269 116 161 157 115 165 234 152 187 133 190 101 146 139 214 246 241 148 179 160 182 156 190 244 132 193 246 200 125 152 254 201 206 166 178 263 189 131 342 176 194 207 178 156 202 155 244 198 144 -9 159 237 159 176 149 220 210 277 251 147 126 159 161 182 157 169 206 204 128 220 254 236 137 228 232 149 390 183 173 208 -9 192 185 212 347 204 161 244 115 218 263 230 120 191 231 128 189 242 263 196 145 183 117 281 187 180 135 196 157 147 121 212 187 142 154 175 320 223 159 245 190 211 173 260 144 241 274 223 120 248 151 188 297 241 175 274 151 268 220 276 195 249 185 -9 112 267 104 282 220 265 112 300 331 241 246 294 158 194 -9 241 286 174 274 235 186 181 278 260 192 223 168 159 157 106 291 198 189 250 184 309 245 299 214 133 125 248 169 330 167 253 170 178 154 208 224 264 198 224 290 213 186 230 180 300 169 239 266 162 320 289 203 245 -9 132 184 364 211 -9 201 213 176 296 174 179 302 303 144 196 172 273 119 158 187 192 204 177 264 296 294 198 188 153 238 190 217 268 139 249 278 197 116 274 180 198 250 183 145 115 165 405 167 196 257 243 209 -9 176 -9 264 272 -9 264 160 142 252 237 260 216 171 312 196 221 203 134 123 203 125 241 191 129 354 297 203 184 316 241 220 210 181 -9 180 146 262 231 231 247 237 
1191 612 Miao China EAST_ASIA 120 116 124 129 144 230 138 114 186 98 130 114 148 217 262 -9 165 163 218 194 183 147 243 136 226 184 188 134 119 199 176 180 158 163 94 166 120 143 166 174 208 191 249 115 141 108 231 242 271 201 236 96 117 236 196 297 181 110 95 241 192 127 132 113 163 144 251 237 88 123 260 116 155 151 109 165 234 152 187 127 178 98 143 133 208 237 241 148 179 160 179 150 184 235 126 190 246 197 119 148 246 201 198 162 170 259 185 123 330 176 190 191 178 152 190 147 236 194 140 -9 151 233 155 172 137 212 202 273 247 131 118 151 153 166 157 169 202 200 124 208 238 228 133 228 228 145 370 183 169 204 -9 188 153 196 347 204 157 244 115 214 263 230 116 187 225 128 181 234 255 192 129 183 109 277 183 176 127 196 157 135 109 210 187 142 138 163 316 215 151 241 190 183 169 240 132 225 274 207 116 248 151 176 297 241 175 258 143 264 220 276 187 245 185 -9 104 267 104 258 200 257 104 300 323 241 242 294 158 182 -9 233 278 172 266 235 182 177 274 260 192 211 164 155 149 98 291 178 173 250 184 301 237 299 210 125 121 240 157 306 159 241 166 178 150 208 212 260 198 220 286 209 178 230 172 292 143 239 262 134 316 285 199 241 -9 136 176 364 211 -9 181 209 164 292 170 175 294 303 144 192 164 261 119 158 183 188 184 177 260 292 262 194 188 141 230 190 209 256 139 245 274 197 112 266 180 178 238 179 141 111 145 405 163 196 249 235 203 -9 172 -9 260 264 -9 256 156 142 240 237 256 204 159 304 196 221 199 118 111 203 123 241 181 117 346 293 191 180 316 241 212 206 181 -9 180 150 258 223 223 243 205 
1192 612 Miao China EAST_ASIA 126 116 142 135 162 234 146 124 182 98 130 -9 154 223 262 233 173 167 214 -9 191 145 247 140 218 184 204 140 119 207 191 184 158 163 100 172 126 171 170 184 212 188 249 115 141 120 237 242 277 210 236 111 126 239 199 288 187 113 98 241 195 127 135 113 163 153 263 234 91 123 266 -9 158 157 112 165 234 158 190 136 178 113 140 142 217 246 247 142 179 166 200 156 190 235 141 193 255 200 125 152 246 205 198 162 162 259 189 127 342 176 190 207 172 172 202 147 248 194 148 -9 155 237 155 172 133 224 210 273 251 155 122 155 153 170 165 173 210 208 132 204 246 236 141 228 228 149 382 183 193 204 -9 192 189 200 351 212 153 244 119 218 267 238 120 187 237 136 193 238 255 196 157 179 129 281 191 184 143 204 157 163 113 212 199 158 146 175 324 211 155 245 198 187 -9 252 136 245 278 231 112 244 167 184 297 241 175 278 159 264 220 276 187 257 189 263 104 263 104 286 212 269 104 292 323 245 242 -9 -9 190 241 233 294 172 270 239 186 189 278 264 192 215 168 155 153 110 291 194 197 250 184 313 237 307 214 137 125 240 169 322 167 253 166 178 162 -9 216 276 202 224 278 223 178 238 180 300 173 239 266 142 324 285 207 257 160 128 180 376 207 193 197 233 164 296 178 187 294 307 140 192 148 289 135 158 207 192 208 181 272 296 298 202 200 149 246 206 213 280 147 245 282 209 116 -9 204 190 242 171 153 111 141 405 171 208 245 243 203 213 172 131 264 280 129 256 160 142 236 233 260 204 167 308 200 209 203 138 123 201 125 245 191 129 362 297 203 180 308 209 216 206 181 213 188 146 258 231 231 259 241 
1192 612 Miao China EAST_ASIA 120 112 126 129 156 230 138 120 180 98 130 -9 152 217 250 233 171 165 214 -9 187 143 245 138 204 184 204 134 119 205 191 180 154 163 100 166 120 143 170 180 208 188 249 115 141 105 237 233 265 207 221 96 117 236 196 288 181 104 86 241 192 121 132 113 163 150 257 234 79 120 263 -9 152 151 109 162 234 152 187 127 178 101 140 133 208 246 244 142 179 163 194 150 184 235 138 190 252 200 125 148 246 193 194 158 162 255 185 123 334 172 190 203 168 160 202 143 240 194 144 -9 155 233 151 168 129 220 202 261 247 131 122 147 149 166 161 169 198 204 128 204 242 232 121 224 228 145 370 183 169 204 -9 188 153 196 347 212 137 240 97 214 267 238 116 183 233 120 189 234 255 188 129 175 121 269 183 180 135 196 149 143 113 204 191 142 146 159 320 209 151 233 198 183 -9 244 136 237 270 211 112 240 151 184 297 241 175 266 151 264 208 276 179 245 185 259 112 263 104 266 216 253 100 292 319 241 242 -9 -9 190 209 229 278 164 262 239 178 189 274 260 184 211 160 143 145 98 287 186 177 250 180 309 237 299 210 129 125 224 157 318 155 253 166 178 154 -9 208 268 198 220 266 209 174 234 176 292 157 235 266 134 316 257 199 233 160 132 176 376 203 193 197 209 164 296 170 183 294 307 144 176 144 285 119 150 179 188 196 173 264 296 258 190 188 141 242 190 209 276 147 245 282 197 104 -9 200 178 228 163 145 111 141 405 163 204 245 239 203 201 156 131 256 260 117 256 160 138 228 233 252 204 159 304 192 185 199 138 117 201 121 241 181 129 346 289 191 180 296 209 216 206 181 193 188 146 258 231 227 251 205 
1193 612 Miao China EAST_ASIA 126 124 142 133 160 232 142 120 188 98 130 120 148 225 262 233 173 167 222 194 187 147 247 132 218 184 206 134 139 203 189 180 158 173 104 166 124 147 170 180 212 188 249 115 141 108 228 242 277 210 236 96 138 236 199 297 187 116 89 241 195 133 135 116 166 153 266 249 91 132 266 116 155 151 109 165 234 161 190 130 190 110 -9 139 214 249 247 151 187 166 179 156 190 250 -9 193 252 200 122 152 254 201 202 158 170 259 185 135 334 176 196 203 202 160 -9 135 244 202 144 196 155 237 159 172 137 240 206 273 255 155 126 159 153 178 161 169 202 204 128 204 242 240 121 228 244 153 386 183 173 211 151 192 153 200 355 212 161 240 111 222 267 234 120 195 243 124 201 250 259 188 145 183 113 281 191 184 143 200 165 159 117 216 198 158 150 171 320 229 159 249 190 199 169 256 148 237 274 223 128 240 155 184 297 257 187 274 155 260 224 276 191 253 189 259 108 263 108 266 200 257 104 296 327 241 234 298 154 218 193 229 298 172 278 239 182 181 278 264 204 205 160 163 153 106 291 182 193 246 184 309 237 315 230 129 133 244 177 322 155 269 -9 178 154 208 220 272 202 220 282 209 178 234 184 304 169 263 266 158 328 289 203 257 168 128 184 376 215 193 189 233 184 292 194 187 302 307 144 188 172 293 131 150 187 192 192 177 264 300 290 198 196 153 242 190 209 276 139 249 282 205 116 270 180 202 246 167 157 111 145 421 167 204 241 231 215 -9 180 131 256 272 129 292 152 142 248 233 264 220 167 304 202 217 203 138 123 201 123 257 181 129 366 305 207 216 316 265 216 210 181 209 184 146 250 227 231 263 225 
1193 612 Miao China EAST_ASIA 126 116 124 129 158 230 140 112 182 98 130 118 148 223 258 233 171 165 216 194 187 143 245 128 218 184 188 134 119 201 174 176 148 169 96 166 120 145 170 180 212 185 246 115 141 105 225 224 271 201 225 96 117 230 196 291 184 113 86 238 192 127 132 113 157 147 257 234 91 123 260 110 155 151 106 156 234 152 187 130 187 98 -9 133 205 246 244 145 179 157 179 150 190 247 -9 187 246 197 119 148 246 197 194 158 166 255 185 135 334 168 196 203 172 152 -9 135 240 194 140 192 155 237 159 172 137 232 206 269 251 131 122 151 153 166 157 169 202 204 124 204 242 228 121 216 224 149 374 183 169 204 151 192 153 196 355 204 137 240 97 218 259 230 116 167 229 120 177 242 259 180 129 175 109 269 187 180 135 200 161 147 109 214 191 142 150 163 312 215 143 245 190 187 165 252 148 225 274 207 112 236 155 176 297 225 175 270 143 260 220 272 183 253 185 259 108 263 104 254 200 257 100 292 319 233 230 290 150 194 193 225 294 170 262 239 178 177 278 260 188 205 152 159 145 100 291 178 193 246 160 301 237 311 218 129 125 244 149 318 155 241 -9 178 150 204 212 260 202 220 282 209 170 226 172 296 169 239 258 134 320 257 203 225 168 136 172 368 203 193 185 209 164 292 174 175 294 307 144 176 164 289 119 150 183 188 184 169 260 296 258 198 188 149 234 190 205 268 135 249 278 201 116 266 180 194 236 163 149 111 141 405 167 204 241 227 211 -9 176 131 252 264 121 268 148 138 240 225 260 216 159 304 198 185 199 118 119 201 119 249 181 117 362 289 203 180 312 209 212 210 173 201 176 142 246 227 231 255 221 
1194 612 Miao China EAST_ASIA 124 124 142 129 142 236 148 120 188 98 136 120 156 223 260 233 181 167 218 198 187 149 249 132 228 184 208 136 119 205 176 184 162 165 102 172 120 173 172 180 212 191 249 115 141 -9 237 239 277 213 236 96 126 233 205 294 187 113 89 241 195 130 147 116 163 150 263 246 94 126 260 113 -9 154 118 162 249 158 190 127 -9 110 143 136 208 246 247 151 182 172 194 162 184 247 141 193 246 197 125 156 246 205 214 162 170 259 189 131 342 176 192 -9 178 152 -9 151 244 194 144 196 155 237 159 180 141 232 210 277 259 155 118 163 149 174 161 173 202 204 128 216 246 232 141 228 232 149 382 187 193 204 151 192 185 204 351 216 165 240 115 218 267 238 120 183 231 144 197 242 259 192 149 175 129 277 187 180 135 196 161 155 117 -9 195 150 146 175 328 215 155 249 194 191 173 256 144 245 278 211 116 244 155 180 297 257 175 270 159 264 220 276 183 253 185 263 108 267 104 258 200 269 100 292 323 249 246 294 162 194 189 241 294 170 274 239 186 193 -9 260 204 215 152 163 157 108 287 198 193 250 184 -9 241 303 214 129 125 252 173 326 163 253 -9 178 154 212 216 260 202 220 282 213 178 230 180 304 161 239 266 158 320 289 211 241 168 128 184 372 203 205 197 237 188 296 186 191 306 303 148 188 148 289 -9 154 191 192 208 177 268 296 262 202 208 149 242 198 209 276 143 249 282 209 116 270 200 202 250 167 145 111 165 417 163 200 245 243 213 209 176 131 264 268 129 264 156 142 244 233 256 224 167 308 196 225 203 142 117 205 125 245 191 121 362 305 203 204 320 237 216 206 185 209 184 146 258 235 231 263 205 
1194 612 Miao China EAST_ASIA 120 116 124 127 142 230 146 112 180 98 130 120 148 217 258 229 169 165 216 194 185 143 243 128 204 184 188 134 119 201 174 184 158 161 94 166 120 143 172 180 212 188 249 115 138 -9 234 224 277 201 230 96 117 233 196 288 184 110 86 238 192 121 132 113 157 147 257 234 85 123 260 110 -9 151 109 156 234 155 187 121 -9 98 134 130 208 228 244 148 179 163 194 156 184 235 117 190 246 197 122 152 246 201 198 158 166 255 185 123 338 168 192 -9 168 152 -9 143 244 194 144 196 155 237 151 176 137 220 202 273 255 147 110 163 133 166 157 165 194 196 124 204 238 228 121 228 232 145 374 183 169 204 147 188 161 196 347 204 141 240 115 214 259 230 116 183 229 120 177 238 255 172 129 175 109 273 187 180 131 196 157 155 113 -9 191 142 138 171 320 211 155 245 190 187 169 236 144 245 270 211 116 240 151 180 297 257 175 270 139 260 220 272 175 253 185 251 108 263 104 250 200 269 96 288 319 241 238 294 162 190 185 225 274 168 274 243 182 185 -9 260 188 207 152 155 149 98 287 186 193 246 180 -9 233 299 210 129 125 224 153 326 163 245 -9 170 154 208 208 260 198 220 278 209 174 230 176 292 157 235 266 138 316 285 195 217 160 132 176 372 203 181 197 229 176 296 182 187 302 303 140 180 148 261 -9 154 179 192 208 165 264 284 262 198 200 149 234 186 205 264 142 245 278 197 116 266 180 198 218 163 145 115 161 405 163 200 241 243 207 205 172 115 264 264 117 256 156 138 200 233 248 216 159 308 192 209 199 118 117 203 123 245 183 117 342 301 203 184 308 237 212 206 185 205 180 150 246 231 227 251 205 
1195 612 Miao China EAST_ASIA 128 126 142 129 156 230 138 120 182 102 130 120 148 217 260 241 173 165 220 194 193 145 251 138 222 200 190 140 119 207 187 184 158 167 94 172 120 145 172 184 212 188 255 115 141 -9 234 248 271 213 221 111 126 233 199 306 190 116 98 238 195 133 144 125 163 -9 -9 234 91 126 266 113 155 157 -9 165 240 152 187 136 -9 110 143 136 214 252 250 148 179 166 194 156 184 235 141 190 252 200 122 152 246 205 202 162 174 259 185 127 338 172 190 207 198 164 214 155 248 202 144 -9 159 237 163 176 137 200 210 273 255 155 130 155 149 170 157 169 198 208 124 212 242 232 121 228 228 149 374 183 169 204 155 196 153 200 351 208 161 240 115 222 267 238 120 199 239 128 197 242 -9 180 145 179 113 277 191 180 131 212 157 151 117 208 187 158 150 163 324 223 155 -9 190 211 177 244 148 245 278 231 124 236 155 192 297 241 175 270 155 264 220 276 191 245 189 271 112 271 112 274 212 269 100 300 319 241 242 302 166 198 193 237 310 168 266 239 178 189 278 260 192 215 160 155 141 -9 287 198 193 254 180 305 241 315 218 133 129 252 153 318 159 257 170 178 154 208 208 268 202 220 286 209 178 234 176 300 173 239 270 134 320 285 199 233 168 128 188 376 -9 201 185 233 176 296 186 187 302 307 140 176 164 -9 131 158 195 196 -9 173 272 300 -9 202 208 149 246 206 213 268 143 253 282 201 116 274 204 206 246 171 153 111 165 421 167 204 257 247 203 225 176 131 256 276 129 268 168 146 232 233 264 224 159 304 202 213 211 134 117 205 127 245 183 129 378 301 203 180 316 241 216 202 181 213 184 146 262 231 227 255 221 
1195 612 Miao China EAST_ASIA 120 124 124 129 156 230 138 112 180 98 130 120 148 217 250 229 173 163 216 194 185 143 243 136 220 184 188 134 119 199 174 182 154 163 90 166 120 143 168 180 208 185 249 115 141 -9 234 239 271 201 221 105 117 218 199 294 184 113 89 238 192 130 144 113 157 -9 -9 234 88 123 263 110 152 157 -9 165 234 140 187 133 -9 104 140 130 205 246 235 148 179 160 179 150 181 235 126 187 246 200 119 148 246 197 202 158 166 259 185 127 330 172 188 199 168 152 202 147 244 198 144 -9 155 221 159 172 133 200 210 273 251 155 126 155 145 150 153 165 194 196 124 204 242 224 121 216 228 149 366 183 169 204 151 192 117 196 347 204 161 240 111 210 259 230 116 167 231 124 197 242 -9 172 129 175 113 269 187 176 131 192 145 147 113 208 187 142 142 159 320 215 147 -9 190 183 165 240 148 241 274 219 112 236 151 184 297 225 175 254 147 260 212 276 183 241 181 259 108 259 108 266 200 261 100 296 319 241 230 298 150 174 193 233 282 164 262 243 178 177 270 260 184 211 156 143 141 -9 287 198 189 246 160 301 237 303 214 129 129 224 137 318 159 245 170 162 154 204 208 264 198 216 278 209 170 230 168 300 161 235 266 134 320 257 195 225 164 132 176 368 -9 193 181 209 164 292 186 175 298 299 140 176 148 -9 119 150 183 192 -9 165 268 292 -9 198 192 149 242 202 201 260 139 253 278 197 100 274 180 198 242 159 153 111 149 405 167 200 241 235 203 221 172 127 252 272 121 256 152 138 196 229 260 216 159 304 202 205 199 134 111 199 127 245 181 117 350 297 191 168 316 241 216 198 181 201 180 142 258 223 227 251 205 
1196 612 Miao China EAST_ASIA 128 116 144 135 142 234 148 120 180 100 136 120 156 223 258 235 167 165 218 194 187 143 249 142 226 200 190 138 141 207 191 180 158 167 106 174 130 173 170 184 212 188 252 115 141 -9 234 233 271 210 236 96 126 233 199 297 190 116 89 241 195 127 132 113 163 150 251 249 91 126 266 113 161 157 112 168 234 152 190 127 -9 113 143 127 208 249 244 148 179 166 197 156 184 247 141 193 252 200 122 152 246 205 166 166 174 263 185 127 346 176 200 211 174 160 202 155 244 194 152 188 155 237 151 172 141 224 210 273 259 131 126 159 161 150 157 177 202 212 124 212 238 224 133 220 228 149 390 183 189 204 147 196 153 192 351 212 157 244 119 226 267 238 116 179 235 128 197 238 255 192 153 183 113 277 187 176 131 200 157 151 113 214 191 162 150 171 320 221 155 245 194 187 173 240 144 225 274 219 124 244 151 184 305 241 187 278 163 264 208 268 191 253 189 263 112 263 108 262 196 269 100 292 327 245 250 302 162 218 189 225 290 170 274 235 182 185 282 264 188 211 -9 163 145 -9 291 198 193 250 180 301 241 303 218 129 133 244 169 326 167 253 174 178 154 216 216 268 202 228 278 223 202 234 176 304 169 239 270 146 324 289 207 229 164 128 188 372 203 189 197 233 172 296 190 183 302 303 144 176 160 -9 131 158 199 192 216 177 264 304 -9 202 208 153 246 198 209 276 135 253 274 209 116 270 204 202 250 167 157 115 169 421 163 200 253 239 209 225 180 131 272 272 129 264 164 134 248 229 256 224 167 312 206 209 203 146 121 203 121 245 191 117 358 301 203 204 312 269 216 206 181 -9 188 146 266 231 231 259 241 
1196 612 Miao China EAST_ASIA 126 116 124 129 142 230 144 112 180 98 130 120 148 217 250 235 147 165 218 194 187 143 245 136 224 184 186 134 139 201 183 172 156 163 102 166 124 173 170 174 208 188 249 115 141 -9 225 224 268 201 236 96 117 233 196 291 190 110 89 241 189 121 132 113 157 147 251 246 91 123 260 110 155 157 112 165 234 140 187 124 -9 104 134 127 205 237 227 142 179 160 194 150 184 235 129 181 249 200 122 140 246 201 206 158 166 263 185 123 338 168 198 191 168 152 198 147 240 194 144 184 151 237 151 168 125 216 210 261 255 131 122 155 149 146 157 169 198 204 116 204 234 216 121 216 228 145 374 183 177 200 147 192 153 192 347 204 141 240 111 218 263 230 112 167 235 128 197 238 255 180 129 179 113 277 187 176 131 196 153 151 109 212 179 154 142 171 316 205 155 237 194 187 169 240 132 225 274 219 124 244 151 176 297 241 171 278 139 264 208 268 183 245 181 259 108 259 104 250 200 253 96 284 327 237 230 302 154 202 169 221 286 164 274 239 178 177 278 260 184 205 -9 159 141 -9 287 182 185 242 180 297 241 295 218 129 129 224 153 306 167 253 170 170 154 208 212 264 198 224 266 209 178 230 176 300 161 239 262 142 312 285 199 229 160 132 176 372 203 185 197 209 168 292 190 179 298 303 140 176 160 -9 119 150 195 188 208 173 264 288 -9 198 196 149 238 190 209 276 132 253 270 201 116 254 204 202 242 163 141 111 141 417 163 200 249 231 207 213 164 131 260 256 117 256 160 126 232 229 256 204 159 308 192 209 203 134 117 201 121 241 187 117 354 281 203 180 304 249 216 206 173 -9 184 146 262 231 231 247 225 
1197 612 Miao China EAST_ASIA 128 136 124 141 164 230 142 122 186 106 130 120 148 225 258 241 173 -9 218 198 187 147 251 136 226 184 200 144 119 207 189 184 158 173 110 166 130 145 172 180 -9 188 252 115 141 105 234 245 274 213 221 111 138 233 199 309 190 113 89 241 195 130 138 119 163 159 266 234 91 132 263 113 155 151 118 168 234 158 190 130 193 110 -9 130 214 246 244 154 182 166 -9 156 184 247 141 193 252 200 119 152 246 205 206 162 162 259 189 139 338 172 194 203 194 164 186 151 -9 198 144 192 155 241 159 176 149 208 210 273 255 155 126 155 149 178 165 165 202 212 140 208 242 232 141 228 236 149 374 195 197 208 163 196 185 192 351 220 161 244 119 218 259 234 120 183 229 120 -9 242 263 -9 157 175 133 277 191 184 151 200 149 -9 121 214 191 142 154 171 324 229 159 241 198 187 177 256 152 229 274 231 124 248 155 184 297 257 187 274 155 268 220 280 -9 257 185 -9 108 263 108 278 200 -9 104 300 319 249 230 302 154 206 237 241 298 178 274 235 182 189 282 260 196 -9 164 159 157 102 287 202 197 246 184 309 245 307 214 137 129 244 169 322 -9 249 170 178 158 208 216 268 202 224 278 213 174 234 -9 308 151 259 266 154 -9 289 203 245 164 128 184 376 215 193 201 233 180 304 186 179 302 299 144 188 160 269 123 158 187 196 208 177 264 296 274 202 208 157 242 202 209 280 143 253 286 197 -9 270 204 202 242 167 157 111 161 421 167 196 253 247 207 -9 172 131 252 276 -9 256 164 150 200 237 260 224 167 304 202 213 199 118 -9 201 129 245 183 125 366 -9 203 180 324 265 216 206 181 221 184 146 262 235 231 271 221 
1197 612 Miao China EAST_ASIA 126 114 124 129 156 230 138 120 186 98 130 120 148 217 258 229 167 -9 218 194 187 137 245 132 218 184 190 134 119 199 183 180 154 163 98 166 126 145 170 174 -9 182 249 115 141 105 225 239 271 201 221 111 129 224 196 297 184 113 89 238 195 115 132 116 157 156 251 234 91 123 260 110 155 151 112 165 234 152 187 118 178 104 -9 127 205 240 244 148 178 166 -9 150 184 235 129 190 249 200 119 148 246 197 198 158 162 259 185 135 330 168 190 191 174 164 186 143 -9 194 144 188 155 241 151 176 129 200 206 269 251 151 122 147 149 166 161 161 202 204 140 208 238 228 141 224 228 141 374 183 177 204 159 192 185 192 347 216 161 240 115 214 255 230 116 167 225 120 -9 238 259 -9 149 175 109 269 187 184 131 200 145 -9 113 212 187 142 146 159 320 205 155 237 198 183 173 240 132 225 274 211 112 248 155 180 297 257 175 270 139 268 220 272 -9 249 185 -9 108 263 104 254 196 -9 100 296 315 241 226 298 146 194 185 233 282 172 270 239 182 177 278 260 184 -9 152 155 141 98 287 186 181 246 180 301 237 303 214 125 129 240 157 322 -9 245 170 170 158 200 204 260 198 220 274 209 170 234 -9 292 143 235 262 146 -9 257 199 217 160 128 180 372 207 173 189 233 172 292 186 179 302 299 144 176 148 257 123 150 159 196 204 173 264 296 270 198 188 149 238 202 209 272 135 241 282 197 -9 258 184 190 224 167 137 111 141 405 163 196 249 235 203 -9 168 131 248 272 -9 256 156 142 196 229 256 204 159 304 192 185 199 114 -9 201 123 225 181 117 350 -9 203 180 312 245 212 206 177 205 184 146 258 227 231 247 205 
1198 612 Miao China EAST_ASIA 126 128 144 129 156 230 142 126 186 98 136 122 148 217 266 235 165 -9 218 194 187 149 249 134 204 184 206 138 139 203 176 182 158 163 108 172 130 169 170 180 -9 188 249 115 141 129 231 239 277 201 221 111 126 230 199 300 193 113 95 256 195 127 132 119 163 -9 263 246 88 129 266 -9 158 166 118 165 249 155 202 130 193 104 146 136 214 237 -9 151 179 169 197 156 190 256 141 190 246 200 119 152 254 205 202 162 174 263 189 135 346 176 196 203 174 164 190 151 240 206 148 196 151 233 163 176 137 224 202 277 251 151 126 159 153 174 157 173 206 204 128 204 242 228 121 228 232 149 378 183 193 204 159 188 153 204 359 204 161 256 111 214 263 230 120 183 235 128 197 246 255 192 149 179 121 281 191 180 143 200 161 143 117 208 195 154 154 175 324 229 163 249 190 187 169 256 144 245 278 231 120 248 159 180 297 261 187 278 151 -9 224 272 195 253 189 267 112 267 108 286 200 273 96 300 323 245 242 298 166 190 189 245 294 166 278 239 178 189 278 260 192 211 164 159 157 -9 287 182 189 250 184 301 249 303 218 129 133 240 169 326 167 245 166 178 162 208 208 260 202 224 282 209 178 238 -9 304 161 251 266 154 324 285 203 257 164 136 184 372 211 185 201 233 184 300 190 183 302 307 144 196 148 289 131 162 199 192 212 177 276 292 -9 206 192 153 242 198 209 264 143 253 286 201 104 274 204 198 250 187 161 111 169 409 167 208 249 235 205 209 176 131 260 276 121 256 164 142 204 233 264 208 159 304 202 221 203 142 119 205 123 249 199 121 362 301 203 180 316 265 216 206 181 205 184 146 262 231 227 263 221 
1198 612 Miao China EAST_ASIA 126 112 124 129 142 226 140 112 182 98 136 120 148 217 264 233 147 -9 218 194 187 143 245 132 204 184 188 134 119 201 174 178 158 163 94 166 130 147 168 174 -9 188 249 115 141 120 231 224 271 195 221 96 117 221 196 297 187 113 95 241 195 118 132 116 163 -9 239 234 85 123 260 -9 158 157 109 162 234 152 190 127 187 104 143 136 208 228 -9 145 179 163 194 150 184 253 126 190 246 200 119 152 246 197 202 158 162 259 189 123 346 172 196 199 172 152 190 147 236 202 140 188 151 221 151 172 133 200 202 273 251 143 122 147 148 170 157 173 202 204 128 204 238 228 121 216 224 133 370 183 181 204 147 188 153 192 359 204 145 240 97 214 263 230 116 183 225 120 193 242 255 172 149 179 109 269 183 164 131 200 157 139 113 208 191 154 142 175 320 223 159 245 190 179 169 240 132 245 274 211 116 244 155 180 297 245 175 274 139 -9 220 268 179 245 185 243 108 263 104 274 196 265 96 292 319 241 230 294 154 190 185 225 270 164 270 243 170 177 278 260 188 201 156 143 153 -9 283 178 189 246 160 297 237 299 214 129 129 224 157 314 155 241 162 178 154 208 208 260 190 220 266 209 178 226 -9 304 147 239 262 138 316 257 203 233 156 140 176 372 211 181 189 233 168 296 186 175 294 303 140 176 144 289 123 154 187 192 212 169 272 292 -9 206 188 153 242 190 205 252 139 253 286 197 100 258 180 190 242 179 157 111 161 405 163 200 245 227 203 205 176 115 260 268 121 256 160 126 200 233 260 204 151 304 196 213 203 134 119 203 123 241 181 117 338 297 203 180 316 241 216 198 177 197 180 146 262 227 227 263 205 
1223 622 Mongola China EAST_ASIA 128 126 140 129 162 230 146 -9 182 98 140 120 148 -9 258 -9 171 167 218 -9 187 149 -9 136 218 184 190 134 -9 201 189 182 164 167 112 172 126 145 170 180 212 188 249 115 -9 -9 237 242 274 -9 236 111 138 236 205 294 190 113 89 256 -9 121 144 122 160 162 -9 237 97 126 266 110 155 166 112 165 249 155 199 133 -9 110 143 133 208 252 247 142 184 166 197 150 190 247 135 193 252 200 122 152 246 205 198 166 178 263 185 127 342 176 196 191 -9 164 202 143 244 202 144 192 155 241 159 176 149 244 206 273 255 151 126 -9 148 170 161 173 202 196 128 208 246 240 145 228 236 149 382 183 181 200 159 192 157 200 351 216 157 244 97 214 271 234 120 -9 239 136 197 246 259 -9 -9 183 137 281 199 180 143 200 157 159 117 212 195 154 142 163 320 229 155 237 194 187 177 260 140 237 274 207 120 -9 155 180 297 269 187 274 -9 268 220 276 207 253 185 271 112 267 116 282 216 273 100 300 327 245 242 302 -9 206 193 237 278 172 274 239 194 189 294 272 196 219 156 159 161 116 299 202 197 246 180 321 -9 307 218 129 125 240 169 322 163 249 170 178 162 204 220 264 202 224 286 209 178 234 180 300 169 239 270 142 -9 297 203 261 168 132 176 372 223 197 189 209 184 304 186 187 298 -9 140 192 164 -9 131 162 207 196 212 173 272 300 290 -9 204 149 242 -9 205 -9 143 -9 286 205 116 274 204 198 246 179 153 111 -9 421 167 204 253 243 211 217 188 131 260 272 -9 264 168 138 232 237 -9 220 151 308 202 225 207 138 119 205 123 -9 -9 125 346 297 203 204 320 265 220 206 -9 -9 192 146 270 231 231 271 241 
1223 622 Mongola China EAST_ASIA 126 114 124 129 144 228 144 -9 180 98 130 120 148 -9 250 -9 147 165 214 -9 187 143 -9 132 218 184 188 134 -9 199 183 182 158 163 94 172 120 145 170 178 212 188 249 115 -9 -9 225 239 271 -9 236 105 123 227 199 288 184 113 89 238 -9 121 132 116 157 147 -9 234 85 123 260 107 155 157 109 162 234 155 187 133 -9 104 140 127 205 237 230 142 179 160 194 150 181 235 126 187 246 200 122 148 246 205 198 158 170 263 181 119 330 176 194 187 -9 156 190 143 244 198 144 192 151 233 155 176 141 208 202 273 251 151 126 -9 133 166 161 161 198 196 128 208 238 232 141 228 228 145 382 183 173 192 159 188 153 200 347 216 153 244 97 214 259 230 120 -9 231 120 177 242 259 -9 -9 175 117 277 191 176 135 192 153 147 113 212 187 142 138 163 320 199 151 237 190 187 169 240 132 225 270 207 116 -9 155 176 289 261 175 270 -9 264 220 276 191 241 181 263 108 263 108 278 208 265 96 292 323 241 242 286 -9 190 189 225 278 168 274 255 178 189 290 264 192 211 144 159 141 98 291 178 193 242 180 305 -9 307 214 121 121 228 153 310 159 245 162 174 154 200 208 256 198 216 278 209 178 234 180 300 161 235 262 130 -9 289 195 233 168 140 172 372 207 193 185 209 160 292 182 183 294 -9 136 188 152 -9 123 154 191 192 184 173 264 292 262 -9 196 149 226 -9 201 -9 139 -9 282 201 104 274 204 186 228 175 149 111 -9 421 163 200 241 231 207 209 180 131 248 260 -9 264 160 122 224 225 -9 216 151 304 202 209 203 138 111 205 123 -9 -9 117 346 297 203 180 316 241 212 206 -9 -9 184 142 258 227 231 263 217 
1224 622 Mongola China EAST_ASIA 124 128 140 135 156 232 142 112 188 106 136 118 154 217 262 235 175 165 218 198 187 145 247 140 224 184 188 148 119 213 183 182 162 167 106 166 136 171 170 184 212 188 249 115 147 108 228 242 277 213 239 111 126 236 199 300 187 -9 101 250 195 127 141 113 166 -9 263 246 94 132 272 -9 158 157 118 165 234 152 193 136 193 110 146 139 223 249 244 151 182 163 200 153 196 250 138 187 249 200 125 152 246 201 202 166 174 263 193 131 338 172 192 203 180 168 202 147 248 194 144 188 159 237 163 176 141 220 210 305 255 155 122 163 153 170 161 173 210 212 128 204 242 232 121 228 236 149 386 195 173 204 163 188 193 200 359 208 157 240 -9 218 267 238 124 183 239 132 181 246 255 172 149 179 113 277 187 188 139 200 157 155 113 212 195 150 146 171 328 229 155 245 190 187 173 256 152 245 274 211 120 248 163 184 297 261 183 258 151 264 220 276 191 257 185 263 108 263 104 262 216 265 108 300 327 241 246 298 170 198 193 229 282 178 274 227 182 189 282 268 184 219 164 -9 149 108 283 186 193 246 176 305 241 307 214 133 129 244 169 338 159 249 170 178 154 208 216 264 210 224 282 227 170 226 180 304 173 239 266 142 324 289 203 257 168 132 176 372 211 189 189 241 172 300 190 179 302 303 152 196 -9 289 127 150 207 196 208 177 268 300 266 202 204 157 250 202 209 268 139 253 282 205 120 282 204 202 246 179 157 111 165 413 167 200 257 239 207 225 176 131 260 264 121 256 160 130 240 233 256 208 159 312 202 209 -9 134 111 205 129 249 183 121 350 297 207 180 308 265 212 210 181 213 176 146 262 227 231 259 225 
1224 622 Mongola China EAST_ASIA 124 124 124 129 144 224 140 112 180 98 132 118 148 217 258 235 167 163 218 194 175 143 243 136 204 184 186 134 119 211 176 176 154 163 90 166 130 143 168 182 208 185 249 115 141 108 225 236 274 201 236 96 117 236 196 288 184 -9 95 238 192 127 132 113 157 -9 251 234 91 126 260 -9 155 151 109 156 234 152 187 130 190 101 140 133 202 237 227 130 179 160 194 150 184 235 132 184 246 200 119 148 246 197 202 162 162 255 181 123 334 168 188 191 178 152 198 135 244 194 144 188 143 233 159 172 129 216 210 265 247 147 122 139 153 166 157 169 206 204 124 204 242 228 121 224 232 145 382 179 173 200 159 188 153 196 351 204 157 240 -9 210 263 234 120 167 239 128 177 242 247 172 145 175 109 277 183 180 131 196 145 139 109 212 191 142 142 171 324 205 155 241 190 183 173 240 132 225 270 211 120 232 159 180 293 241 175 258 151 260 220 268 183 249 185 259 108 263 100 258 212 257 96 296 327 233 242 294 162 190 189 229 274 160 270 235 178 185 274 264 184 215 152 -9 141 98 283 182 193 246 160 301 237 307 210 129 125 244 169 314 155 245 166 178 154 204 212 260 210 224 278 209 170 226 168 292 143 235 258 134 320 269 187 241 164 136 176 368 207 185 189 233 160 296 186 175 298 303 140 192 -9 273 123 150 183 192 204 177 268 296 258 198 188 153 234 202 205 256 135 245 278 197 120 254 204 190 246 163 137 111 141 405 163 196 245 227 199 213 168 119 252 260 121 256 152 122 240 233 256 204 151 308 196 185 -9 118 107 201 127 245 181 117 342 289 203 168 308 253 212 206 173 205 176 142 258 227 223 255 221 
1225 622 Mongola China EAST_ASIA 126 126 142 137 142 234 146 128 186 104 136 120 150 217 258 -9 165 165 218 198 191 149 243 136 228 200 188 138 119 207 183 182 164 163 102 166 128 173 170 174 212 188 249 115 147 129 240 239 271 204 245 111 -9 236 196 300 190 113 95 250 192 133 132 128 163 147 260 237 94 129 -9 119 164 157 115 165 234 155 190 133 190 110 143 139 208 249 227 148 185 169 200 150 184 250 141 187 252 200 119 156 246 205 198 158 166 263 201 131 338 176 -9 207 180 168 198 151 240 194 148 192 155 237 167 176 141 232 196 277 255 151 126 163 133 170 157 177 206 204 124 208 246 232 121 228 232 149 378 187 173 204 163 192 153 204 347 204 157 244 115 222 263 238 116 183 239 140 197 242 259 192 -9 -9 109 281 191 184 131 200 153 155 121 212 183 154 142 175 324 213 151 245 190 187 177 256 148 245 278 211 120 244 163 184 293 245 175 282 155 268 208 276 195 245 189 -9 108 263 104 282 200 261 100 280 323 -9 246 294 158 214 193 241 278 168 278 239 178 185 282 264 208 223 -9 159 149 98 291 178 197 250 180 301 -9 319 210 133 125 248 153 326 167 241 174 182 162 212 220 264 202 220 282 223 194 238 180 312 169 -9 270 154 324 289 203 229 168 136 180 380 207 193 193 233 188 300 202 195 298 307 148 188 160 273 127 154 195 196 208 177 268 292 270 194 204 149 242 202 209 272 139 249 286 209 -9 274 -9 202 254 163 141 115 161 421 167 204 245 239 207 217 180 139 264 268 129 256 160 142 240 233 -9 208 171 304 198 221 203 138 123 205 127 249 -9 129 346 301 203 216 320 265 216 210 181 209 184 146 262 231 231 263 221 
1225 622 Mongola China EAST_ASIA 120 116 140 129 142 234 140 112 186 102 132 120 148 217 258 -9 147 165 216 194 183 149 243 132 218 184 188 138 119 203 174 182 154 163 102 166 120 143 170 174 212 185 249 115 144 105 237 224 271 201 236 96 -9 230 196 288 187 113 86 241 189 121 132 113 160 147 251 237 85 123 -9 107 158 151 112 165 234 155 187 127 187 98 143 133 202 243 227 139 179 166 194 150 181 247 132 181 252 200 119 140 246 201 198 158 162 255 185 123 330 176 -9 195 168 156 186 151 236 194 144 184 151 233 159 172 137 228 196 273 255 135 118 151 133 170 145 161 202 196 120 204 238 224 121 224 228 145 374 183 173 204 147 192 153 200 347 204 149 240 107 214 255 230 116 183 225 128 189 238 255 172 -9 -9 109 277 191 180 131 196 153 151 113 210 179 150 138 163 320 209 143 237 190 183 173 256 144 237 274 207 120 232 155 184 289 241 171 274 151 268 208 272 187 245 185 -9 108 263 104 258 188 257 96 280 315 -9 234 294 154 194 193 233 278 164 270 259 178 177 270 256 188 211 -9 155 141 98 287 178 181 246 172 297 -9 303 210 133 121 248 153 322 167 241 162 178 158 204 204 256 198 220 266 209 178 226 168 300 143 -9 266 154 316 277 199 229 160 136 176 376 203 189 189 233 164 296 170 183 294 303 140 188 160 261 119 150 187 192 192 169 248 292 262 190 200 141 238 202 205 264 139 245 282 201 -9 254 -9 202 242 163 141 111 141 417 167 200 245 239 203 205 176 131 260 268 125 256 156 138 228 233 -9 204 159 304 192 217 199 118 119 203 121 249 -9 121 346 297 191 204 316 265 216 198 177 205 180 146 250 231 231 255 213 
1226 622 Mongola China EAST_ASIA 128 124 124 129 162 230 138 124 188 98 136 120 156 223 262 -9 175 167 218 196 193 157 251 140 218 206 200 146 119 209 189 180 160 165 110 166 130 179 170 186 212 188 255 124 153 120 234 242 271 201 242 105 138 218 199 306 187 113 89 241 192 124 144 125 163 150 260 234 91 123 266 -9 161 157 109 165 249 152 190 130 199 113 146 136 208 243 247 148 182 169 -9 156 184 241 141 193 252 200 119 152 254 201 202 166 178 263 189 135 338 176 200 207 200 164 206 147 248 202 144 192 159 237 163 172 137 224 210 309 251 151 126 155 133 170 157 177 198 200 128 208 250 208 141 228 228 145 370 183 193 204 159 204 189 204 351 212 157 240 97 226 263 238 120 187 231 136 -9 238 263 188 149 191 133 281 191 172 131 200 157 151 113 212 195 154 150 175 320 225 155 245 194 195 177 252 144 225 278 207 116 244 159 180 297 253 179 274 -9 264 224 264 195 249 189 259 112 267 112 270 216 269 104 292 323 249 238 306 154 194 193 233 294 168 278 235 182 193 282 264 184 219 160 155 141 108 291 190 193 250 180 309 -9 311 218 133 125 252 157 322 163 257 174 186 162 208 212 264 206 232 282 223 178 230 180 304 169 263 266 150 324 289 203 261 168 132 180 368 215 193 193 229 168 300 182 183 298 -9 140 176 164 293 119 154 187 204 212 177 272 304 270 202 204 149 238 -9 209 256 151 253 -9 197 120 258 -9 194 242 167 157 115 165 417 167 200 245 239 207 209 180 131 268 268 -9 268 168 150 -9 237 260 224 167 308 202 217 203 146 119 203 125 241 -9 129 362 297 207 180 316 245 216 206 185 213 188 146 266 231 235 267 225 
1226 622 Mongola China EAST_ASIA 124 124 124 129 144 230 136 118 182 98 130 120 148 217 258 -9 175 165 218 194 187 147 243 136 218 184 188 142 119 209 183 178 154 159 86 166 120 145 170 182 212 185 249 115 141 108 225 242 271 195 221 105 126 218 196 288 184 113 89 238 192 118 144 113 163 150 251 234 88 123 263 -9 161 151 103 162 240 140 187 130 193 104 146 118 205 237 235 142 179 160 -9 150 184 235 126 190 246 200 119 140 246 197 202 158 162 259 185 127 322 172 198 203 168 160 202 143 240 194 144 188 147 233 155 172 137 216 210 273 247 151 118 139 133 170 153 169 194 196 128 204 242 204 129 216 228 145 370 183 173 204 147 188 153 200 335 204 157 240 97 218 263 234 116 167 225 124 -9 238 251 180 149 179 109 269 187 164 131 196 153 143 109 208 195 142 122 175 312 221 151 237 190 187 173 252 132 225 274 207 112 232 155 180 297 241 175 258 -9 260 224 264 187 245 189 247 96 263 104 266 212 265 100 292 319 229 234 286 154 194 185 233 282 168 262 239 182 185 282 260 184 207 156 155 141 98 283 178 193 250 180 301 -9 311 218 125 125 240 149 314 155 245 170 170 154 208 204 260 202 216 278 213 170 218 168 300 143 235 262 146 320 289 195 225 164 132 176 368 207 189 189 229 168 296 178 175 294 -9 140 176 148 289 119 150 171 192 184 177 264 296 266 198 200 149 234 -9 205 252 139 249 -9 193 116 254 -9 182 228 167 149 111 149 405 167 184 241 227 203 205 172 131 264 264 -9 256 164 142 -9 233 248 220 151 304 198 185 203 134 117 201 121 233 -9 117 350 285 203 180 308 245 216 202 177 209 184 146 262 227 231 251 217 
1227 622 Mongola China EAST_ASIA 128 128 146 129 158 230 142 116 188 98 136 120 152 223 258 233 171 165 218 -9 189 145 245 140 226 184 194 146 139 205 189 180 158 167 100 172 130 145 170 180 212 188 255 118 141 108 237 245 274 210 233 111 126 239 202 318 187 113 98 253 192 133 144 125 160 150 263 234 88 132 263 -9 158 157 115 165 234 155 190 133 -9 107 146 136 217 246 244 148 -9 163 -9 153 -9 241 132 193 252 200 119 140 254 205 206 162 174 263 209 123 342 176 194 207 190 168 206 147 244 198 148 196 155 237 163 180 145 220 210 305 255 155 118 151 133 170 161 173 206 212 124 208 250 224 121 216 228 149 382 183 197 204 159 196 181 196 355 212 157 240 119 222 -9 238 116 199 243 136 181 238 255 192 153 179 121 281 187 176 131 200 157 151 117 212 183 146 154 163 324 225 155 241 198 191 177 260 148 245 282 227 116 248 159 188 297 253 187 274 -9 264 220 276 203 245 197 271 108 263 108 270 216 265 108 296 319 245 234 298 162 194 185 237 302 172 274 -9 182 197 294 264 196 227 -9 159 149 98 291 198 193 250 180 305 -9 315 218 133 125 248 177 322 163 265 166 182 158 208 216 268 198 224 286 227 178 234 180 304 157 235 266 158 -9 293 203 -9 168 -9 180 376 211 193 201 237 184 300 182 191 306 303 140 204 152 -9 131 162 187 192 212 177 260 296 262 202 204 141 246 198 209 268 151 257 286 213 116 270 180 190 242 179 153 111 165 421 163 208 249 243 213 209 172 131 264 272 125 288 168 138 240 233 260 224 159 -9 204 209 211 142 119 205 129 -9 -9 117 370 297 203 180 312 269 216 206 181 209 180 150 250 231 231 275 237 
1227 622 Mongola China EAST_ASIA 124 124 144 129 156 230 138 112 186 98 130 118 148 217 250 233 167 163 218 -9 183 145 237 128 226 184 188 134 119 205 189 178 154 165 90 166 126 145 168 174 208 188 246 115 141 105 234 242 265 204 221 99 117 239 196 294 184 113 95 241 192 133 132 119 157 147 239 234 79 126 260 -9 158 151 109 162 234 155 187 130 -9 98 137 133 217 240 227 139 -9 160 -9 147 -9 235 132 181 246 200 119 140 250 205 198 158 162 255 185 115 338 176 190 203 176 160 202 143 236 194 144 172 147 237 159 168 137 200 210 273 251 143 118 151 133 154 145 169 198 204 124 204 242 204 121 212 228 145 378 175 189 200 147 188 165 188 347 208 149 240 97 214 -9 238 112 183 231 128 177 238 255 184 149 179 109 269 183 176 131 200 149 139 113 208 183 142 142 159 320 215 155 237 194 187 177 256 132 225 278 219 112 236 155 184 297 245 167 262 -9 264 220 272 191 245 185 263 108 263 104 270 216 257 100 292 319 241 234 294 150 190 181 233 302 168 270 -9 182 177 278 260 184 223 -9 159 137 98 287 178 193 250 176 305 -9 307 210 133 125 244 153 314 155 245 162 178 154 208 212 264 186 216 270 213 174 230 168 300 157 235 266 138 -9 285 199 -9 156 -9 176 372 199 189 181 213 180 292 170 175 294 299 140 196 148 -9 127 158 163 188 192 173 260 292 262 194 188 141 234 190 209 256 135 249 278 201 116 266 180 186 242 163 153 111 149 417 163 200 245 231 213 205 176 131 252 264 121 256 168 134 240 225 260 204 151 -9 202 205 203 138 111 201 125 -9 -9 117 370 293 191 180 312 265 216 206 181 205 176 146 250 227 227 263 233 
1228 622 Mongola China EAST_ASIA 126 126 146 135 160 234 146 114 182 102 132 120 146 225 262 233 173 165 220 194 187 143 247 144 230 184 210 134 137 205 189 180 158 167 112 172 126 145 170 184 212 188 249 115 141 108 237 233 274 210 242 111 126 233 199 309 190 -9 95 241 195 133 144 125 166 150 263 234 91 123 263 119 158 157 118 165 240 152 190 130 190 107 140 136 208 255 247 148 179 163 -9 156 196 253 138 196 246 200 119 156 246 205 202 166 170 259 189 127 346 164 194 207 178 164 202 155 240 194 144 196 155 237 155 180 137 216 206 277 251 143 126 151 149 170 161 169 206 204 144 212 246 232 141 232 236 149 390 183 189 204 159 188 193 200 371 216 161 244 119 226 263 238 120 187 243 -9 197 238 263 188 153 179 125 281 191 184 143 200 153 155 117 212 191 158 150 171 324 223 159 245 202 195 177 260 148 241 274 219 116 244 163 184 293 245 -9 278 155 264 224 276 195 249 185 271 108 263 108 282 212 269 100 292 319 245 242 -9 158 190 205 245 286 170 274 239 182 185 286 268 188 205 164 159 145 110 291 194 193 250 184 321 237 315 218 -9 129 244 169 326 167 253 166 182 158 216 216 260 202 220 286 209 174 234 180 304 173 239 266 182 324 293 203 257 168 132 176 372 207 193 201 233 172 300 182 187 302 303 140 176 164 289 123 158 207 196 212 177 264 300 266 202 204 153 246 202 205 280 142 253 282 197 120 278 204 202 246 171 149 115 165 405 163 204 249 235 213 213 180 135 260 272 129 268 164 138 244 233 256 224 159 308 206 213 211 138 121 219 127 249 181 129 354 305 215 180 316 249 220 206 181 209 188 146 258 227 239 267 225 
1228 622 Mongola China EAST_ASIA 124 116 144 133 158 228 140 112 180 98 130 114 132 217 258 233 147 165 218 194 187 137 245 132 204 184 188 134 119 205 174 180 156 163 110 172 120 143 168 174 212 185 246 115 141 108 234 224 271 201 230 96 117 230 199 288 181 -9 86 241 192 118 138 113 163 150 239 234 79 123 260 110 155 157 112 162 234 140 187 127 190 98 134 127 205 246 227 136 179 157 -9 150 181 247 135 193 246 200 119 140 246 201 202 158 170 259 181 123 338 164 190 195 168 156 190 147 240 194 140 184 155 233 155 176 129 216 202 273 247 131 114 139 133 158 146 165 206 196 124 204 242 221 141 224 228 145 370 183 177 204 159 188 153 196 351 204 153 240 115 210 263 234 116 167 231 -9 177 234 259 188 145 179 113 281 191 180 131 200 153 151 117 208 187 142 146 159 320 199 159 241 190 183 165 256 132 237 270 211 112 240 159 180 293 241 -9 274 147 260 220 260 187 245 181 263 108 263 104 258 200 265 96 288 319 237 238 -9 158 174 181 233 278 170 262 243 178 173 286 260 184 203 160 143 141 98 287 178 193 246 180 305 233 303 218 -9 125 244 161 318 159 245 162 174 150 212 208 260 198 216 270 209 170 230 168 300 169 235 262 134 320 289 199 229 168 136 176 372 203 193 193 233 172 296 178 175 298 303 136 176 164 273 119 146 163 196 192 173 264 292 258 194 192 141 242 198 201 252 139 245 278 193 100 274 180 186 236 163 145 111 141 405 159 196 245 235 203 209 172 131 252 268 117 264 164 134 240 233 256 220 159 308 198 209 199 134 119 197 123 229 181 117 346 297 191 180 308 209 216 198 177 193 180 146 258 223 231 255 209 
1229 622 Mongola China EAST_ASIA 126 124 124 135 164 238 140 116 182 98 130 120 -9 -9 264 233 173 167 220 -9 187 145 249 144 218 198 188 134 139 203 191 180 162 163 94 172 126 145 170 184 212 188 249 115 153 108 237 239 271 210 221 111 141 236 199 309 190 -9 89 256 195 127 144 116 163 153 260 249 88 126 -9 113 158 157 118 165 243 152 190 136 -9 110 143 139 208 252 247 154 -9 166 194 159 -9 247 138 190 246 200 125 152 246 201 202 170 170 259 185 131 342 172 -9 199 178 164 198 151 248 198 144 196 155 241 151 176 137 244 206 273 255 147 122 155 -9 170 157 169 202 208 140 216 254 248 145 228 -9 149 382 187 193 204 159 204 201 212 367 220 161 256 111 214 263 230 120 175 231 136 197 242 255 180 -9 183 117 277 191 184 131 204 157 159 121 212 199 162 146 171 320 239 151 245 198 199 169 260 144 245 274 227 128 240 159 184 297 245 175 270 151 268 224 276 195 245 189 271 104 271 108 -9 208 269 104 300 323 245 234 294 -9 198 201 233 294 168 274 239 182 189 278 272 208 215 164 159 149 114 287 194 197 250 184 313 241 303 218 133 125 244 157 322 167 253 166 174 158 204 212 264 206 224 286 223 174 226 168 300 173 -9 262 158 316 293 203 229 168 120 188 372 207 197 197 209 188 -9 -9 187 294 303 148 -9 164 289 123 158 195 200 208 177 264 296 290 202 200 149 242 198 209 264 139 253 282 209 116 274 -9 194 246 171 153 111 165 405 167 200 249 243 213 -9 176 131 264 268 121 256 156 134 244 233 -9 220 167 -9 202 229 207 138 125 213 125 -9 191 121 362 305 191 180 316 265 216 206 181 193 184 146 250 235 231 263 225 
1229 622 Mongola China EAST_ASIA 126 112 124 131 156 230 138 112 182 98 130 114 -9 -9 264 233 147 165 218 -9 187 143 245 132 204 184 188 134 119 193 189 180 162 163 94 166 118 145 170 174 208 185 246 115 147 108 225 236 271 201 221 96 117 236 196 294 184 -9 86 238 192 118 132 113 160 144 251 234 79 123 -9 110 158 157 118 162 234 140 190 130 -9 107 134 127 202 246 244 142 -9 163 194 156 -9 247 138 187 246 200 119 140 246 197 202 158 162 259 181 119 334 168 -9 199 176 152 186 143 240 198 136 192 147 237 151 176 133 212 202 269 255 143 122 151 -9 170 153 165 198 196 140 212 254 228 121 228 -9 149 370 183 173 204 151 188 185 192 351 212 157 240 97 214 263 230 120 167 203 120 181 238 255 172 -9 179 113 277 187 180 131 196 153 155 117 212 187 142 146 163 320 219 151 237 198 183 169 256 132 225 270 211 124 240 151 184 293 241 171 258 151 264 208 276 187 245 185 263 108 259 104 -9 208 265 100 288 323 237 230 294 -9 194 197 233 282 164 270 239 178 173 278 260 192 207 156 155 145 98 287 182 189 242 184 305 241 299 214 129 125 224 157 318 155 253 162 170 154 204 212 260 202 220 282 213 170 214 168 292 165 -9 262 122 312 289 195 225 160 132 176 372 203 193 189 209 184 -9 -9 187 294 303 144 -9 152 269 119 158 191 192 184 165 260 296 266 202 188 145 238 190 209 252 139 249 282 193 112 258 -9 186 242 163 153 111 141 405 163 200 245 235 199 -9 180 123 260 268 121 256 156 122 236 229 -9 204 151 -9 192 225 207 138 121 203 125 -9 191 117 350 297 191 168 312 261 216 206 173 193 184 146 250 231 227 255 221 
1230 622 Mongola China EAST_ASIA 126 116 124 133 166 232 142 116 182 98 130 122 148 217 258 -9 165 167 220 -9 189 147 245 132 228 206 186 144 119 201 189 182 154 175 94 168 130 -9 170 184 212 188 252 115 141 108 234 242 271 210 239 111 117 236 196 288 187 116 95 241 192 130 144 119 166 162 251 246 91 123 260 119 155 157 115 168 234 155 190 133 190 110 143 133 217 252 250 139 179 169 197 150 193 244 135 190 252 200 119 156 246 205 206 158 174 259 189 135 342 176 196 207 -9 160 202 147 248 198 152 188 155 237 163 176 153 220 210 273 251 143 126 151 137 174 157 169 206 212 124 204 246 228 141 224 228 149 374 187 189 204 159 192 193 208 351 220 157 240 115 210 263 230 124 187 231 128 193 242 255 192 153 199 109 281 191 188 139 192 157 167 121 212 199 158 146 171 324 227 163 241 198 195 181 256 148 249 278 235 120 244 155 188 297 237 175 254 151 264 224 276 187 257 185 271 108 263 108 278 220 269 112 300 323 245 242 298 154 202 209 237 266 172 274 235 182 197 286 260 200 211 164 159 145 108 295 190 193 250 180 309 237 311 214 133 125 248 165 326 159 253 166 186 154 216 212 264 202 220 282 223 174 230 168 304 173 239 270 158 320 289 211 241 168 132 180 372 211 193 197 233 184 300 190 183 294 307 144 196 160 265 131 158 191 196 192 177 268 296 266 202 192 149 242 202 209 256 139 249 282 197 116 270 212 202 246 171 153 111 161 417 163 204 261 235 213 221 -9 139 260 268 -9 256 156 134 244 233 260 224 159 304 202 209 211 138 121 205 121 245 183 117 334 301 191 180 320 245 216 214 181 205 188 146 262 231 231 271 209 
1230 622 Mongola China EAST_ASIA 120 116 124 123 156 230 138 114 180 98 130 120 148 217 258 -9 163 163 218 -9 187 143 245 132 228 184 186 134 119 199 174 176 148 171 94 166 126 -9 168 180 208 185 249 115 141 105 234 239 271 192 221 96 117 230 196 288 187 116 95 238 189 124 132 113 157 153 251 234 91 120 257 107 155 151 112 165 234 140 190 133 187 104 143 130 208 246 247 139 179 157 197 150 190 238 126 190 246 197 119 152 246 201 202 158 170 255 185 123 342 176 194 203 -9 152 190 147 240 194 144 188 151 237 159 172 137 216 206 269 251 131 122 151 133 150 153 169 206 200 120 204 242 224 141 224 228 145 370 183 181 200 147 188 189 204 351 216 141 240 111 206 263 230 116 187 229 128 189 234 251 172 145 183 109 281 187 172 131 188 149 143 117 196 187 146 138 171 320 219 155 241 198 187 165 244 132 225 270 211 120 232 151 180 297 225 175 254 143 264 224 276 187 245 181 259 96 263 104 254 212 269 100 296 319 233 230 294 150 194 193 229 262 168 270 239 178 177 278 260 188 211 164 147 145 98 291 182 193 242 176 301 233 307 210 133 117 224 165 318 155 249 162 178 154 204 208 260 190 208 266 223 174 226 168 296 169 235 262 154 320 289 203 233 168 140 176 372 203 193 197 209 168 300 186 175 290 307 140 192 152 265 119 154 187 188 184 173 244 296 262 190 188 149 238 198 201 252 139 245 282 193 112 254 180 194 246 167 137 111 141 417 163 200 245 231 207 209 -9 131 256 260 -9 256 148 134 240 233 260 204 151 304 202 185 203 134 111 201 121 245 181 117 330 289 191 168 308 241 216 206 181 201 180 146 254 227 231 267 201 
1231 622 Mongola China EAST_ASIA 124 116 142 135 156 236 150 128 186 98 132 120 146 217 264 235 173 167 222 -9 187 147 247 140 228 184 194 152 139 207 191 184 154 163 100 166 130 163 170 186 212 191 258 115 141 -9 237 245 274 213 236 96 129 239 196 297 190 -9 101 250 195 136 138 119 163 156 257 234 91 126 266 116 158 157 112 165 234 155 199 133 -9 104 134 133 217 249 250 151 185 163 197 156 193 253 138 187 252 200 125 160 254 205 202 166 174 271 189 135 334 176 196 199 168 152 202 147 244 202 144 196 155 237 167 176 141 228 210 273 255 151 130 159 153 170 157 181 202 204 128 204 246 224 133 228 244 153 390 187 189 204 163 200 153 200 -9 212 157 244 115 218 263 230 116 -9 243 132 197 242 255 192 153 187 117 277 187 180 131 208 157 143 117 212 191 150 150 171 320 221 159 249 -9 195 177 256 132 -9 278 227 116 -9 155 188 297 261 187 270 151 272 220 276 195 253 189 259 108 267 108 254 208 257 104 304 323 245 234 298 -9 194 201 233 294 174 278 239 186 181 278 256 192 223 168 159 145 98 287 194 193 250 180 309 241 299 218 133 133 240 157 326 163 245 174 178 158 212 216 264 202 224 282 223 190 230 168 304 169 239 266 142 328 289 207 -9 160 132 180 376 211 189 197 221 172 304 194 187 298 307 144 192 168 -9 123 154 203 192 208 177 264 296 274 198 208 153 246 190 209 280 135 253 286 197 116 274 204 194 246 175 149 111 149 409 171 204 245 235 205 217 176 139 260 276 133 264 164 142 236 233 260 204 163 304 202 217 203 134 119 203 127 249 191 129 362 297 207 200 312 265 216 202 181 209 188 146 270 227 235 263 221 
1231 622 Mongola China EAST_ASIA 122 116 124 131 142 230 140 118 180 98 130 114 132 217 250 233 171 165 218 -9 183 143 243 128 220 184 190 142 119 199 191 182 148 163 94 166 120 143 164 174 208 179 249 115 141 -9 225 224 271 201 221 96 117 236 196 288 187 -9 95 238 192 133 132 119 160 144 251 234 79 120 248 107 155 157 109 165 234 140 190 130 -9 104 131 130 208 249 241 148 185 160 194 150 184 235 126 187 246 200 119 152 246 197 198 162 162 259 185 131 334 176 188 191 168 152 198 135 240 190 144 188 155 233 163 172 129 220 202 273 247 143 122 159 133 170 142 165 198 200 124 204 238 204 121 224 228 149 374 187 173 204 147 188 153 196 -9 204 141 240 111 210 255 218 116 -9 225 128 177 238 255 188 149 183 109 273 187 176 131 208 157 143 113 204 191 142 146 159 316 215 155 241 -9 187 165 240 132 -9 270 207 112 -9 151 180 297 245 171 258 147 260 220 276 187 253 185 255 104 263 104 250 216 253 100 300 323 245 230 294 -9 170 189 233 270 164 274 243 178 173 278 252 188 211 160 155 141 98 283 174 193 246 180 297 237 299 210 129 125 240 153 322 155 241 166 174 154 204 212 256 198 224 266 213 178 230 168 300 143 235 266 138 320 257 199 -9 160 132 176 372 203 185 189 209 172 300 178 175 290 299 144 192 148 -9 123 150 199 192 192 177 248 296 262 194 188 149 234 190 205 276 135 249 278 197 112 266 200 190 246 175 149 111 145 405 167 204 245 227 205 209 168 135 256 264 121 256 160 134 236 229 252 204 151 304 198 209 199 134 113 201 123 241 181 129 338 293 191 180 312 209 216 202 173 197 184 142 246 223 231 259 201
1232 622 Mongola China EAST_ASIA 126 128 144 135 160 230 138 122 188 104 130 120 148 225 250 235 177 165 222 194 191 143 257 136 228 184 208 134 119 207 189 184 162 167 106 172 126 145 170 180 212 191 249 118 144 126 237 242 274 213 236 111 138 236 199 294 190 116 89 253 192 136 144 119 157 150 239 246 91 132 266 113 158 157 112 162 234 155 190 130 193 119 146 136 208 252 247 148 178 160 200 156 190 247 129 190 255 200 125 140 246 197 202 158 166 259 193 127 342 176 198 203 196 164 206 151 248 202 152 196 155 233 159 180 141 228 220 281 255 151 126 159 -9 174 153 169 202 216 132 204 242 228 129 224 236 153 382 183 177 204 163 188 165 204 359 204 157 264 115 218 259 230 120 187 237 -9 197 242 259 188 149 179 109 281 183 180 135 192 157 151 117 208 195 158 146 171 324 229 159 241 194 187 177 260 152 249 274 235 112 248 155 184 297 265 175 258 151 264 212 276 191 253 185 259 112 263 108 262 216 265 104 292 331 245 234 298 162 198 189 241 290 170 282 235 178 185 290 260 200 223 164 163 153 98 291 198 189 250 184 317 245 303 218 129 121 248 165 -9 167 249 170 182 162 212 208 268 198 236 278 223 182 230 180 300 165 251 262 158 324 289 203 241 168 128 176 376 203 201 201 233 172 300 190 187 306 307 148 192 164 265 131 158 195 196 192 177 272 296 270 198 200 149 238 206 209 284 139 249 282 201 104 270 208 190 242 167 157 115 149 417 167 204 249 231 203 221 176 135 252 268 129 264 164 142 244 237 260 220 159 304 200 221 207 146 123 201 129 253 191 121 358 305 207 204 308 249 216 206 177 213 184 146 254 235 235 267 225 
1232 622 Mongola China EAST_ASIA 126 114 140 129 158 228 136 112 188 98 130 120 148 217 242 233 171 165 214 190 183 143 253 136 220 184 188 134 119 203 183 184 158 163 106 166 124 145 170 174 212 188 249 115 141 105 237 239 271 210 221 111 117 230 196 291 190 107 89 241 192 118 144 113 157 150 239 234 91 126 266 110 158 154 109 162 234 152 187 130 190 110 143 127 205 243 244 139 178 142 179 150 187 241 123 187 246 200 119 140 246 197 202 158 162 243 181 123 342 168 190 203 168 164 186 143 240 198 144 184 155 233 151 180 129 216 210 269 251 147 126 151 -9 170 153 165 198 204 116 204 238 224 121 216 220 145 370 183 173 200 159 188 153 188 351 204 157 240 115 218 255 230 112 187 219 -9 177 234 255 184 145 179 109 269 183 172 131 192 153 143 109 208 195 146 142 171 312 199 155 237 194 187 177 240 140 245 266 211 108 232 151 184 297 241 175 254 143 260 212 272 187 245 181 251 108 259 104 250 200 253 100 288 319 241 230 286 162 194 189 233 286 168 274 239 178 181 278 260 184 211 156 163 149 98 287 182 189 250 160 313 241 303 218 125 121 248 157 -9 163 245 170 170 154 204 204 264 190 224 266 209 174 226 172 300 161 239 258 134 320 285 199 233 168 132 176 372 203 193 189 209 172 292 186 187 306 291 140 176 144 265 127 154 195 192 192 173 264 296 270 194 188 149 230 194 209 268 139 245 274 201 104 266 180 186 236 163 141 115 141 417 167 200 245 231 203 213 168 131 252 268 121 256 156 134 224 229 252 216 151 304 196 185 199 118 121 201 119 245 181 117 354 293 203 204 304 209 216 198 173 209 180 146 250 227 223 255 221 
1337 625 Naxi China EAST_ASIA 126 116 142 137 166 232 148 112 186 98 136 120 156 225 258 233 173 167 222 194 189 147 251 140 228 184 188 138 119 207 191 184 162 173 104 172 130 173 170 184 212 191 249 118 141 123 237 242 274 210 242 111 129 236 199 288 187 116 95 241 195 121 144 119 163 159 263 234 91 123 266 113 164 154 115 165 240 149 190 133 187 113 146 130 217 252 244 142 179 166 194 162 184 250 129 187 249 200 119 140 250 205 202 158 174 263 189 131 342 176 194 211 198 156 202 143 240 198 156 200 155 241 155 180 141 248 210 277 251 151 126 159 149 170 161 173 202 212 140 204 242 224 145 228 236 145 382 183 189 208 163 188 189 196 351 212 157 240 119 218 267 230 120 187 237 132 209 242 255 192 149 179 125 281 187 180 143 200 153 147 121 212 187 150 146 175 324 215 163 245 194 183 173 240 148 241 278 239 112 244 155 192 289 265 187 270 155 268 224 272 199 245 193 247 108 263 112 274 208 265 108 300 323 245 238 306 158 202 209 237 290 172 274 243 182 177 290 260 196 223 168 159 149 106 295 178 197 242 180 301 245 315 230 125 133 244 173 330 167 265 170 182 162 208 208 260 198 220 282 215 174 234 180 304 169 239 270 158 320 285 203 261 172 136 172 380 207 193 197 233 168 304 190 183 294 303 140 196 168 269 131 154 191 192 208 173 268 296 290 202 208 153 242 210 209 272 151 249 278 209 112 278 204 198 246 179 161 111 169 421 171 208 253 227 203 217 176 127 256 268 121 256 168 138 232 229 256 220 171 308 202 217 199 142 123 201 129 245 183 121 358 309 203 216 312 241 216 206 181 213 188 146 270 231 227 259 221 
1337 625 Naxi China EAST_ASIA 126 112 122 129 156 232 138 112 182 98 136 114 150 217 258 231 169 165 218 194 185 147 243 134 218 184 188 134 119 207 189 176 162 159 94 166 130 145 168 182 212 188 246 115 141 108 237 236 271 195 221 96 126 233 199 288 184 104 89 241 195 121 132 119 157 156 254 234 79 123 257 110 155 151 112 162 234 140 187 127 178 104 140 127 214 249 244 136 179 163 179 156 184 247 126 187 246 197 119 140 246 197 202 158 162 263 185 123 330 172 190 199 178 152 198 143 240 198 144 196 151 237 155 172 137 212 210 273 247 147 126 151 133 170 157 157 198 208 124 204 242 224 117 228 228 133 374 183 173 204 159 188 177 192 347 204 141 240 115 214 255 230 120 183 231 120 181 238 255 188 129 179 117 281 183 172 139 192 149 159 113 208 187 142 138 171 324 215 143 237 194 183 169 240 144 237 274 223 112 240 155 184 289 241 171 258 151 260 216 268 195 245 181 243 108 259 104 250 200 257 108 300 319 241 238 302 154 202 189 233 278 164 270 239 174 177 282 256 188 215 156 155 145 98 283 174 193 242 180 297 233 311 210 125 129 240 157 326 167 253 162 178 154 204 208 260 198 220 278 209 170 226 168 300 169 239 266 146 320 273 199 233 168 132 168 368 203 185 185 233 164 296 170 175 294 299 136 176 164 269 119 150 183 192 184 169 260 296 270 202 196 149 242 190 205 252 135 245 274 201 104 258 204 190 238 175 149 111 165 409 171 208 249 227 201 209 172 119 252 268 121 256 148 126 200 229 252 212 159 308 202 185 199 138 123 199 125 241 181 117 346 289 203 180 308 209 212 206 173 201 180 146 258 227 227 251 221 
1338 625 Naxi China EAST_ASIA 126 124 142 137 156 234 146 122 182 100 136 120 154 225 258 233 171 167 218 200 189 145 249 136 228 184 206 148 119 207 183 182 162 169 102 172 130 145 170 184 212 191 258 115 141 108 237 -9 274 210 236 96 129 239 199 297 187 116 98 256 195 133 144 125 160 162 251 246 91 123 266 116 161 154 109 165 234 161 196 133 190 98 140 127 205 -9 247 148 182 166 -9 150 190 235 135 190 252 200 119 -9 246 205 198 166 174 263 189 135 330 180 196 207 168 160 202 -9 236 198 -9 192 159 237 163 176 141 228 214 273 255 151 118 155 157 170 157 173 202 208 128 204 250 232 149 228 228 149 382 183 181 204 159 -9 193 200 355 212 157 244 97 214 271 234 120 183 231 124 199 238 255 180 149 183 129 269 -9 180 139 200 161 143 117 212 195 146 146 171 320 219 163 249 182 187 169 260 144 237 274 231 124 244 155 180 297 261 175 282 159 272 212 272 195 249 185 267 108 263 108 278 212 265 104 296 327 233 238 302 166 -9 213 233 306 174 274 239 186 185 286 260 188 207 164 155 141 106 287 198 189 246 184 309 237 307 214 133 125 244 157 322 167 257 170 178 158 208 216 268 206 232 278 223 190 234 180 304 169 255 266 162 320 297 203 233 168 132 180 376 211 193 197 233 188 300 190 187 302 303 140 180 164 289 131 162 195 192 192 181 264 300 266 -9 208 153 246 206 213 280 143 253 286 201 116 274 204 198 242 167 157 111 141 417 163 200 253 235 209 209 176 135 264 268 121 280 -9 146 240 233 -9 216 159 308 202 213 207 142 111 201 127 -9 181 117 374 301 203 216 316 265 220 206 181 201 188 146 262 231 231 271 225 
1338 625 Naxi China EAST_ASIA 120 112 124 137 142 230 138 120 182 98 130 114 148 217 258 233 167 165 218 198 187 141 247 130 218 184 188 134 119 193 183 176 158 163 86 166 124 143 168 174 212 188 246 115 141 108 225 -9 274 207 221 96 117 230 199 288 184 116 89 250 192 127 132 119 157 153 251 246 91 120 260 107 155 151 109 159 234 140 193 127 187 98 134 127 205 -9 244 136 176 166 -9 150 181 235 126 187 246 197 119 -9 246 201 198 158 162 259 181 131 330 176 194 207 168 160 202 -9 236 194 -9 180 159 233 159 172 141 208 206 273 255 143 118 151 153 150 157 169 198 204 124 204 238 228 145 228 220 145 378 183 173 204 159 -9 185 200 351 208 145 240 97 210 267 230 120 183 229 120 177 238 255 180 149 179 113 269 -9 176 131 196 153 155 117 208 187 146 138 159 312 211 159 241 182 187 165 252 132 225 270 227 120 236 155 180 297 241 171 266 143 264 208 268 179 245 181 255 108 263 104 258 208 257 96 292 319 225 234 298 150 -9 185 229 286 170 270 235 174 177 278 260 184 201 156 155 137 102 287 182 189 238 184 301 229 303 210 133 121 244 153 322 159 249 166 178 150 208 216 260 190 220 278 209 170 230 180 300 157 235 262 162 316 289 199 225 164 128 176 368 203 185 185 209 168 296 174 175 294 303 136 176 160 261 131 158 187 192 184 173 260 296 266 -9 188 153 238 198 205 280 139 249 282 197 100 270 180 186 228 163 157 111 141 409 163 200 245 231 207 201 172 131 252 264 121 256 -9 134 236 229 -9 216 155 304 198 185 203 134 107 197 117 -9 181 117 354 297 203 216 308 209 216 198 173 201 180 146 254 223 231 263 209 
1339 625 Naxi China EAST_ASIA 128 128 146 141 162 236 142 124 188 98 130 120 148 -9 258 -9 167 165 218 194 187 143 251 140 218 200 188 136 139 211 191 180 158 167 106 172 128 173 170 180 212 191 249 118 -9 108 237 242 271 201 239 111 117 -9 199 306 193 116 95 241 192 121 144 113 163 156 263 234 94 132 -9 116 155 160 115 165 252 158 202 136 190 110 143 133 217 249 244 151 182 160 179 -9 184 250 141 187 252 200 125 156 254 205 194 158 -9 259 201 127 330 176 198 207 184 164 202 147 240 194 144 192 155 237 163 172 141 220 212 273 -9 143 126 159 149 170 157 177 -9 212 144 208 246 232 137 228 232 149 382 183 189 -9 163 192 193 200 367 -9 145 244 115 218 255 238 120 183 237 128 217 242 255 188 153 179 117 277 191 180 139 196 157 147 121 212 194 150 146 171 328 229 159 241 198 187 181 260 152 -9 274 231 132 -9 151 180 301 269 175 258 159 264 228 276 199 245 185 263 104 267 108 278 208 261 104 296 323 241 246 294 158 194 193 233 -9 174 270 239 -9 185 298 260 188 223 168 163 -9 102 287 198 201 254 184 317 237 311 226 133 125 244 169 -9 155 245 174 182 154 208 220 264 198 220 286 209 190 238 180 308 173 239 270 138 328 289 203 233 160 132 176 372 207 173 197 209 168 296 190 175 306 303 148 200 148 293 127 166 187 196 208 169 268 296 266 202 188 157 242 210 209 268 143 245 282 201 116 282 208 -9 -9 171 153 115 165 417 163 200 245 235 207 213 180 131 252 268 133 -9 164 138 236 233 260 216 159 308 202 209 203 -9 131 205 129 229 187 121 350 301 207 -9 320 -9 216 206 177 213 192 146 270 231 231 259 233 
1339 625 Naxi China EAST_ASIA 126 116 124 129 156 236 140 112 180 98 130 118 148 -9 258 -9 163 163 218 194 187 143 243 132 218 184 188 136 139 201 183 172 158 163 96 166 120 147 166 180 208 188 249 115 -9 108 234 236 271 201 236 96 117 -9 199 288 187 113 86 238 192 121 132 113 157 156 239 234 91 123 -9 113 155 157 112 165 249 155 190 133 190 98 134 133 217 246 244 148 179 142 179 -9 184 247 126 181 252 200 119 140 250 201 194 158 -9 255 181 119 326 172 196 199 178 156 190 139 236 190 144 184 151 233 151 172 141 212 202 273 -9 135 118 139 149 166 145 169 -9 204 120 204 238 228 121 228 228 145 374 183 189 -9 159 188 153 184 347 -9 137 240 111 210 255 238 116 175 225 120 185 242 255 172 149 179 109 277 179 172 131 196 157 163 117 204 191 142 142 171 320 221 155 241 198 187 169 240 140 -9 270 207 112 -9 151 176 297 241 167 258 139 264 224 264 199 241 181 259 108 263 104 278 200 257 96 292 319 233 230 286 158 170 193 233 -9 164 270 235 -9 177 278 256 188 215 152 159 -9 98 287 178 189 250 180 305 237 299 218 133 125 224 169 -9 155 237 166 178 154 204 216 260 190 216 274 209 174 230 176 304 169 235 266 130 320 257 203 217 156 132 176 364 199 173 197 209 168 292 178 175 302 303 136 196 148 273 123 150 187 192 208 169 268 292 262 194 176 149 238 198 205 252 139 245 262 197 112 254 204 -9 -9 171 153 111 145 417 159 196 245 235 207 201 172 119 252 264 117 -9 156 134 200 233 260 204 151 304 196 209 199 -9 125 201 119 229 181 117 346 297 191 -9 316 -9 212 198 177 205 188 146 266 227 227 255 225
1340 625 Naxi China EAST_ASIA 126 128 144 129 156 238 142 122 186 98 138 120 156 223 262 233 173 169 218 194 187 145 249 144 226 -9 206 152 139 207 183 182 158 163 104 166 120 145 170 184 212 188 252 121 -9 108 237 245 271 210 236 117 117 233 199 306 -9 116 98 241 195 133 144 113 166 153 266 240 91 135 266 113 161 160 118 165 234 155 190 133 190 104 140 136 208 249 235 148 182 163 197 156 184 235 138 193 246 200 125 152 -9 201 198 162 170 259 189 127 334 176 196 207 178 160 202 151 248 202 144 196 155 241 159 168 149 228 210 273 251 147 126 163 141 174 165 169 202 208 128 204 242 232 141 228 228 149 382 191 169 204 151 196 161 200 355 212 161 240 119 210 267 238 120 -9 231 128 217 242 259 180 153 179 125 281 187 180 135 196 157 143 113 212 198 154 154 175 324 237 151 245 198 183 169 240 148 -9 278 215 112 -9 155 188 297 245 187 258 151 272 224 280 199 249 189 267 108 267 104 286 216 261 104 304 327 241 246 298 166 198 193 233 286 178 274 239 -9 189 282 268 188 219 184 163 -9 102 295 198 189 250 180 309 249 303 222 125 129 240 173 326 159 249 170 174 158 212 212 264 198 220 282 213 182 234 180 -9 161 235 262 146 320 289 195 241 164 128 180 372 207 193 197 241 172 304 194 191 302 303 144 200 164 265 127 158 191 192 216 177 276 324 294 206 192 153 242 198 209 284 147 249 282 213 116 274 204 202 -9 179 157 115 161 413 167 200 253 239 209 217 176 135 264 272 121 256 168 142 248 233 264 224 159 316 202 213 199 134 117 205 125 249 191 129 354 293 203 -9 312 269 216 210 -9 213 184 150 258 231 235 267 229 
1340 625 Naxi China EAST_ASIA 120 124 124 127 142 230 138 112 182 98 128 118 152 217 254 233 147 167 214 194 177 143 247 136 218 -9 190 138 139 201 174 176 158 163 94 166 118 145 170 174 208 182 249 115 -9 105 234 233 271 195 221 108 117 224 199 300 -9 113 89 241 192 121 138 113 163 153 251 234 88 126 260 113 155 154 118 165 234 152 187 133 187 104 140 127 208 246 227 148 178 160 179 150 184 235 132 193 246 197 119 140 -9 197 190 158 162 255 185 127 330 172 194 207 178 156 202 147 240 194 144 184 155 237 151 164 129 216 210 273 251 147 122 163 137 170 153 165 194 208 124 204 238 232 121 224 228 145 382 183 169 200 147 188 117 196 347 204 157 240 111 210 267 230 116 -9 225 120 181 238 255 172 129 179 109 277 183 172 131 192 153 147 109 204 191 146 138 171 320 209 147 237 198 183 165 240 132 -9 274 207 112 -9 151 180 293 241 175 258 151 264 208 276 171 245 181 263 108 259 104 250 200 257 100 280 315 241 238 294 158 194 189 233 278 174 274 235 -9 189 274 260 184 207 156 159 -9 100 295 178 189 250 180 309 241 299 210 125 129 240 173 322 155 245 162 170 158 204 208 260 198 220 278 209 170 226 168 -9 143 235 262 146 316 285 191 225 156 128 176 372 207 173 193 233 164 284 178 191 294 299 144 176 164 261 119 154 179 188 192 177 272 296 266 198 188 149 234 190 201 264 139 245 278 209 116 262 180 186 -9 167 149 111 141 405 163 200 245 235 207 209 172 127 260 268 121 256 156 134 200 229 256 216 151 304 202 209 199 134 111 203 123 237 183 129 346 289 203 -9 304 209 212 210 -9 201 180 150 258 223 235 255 225
1341 625 Naxi China EAST_ASIA 128 128 142 139 162 230 138 112 188 98 138 120 156 -9 262 235 171 167 220 194 189 149 251 136 218 184 188 144 119 207 191 182 162 163 108 172 124 145 172 180 212 188 249 115 141 123 237 -9 274 213 221 105 144 236 211 309 184 113 89 241 189 133 144 122 163 162 263 237 91 123 260 110 158 157 112 165 234 158 190 133 193 110 140 130 208 240 -9 142 185 169 197 156 190 250 132 187 252 200 125 156 254 201 202 166 170 263 205 127 342 176 194 203 178 160 202 147 248 198 144 192 155 241 155 176 145 220 210 265 259 147 122 163 153 166 157 173 198 204 136 208 254 232 121 228 232 153 378 187 193 204 163 204 181 204 359 204 157 244 119 218 255 238 116 183 233 128 201 246 255 188 149 191 113 277 199 188 143 196 153 139 113 212 199 142 150 175 324 215 159 245 194 187 177 240 144 241 274 227 120 244 159 184 297 241 175 274 151 264 220 276 183 245 181 -9 104 263 104 258 220 257 104 300 327 241 234 298 162 198 205 241 286 172 270 247 182 185 278 260 188 -9 164 163 153 106 287 202 189 250 180 309 241 311 218 129 129 244 169 326 163 249 170 186 154 212 220 268 202 220 282 223 170 234 180 304 165 239 266 150 324 301 199 229 164 128 188 384 207 189 197 233 184 312 190 183 302 307 144 188 156 289 131 158 187 192 212 177 264 300 270 202 200 153 242 198 213 268 139 253 262 201 100 270 204 206 246 183 169 115 165 421 163 204 249 243 207 217 180 131 268 272 125 -9 168 138 236 233 260 204 167 304 202 217 203 138 111 203 125 245 191 117 -9 301 203 216 312 253 220 206 -9 217 188 150 262 235 235 259 217 
1341 625 Naxi China EAST_ASIA 126 124 124 135 156 230 138 112 182 98 128 114 148 -9 258 233 167 165 218 194 183 143 245 128 204 184 188 134 119 205 183 176 158 159 100 166 120 145 170 180 208 185 249 115 141 105 237 -9 271 201 221 96 129 230 199 288 181 113 89 241 189 121 141 113 163 147 263 234 91 120 260 107 155 151 106 165 234 155 190 124 178 107 134 127 208 240 -9 136 179 160 194 156 184 235 129 181 246 200 119 148 250 201 202 158 166 259 181 123 334 168 194 199 168 156 202 143 248 194 144 188 155 233 151 172 141 216 210 265 251 147 118 155 137 150 149 169 194 204 124 204 238 232 121 224 228 145 378 183 181 204 147 184 117 192 355 204 157 240 111 210 255 230 116 183 231 128 193 242 251 172 145 179 109 277 187 180 143 196 153 147 109 212 183 142 146 175 320 215 155 237 194 183 169 240 132 225 274 207 112 240 155 176 297 241 171 270 151 260 216 272 175 245 181 -9 104 263 104 254 216 253 100 292 319 241 234 298 154 194 193 233 270 164 270 235 174 169 278 260 184 -9 160 159 145 98 283 190 185 250 160 301 229 307 214 129 129 224 157 322 155 249 166 178 150 204 216 268 198 220 282 213 170 226 180 300 143 235 262 138 316 285 195 225 164 128 176 368 195 185 189 225 176 296 170 183 294 303 144 180 148 289 119 158 163 188 184 169 256 296 270 202 196 153 238 198 205 252 139 249 262 197 100 258 184 190 242 175 141 111 141 417 159 200 245 235 203 209 176 131 256 268 121 -9 148 134 196 233 260 204 159 304 200 185 199 134 111 201 123 245 181 117 -9 297 203 180 308 209 216 198 -9 205 188 146 250 231 235 263 205 
1342 625 Naxi China EAST_ASIA 126 126 124 139 160 236 140 122 186 98 136 128 158 223 258 233 167 167 218 194 187 145 251 132 232 184 206 148 139 207 189 176 162 167 96 166 128 143 172 184 212 191 246 118 141 108 228 -9 271 210 236 114 138 236 199 297 193 116 89 241 195 133 132 128 163 156 251 234 91 132 266 113 155 157 112 165 246 155 190 133 190 104 140 136 -9 252 244 148 182 169 197 150 190 250 141 187 252 200 125 148 246 205 202 158 162 267 189 131 342 176 192 207 178 164 202 147 236 198 148 196 155 241 163 176 157 224 206 273 255 155 118 159 149 170 157 173 202 212 144 204 246 236 129 228 232 149 382 183 189 204 163 196 193 200 367 216 157 240 119 210 263 238 116 175 231 128 193 246 255 192 153 199 113 277 191 180 135 196 165 143 121 212 187 142 146 171 324 221 159 241 194 195 177 240 148 241 274 231 132 240 155 188 301 241 171 266 151 264 228 280 187 249 193 267 112 263 108 258 208 269 108 296 323 245 246 298 162 198 185 237 302 172 270 239 186 185 290 256 188 207 168 159 141 98 287 198 193 254 180 305 241 303 226 133 125 248 169 326 167 253 162 178 154 204 212 264 198 224 278 227 174 242 180 308 173 239 270 138 320 289 199 233 164 132 176 372 207 193 197 233 172 296 178 187 298 315 148 188 164 293 127 162 187 192 212 177 276 300 282 198 200 149 246 198 209 268 139 245 282 201 116 274 204 186 242 175 169 115 145 421 171 204 245 235 207 217 184 135 268 272 133 264 -9 138 240 233 264 220 159 304 196 213 203 142 121 205 129 233 187 121 370 297 203 180 320 265 216 206 177 209 188 146 262 223 227 267 225 
1342 625 Naxi China EAST_ASIA 126 124 124 129 144 230 138 112 182 98 130 120 152 217 258 229 147 165 218 194 187 143 243 132 218 184 188 134 119 199 183 172 158 163 96 166 120 143 164 174 212 188 246 115 141 105 222 -9 271 201 221 96 117 236 199 288 184 113 89 238 183 121 132 116 163 150 251 234 79 126 260 110 155 151 109 165 234 155 187 133 187 104 140 133 -9 252 244 148 179 160 179 150 184 238 138 181 246 200 119 140 246 201 202 158 162 255 189 123 326 172 190 203 178 164 198 147 236 194 148 192 151 233 155 172 141 216 202 273 251 135 118 155 133 170 145 169 198 204 124 204 242 232 121 212 224 145 370 183 189 200 159 188 153 200 351 204 137 240 111 198 255 234 116 175 225 124 193 238 255 188 153 183 113 277 187 172 131 196 157 147 121 208 183 142 138 171 320 219 155 241 194 187 173 240 140 229 270 231 116 236 151 184 289 241 163 258 151 264 216 276 183 245 189 259 108 263 104 250 200 269 96 284 323 241 234 294 158 190 181 233 282 168 270 235 182 177 278 256 188 203 156 155 141 98 287 178 189 250 160 297 237 299 214 133 121 224 153 322 163 245 162 178 154 204 212 264 198 216 274 209 174 226 180 292 169 239 262 134 320 257 199 217 156 128 176 372 199 173 193 217 168 296 174 179 294 299 136 176 148 289 127 154 183 192 184 169 264 300 262 198 196 145 242 190 209 252 135 237 282 193 112 270 180 186 236 171 157 111 141 409 163 200 245 223 203 205 180 119 260 268 125 256 -9 138 200 225 260 204 159 304 196 185 203 138 119 205 121 229 181 121 350 289 203 180 316 265 212 198 173 205 184 146 258 223 227 259 205 
1343 625 Naxi China EAST_ASIA 128 124 140 133 156 238 140 122 182 98 138 120 156 223 262 233 173 167 218 198 189 145 253 140 226 200 192 138 139 201 183 180 158 163 94 166 120 145 170 184 212 188 261 115 141 108 234 239 280 210 236 108 117 230 199 306 190 116 95 253 192 133 144 122 163 162 266 240 88 126 266 110 161 160 124 165 234 152 190 133 190 104 143 136 208 246 241 151 185 160 194 150 184 235 141 193 246 200 125 156 246 201 202 158 170 259 185 127 346 176 196 207 178 160 202 147 244 202 -9 184 159 237 159 168 141 228 210 273 251 151 126 167 161 174 161 169 202 208 124 208 242 232 141 224 228 149 386 191 169 204 151 196 165 200 359 212 161 256 119 222 267 230 116 187 231 132 213 246 255 192 153 179 129 277 191 180 135 212 157 143 113 212 198 154 150 175 328 237 155 245 194 183 173 240 144 245 274 231 112 244 159 188 297 241 175 274 139 272 224 276 203 245 185 267 108 263 104 286 200 253 100 304 327 241 250 298 166 198 205 233 286 178 274 243 182 189 282 268 188 219 184 -9 149 102 295 198 189 250 180 313 249 311 214 137 129 248 173 322 159 253 170 178 158 212 216 260 202 220 282 213 182 242 168 304 169 259 262 146 320 289 207 241 164 132 176 372 207 193 197 233 176 304 190 191 302 303 148 200 164 261 127 158 191 196 216 181 272 324 294 -9 188 149 250 190 209 -9 147 249 278 213 120 278 204 202 246 179 149 111 141 405 167 200 253 243 207 217 176 135 264 272 121 256 160 142 236 233 268 220 167 316 202 225 -9 134 121 201 125 -9 183 129 354 301 203 216 312 269 216 210 181 205 184 150 258 231 235 255 205 
1343 625 Naxi China EAST_ASIA 120 116 124 129 142 230 138 112 182 98 136 120 146 217 254 233 147 165 218 194 187 143 249 136 218 184 188 134 119 193 174 176 158 163 94 166 120 143 170 174 208 188 252 115 141 108 228 233 271 201 221 96 117 230 199 300 184 113 89 241 192 115 141 113 157 153 263 234 88 126 260 110 155 154 118 165 234 140 190 133 178 104 140 136 208 246 235 148 182 160 179 150 184 235 126 187 246 200 119 156 246 201 198 158 162 255 185 123 330 172 196 203 178 152 198 143 240 194 -9 184 155 237 151 164 133 216 204 273 251 147 118 163 137 170 153 165 202 204 124 208 238 232 121 224 228 149 382 183 169 200 147 188 153 196 351 204 157 240 111 210 263 230 116 179 225 120 193 238 255 180 129 179 125 277 187 176 131 196 153 147 109 212 191 146 146 171 324 223 151 237 194 183 169 240 140 237 274 211 112 240 155 180 297 225 171 258 139 268 220 276 171 245 181 263 104 263 104 266 200 253 96 296 315 241 246 290 158 194 189 229 278 174 274 235 178 189 274 260 184 205 156 -9 149 100 287 182 189 250 180 301 241 303 210 125 121 240 173 322 155 249 162 170 154 208 204 260 198 220 266 213 174 226 168 304 143 235 262 138 316 285 195 225 164 128 176 372 207 173 193 209 176 284 178 183 294 299 144 176 164 261 119 150 159 192 212 177 264 296 266 -9 188 149 242 190 209 -9 139 245 278 209 100 274 180 194 228 171 145 111 141 405 167 200 245 235 207 209 172 119 260 268 121 256 156 126 200 221 260 216 159 304 202 209 -9 134 119 201 123 -9 181 129 346 289 203 180 312 265 212 206 173 197 180 146 258 231 231 251 205 
1344 625 Naxi China EAST_ASIA 126 128 124 141 164 230 144 122 188 102 136 120 152 217 262 233 167 167 218 194 187 -9 247 136 226 184 204 138 139 -9 191 182 158 163 96 172 126 145 170 174 212 188 249 115 147 123 240 -9 271 210 242 111 141 236 196 297 190 116 95 241 192 121 141 113 157 153 266 252 88 132 266 113 158 151 115 165 234 158 190 130 187 113 146 136 208 252 244 139 182 163 -9 156 190 250 132 187 249 200 119 148 246 209 202 162 170 259 185 135 338 180 194 207 178 160 194 151 240 194 144 184 155 241 155 180 141 212 206 273 255 151 126 163 148 170 157 169 206 212 148 216 254 228 141 228 232 149 382 187 193 204 159 192 157 200 -9 216 157 248 119 218 263 238 120 187 231 132 193 246 255 -9 129 195 117 281 187 180 131 204 153 155 121 210 187 162 146 171 324 215 155 245 194 211 169 256 148 249 278 227 120 248 163 184 297 249 187 274 155 268 224 276 191 257 185 263 108 263 104 286 220 269 100 296 331 245 242 298 158 198 193 233 298 172 -9 243 178 189 282 264 184 215 156 167 153 110 291 198 197 250 180 317 245 307 222 125 133 244 169 326 167 245 170 178 162 204 212 268 210 224 286 213 198 230 180 300 161 251 270 154 320 257 207 229 164 132 180 380 211 189 197 237 184 304 194 195 302 315 140 200 168 273 135 158 187 196 220 173 268 296 290 198 208 149 234 198 209 276 135 253 278 201 116 270 204 202 228 183 149 115 165 417 171 200 253 235 213 213 172 131 260 272 133 288 156 138 248 233 260 216 159 308 202 185 207 142 111 207 125 245 191 129 366 -9 203 216 316 265 216 210 181 221 188 150 258 235 235 267 221 
1344 625 Naxi China EAST_ASIA 120 124 124 135 164 230 138 112 188 98 132 120 148 217 258 229 165 165 214 194 187 -9 247 132 222 184 188 134 119 -9 174 178 158 163 94 166 126 143 170 174 212 188 249 115 141 120 237 -9 265 210 221 96 129 233 196 297 190 113 95 238 186 121 141 113 157 153 251 234 88 126 266 110 155 151 112 162 234 140 187 127 178 113 140 130 205 252 241 133 179 160 -9 156 181 247 126 187 249 197 119 140 246 201 202 162 170 259 185 127 326 176 190 191 176 152 186 147 240 190 140 184 155 225 151 172 141 208 204 273 255 147 122 151 145 154 153 165 194 204 136 204 250 208 137 224 232 145 370 183 169 200 155 184 157 196 -9 204 157 240 115 198 255 234 116 187 231 128 189 238 251 -9 129 179 109 277 179 164 127 196 153 159 113 208 183 142 142 167 320 215 155 233 194 203 169 244 144 237 274 207 112 240 155 176 289 241 175 274 147 264 216 272 191 245 185 259 116 263 104 270 212 261 96 288 323 241 234 290 158 194 193 225 282 170 -9 239 178 189 282 260 184 215 152 155 149 98 287 182 193 246 180 305 241 299 214 125 121 240 153 322 163 237 166 170 154 204 212 268 198 220 278 213 178 230 168 296 157 235 266 134 320 257 199 229 160 128 176 372 211 189 193 233 168 296 182 179 282 299 136 180 148 261 131 154 171 192 184 169 268 292 262 198 200 149 234 198 205 256 135 245 278 197 116 270 180 194 228 163 145 111 145 409 171 200 245 235 213 209 168 119 252 268 121 256 156 126 200 233 248 204 151 308 196 185 199 142 111 203 121 233 183 129 350 -9 191 180 308 209 216 210 177 213 180 146 246 223 231 259 205 
1345 625 Naxi China EAST_ASIA 128 124 144 137 166 230 140 114 186 106 136 126 152 229 260 233 -9 167 218 194 187 147 249 144 218 184 192 146 119 205 189 182 162 167 102 172 126 173 172 182 212 188 249 115 144 120 237 245 277 210 236 111 126 230 205 297 184 116 98 241 195 130 144 113 163 153 263 246 91 123 -9 113 161 157 109 159 234 158 190 127 190 104 146 130 214 249 247 148 182 163 194 159 196 247 138 190 246 200 119 152 246 205 198 158 174 263 185 131 334 168 196 211 178 164 198 151 244 198 144 192 155 237 163 180 141 220 206 281 255 143 122 159 157 170 153 173 202 204 120 204 246 228 133 224 228 149 386 187 197 204 151 200 153 204 359 -9 161 256 111 218 255 238 120 187 -9 140 193 246 259 192 149 183 129 281 191 184 143 196 157 144 121 208 191 142 150 171 324 219 155 245 194 199 169 240 144 -9 278 231 120 -9 151 184 297 241 175 274 155 268 220 280 207 253 189 267 108 267 104 262 216 261 100 296 327 245 250 298 162 202 193 257 -9 172 278 235 -9 189 282 260 188 215 164 159 -9 106 291 182 193 250 180 313 241 311 218 133 129 244 169 322 163 253 170 178 158 208 220 260 202 224 286 213 178 234 180 292 173 239 266 158 320 289 203 257 164 136 180 372 211 185 197 233 184 304 186 183 306 307 152 176 164 273 131 154 187 192 208 177 264 -9 270 202 204 149 242 194 209 268 147 249 286 201 116 270 204 206 242 179 157 111 165 421 167 208 245 231 203 201 176 131 260 272 125 -9 164 150 236 233 260 224 -9 308 206 217 199 146 119 201 125 249 191 129 362 297 191 180 320 237 216 206 185 205 188 146 258 227 231 271 221 
1345 625 Naxi China EAST_ASIA 122 124 124 129 164 230 136 112 184 106 130 114 152 217 258 233 -9 165 216 194 187 143 243 140 204 184 188 138 119 201 183 180 158 165 100 166 120 143 170 180 212 188 246 115 141 108 237 239 271 201 221 99 117 230 202 297 181 113 86 241 195 127 141 113 163 153 239 237 91 120 -9 110 155 157 109 156 228 152 190 118 178 104 134 130 208 246 247 136 178 142 179 156 184 235 138 187 246 197 119 140 246 201 198 158 170 259 185 127 326 168 192 203 178 156 190 147 244 194 144 184 151 221 163 176 137 200 206 269 255 135 118 151 153 150 153 161 202 200 120 204 246 228 121 216 224 149 378 183 177 204 147 200 117 196 355 -9 141 248 97 214 255 234 120 183 -9 128 189 242 255 172 149 179 117 277 187 184 139 196 149 167 117 204 183 142 142 171 324 205 151 245 194 195 169 240 144 -9 278 211 116 -9 151 180 293 241 171 258 143 264 220 276 191 245 181 259 104 263 104 262 200 257 96 284 323 233 238 294 150 170 193 229 -9 164 262 235 -9 177 278 256 184 203 148 151 -9 98 283 170 193 246 180 305 233 299 218 125 125 224 153 322 163 237 170 162 154 200 212 260 198 220 274 209 174 230 172 292 157 239 266 154 312 285 199 233 160 128 176 368 207 173 197 209 180 296 174 175 294 303 144 176 164 269 123 154 167 192 208 173 260 -9 270 202 200 145 242 190 205 264 135 249 278 201 104 266 180 202 228 163 149 111 145 409 159 200 241 227 203 201 172 131 252 264 121 -9 156 126 204 229 260 216 -9 304 198 217 195 138 111 197 121 233 181 117 330 293 191 180 320 209 216 198 177 197 180 142 246 227 227 263 205
1346 625 Naxi China EAST_ASIA 126 124 144 -9 156 230 140 124 188 102 142 120 158 225 262 235 169 167 218 194 189 149 247 138 228 184 190 134 119 207 191 180 158 165 106 166 120 147 172 180 208 188 249 115 147 108 237 236 277 213 242 108 135 233 196 309 184 116 95 241 195 133 138 119 166 153 263 237 91 132 272 116 155 157 115 165 -9 152 202 133 190 110 143 136 208 252 247 151 182 169 179 156 190 247 138 187 246 200 119 156 246 205 202 166 170 259 -9 127 334 176 194 203 194 164 202 151 244 198 144 196 159 237 163 176 141 220 216 273 251 159 134 151 153 170 157 165 202 212 128 208 254 224 141 228 236 149 378 183 193 204 155 204 157 196 363 204 161 260 111 222 259 230 120 187 231 128 193 246 255 188 149 183 113 281 191 188 131 208 153 143 117 208 199 154 150 171 324 221 155 245 198 203 169 260 132 -9 278 207 132 240 155 180 297 245 175 274 159 264 220 276 199 253 197 259 108 263 116 262 220 261 104 296 323 233 234 294 162 194 213 245 -9 178 278 239 -9 189 294 260 188 211 -9 159 -9 108 291 198 193 246 180 317 241 311 214 133 125 244 153 326 167 249 170 182 158 216 216 260 210 220 278 223 174 238 180 312 173 239 266 158 328 269 203 233 156 128 196 372 207 189 201 233 176 296 186 187 302 307 140 196 148 289 123 158 191 192 220 177 272 296 270 202 208 157 242 202 213 264 151 249 286 213 116 274 204 194 246 175 165 119 165 421 171 212 253 235 203 209 176 135 260 272 133 268 160 142 240 233 260 216 -9 304 200 229 211 138 119 205 125 241 191 129 362 297 203 -9 316 241 212 206 181 205 180 146 262 231 231 259 225 
1346 625 Naxi China EAST_ASIA 126 118 140 -9 142 228 138 112 180 98 142 114 148 217 260 231 147 165 218 194 185 143 245 132 226 184 188 134 119 199 183 176 154 163 94 166 120 145 170 180 212 185 249 115 141 105 234 224 271 210 236 96 126 233 196 294 184 116 86 241 186 121 132 113 163 141 251 234 91 126 266 107 155 151 112 165 -9 140 190 133 178 98 140 130 205 249 244 142 179 166 179 147 187 235 135 181 246 200 119 152 246 197 190 158 162 255 -9 127 330 176 192 203 168 160 202 143 244 194 140 184 151 233 151 172 137 216 200 265 247 143 122 151 149 166 145 161 202 204 124 208 238 224 121 228 228 141 370 183 173 200 151 196 117 196 359 204 137 240 111 214 255 230 116 183 225 120 185 242 255 188 129 179 109 277 171 176 131 192 149 147 113 204 191 142 150 167 320 219 155 241 198 187 169 244 132 -9 278 207 124 240 155 180 289 241 171 270 155 260 220 268 195 245 181 247 108 263 100 250 200 257 96 292 323 233 230 290 158 202 205 229 -9 174 274 235 -9 177 278 260 184 211 -9 155 -9 106 283 178 185 242 180 313 237 303 210 125 125 244 153 318 155 245 162 178 154 208 204 256 198 216 274 215 166 226 176 304 169 239 266 138 324 257 199 233 156 128 176 372 195 177 189 209 160 292 186 175 294 303 140 176 148 289 119 150 187 188 208 173 260 296 266 194 188 141 238 198 205 252 135 249 262 201 100 254 184 190 240 163 141 111 137 409 167 200 245 223 203 201 176 119 260 268 125 256 148 138 200 229 256 216 -9 304 196 213 203 138 117 201 123 237 191 117 350 293 191 -9 312 209 212 206 177 197 172 142 258 219 227 247 205
1203 613 Oroqen China EAST_ASIA 126 128 140 129 158 230 146 122 188 98 130 120 148 225 264 229 165 -9 224 194 187 147 243 140 228 184 188 142 119 209 189 180 158 165 94 174 126 145 172 186 -9 194 249 118 141 108 234 224 271 210 245 111 141 236 199 309 184 116 95 241 195 118 141 -9 163 -9 263 246 94 129 260 110 158 157 115 165 234 161 190 133 187 107 143 -9 214 252 -9 145 179 166 -9 156 190 247 141 193 252 200 125 156 246 205 198 162 170 271 185 135 346 176 196 207 198 164 202 147 240 194 144 192 155 237 155 176 141 224 214 277 255 155 130 155 156 174 153 177 206 208 136 208 242 232 145 228 232 149 382 187 193 204 147 204 169 192 359 212 161 260 119 218 263 238 116 187 241 136 205 242 255 -9 149 183 129 273 187 176 135 208 161 151 117 212 191 158 142 175 320 221 159 249 190 195 173 240 144 237 274 211 124 244 163 180 297 261 175 274 159 -9 224 276 195 249 189 271 112 263 108 258 212 269 108 296 323 249 234 298 166 194 209 237 286 168 282 223 186 189 278 260 196 215 168 159 149 -9 291 206 193 250 184 309 245 311 214 133 129 248 161 326 163 257 166 178 158 216 216 264 198 224 286 227 182 234 -9 300 169 239 266 154 316 285 203 233 -9 128 180 368 215 201 197 233 172 296 190 187 302 307 144 196 164 273 131 158 183 200 220 173 264 304 278 202 204 153 242 210 209 280 143 249 -9 213 116 262 180 202 246 167 153 111 165 405 167 204 253 235 203 213 172 135 268 272 137 268 172 138 240 233 260 220 171 304 202 209 199 134 117 213 121 245 191 129 354 297 203 180 316 237 216 202 181 -9 184 146 258 239 239 267 209 
1203 613 Oroqen China EAST_ASIA 126 116 124 129 158 230 138 120 182 96 130 114 148 217 258 229 147 -9 222 194 187 143 239 136 218 184 186 134 119 203 174 176 148 159 94 172 120 145 168 174 -9 185 249 115 138 105 228 224 268 204 221 111 126 230 196 300 184 113 95 238 192 118 132 -9 157 -9 251 234 79 123 260 110 155 157 115 165 234 158 187 133 178 104 140 -9 214 249 -9 145 179 163 -9 150 187 247 129 187 246 200 125 140 246 205 198 158 162 259 185 131 342 176 180 203 184 160 202 143 240 194 140 184 147 233 155 172 137 220 206 269 251 147 118 155 148 170 153 165 202 196 120 204 238 224 141 216 228 145 374 187 177 204 147 188 165 184 347 204 161 256 119 214 255 230 116 179 203 128 193 238 251 -9 149 183 113 269 187 176 131 200 157 147 109 208 183 142 142 171 320 215 151 237 190 183 165 240 144 225 270 207 108 224 151 180 297 257 171 270 151 -9 220 268 187 245 185 263 108 263 108 258 200 253 96 288 319 245 230 298 162 190 189 233 274 164 274 239 178 177 278 260 188 205 156 147 141 -9 291 194 189 242 180 301 245 287 214 133 125 244 157 314 155 249 162 178 150 216 212 260 194 220 282 223 174 226 -9 292 169 235 262 138 312 285 203 233 -9 132 176 364 207 185 189 209 164 292 182 175 298 303 144 176 152 269 119 154 163 192 196 173 264 292 274 190 188 149 242 190 197 276 135 249 -9 201 104 258 180 190 242 163 153 111 141 405 155 200 245 235 203 205 168 115 260 268 121 256 148 134 200 233 256 208 159 300 196 205 195 118 117 205 121 237 191 117 342 293 191 180 312 237 212 198 177 -9 184 142 258 231 231 259 205 
1204 613 Oroqen China EAST_ASIA 124 122 148 129 156 236 146 112 188 106 136 120 156 227 262 235 175 165 228 194 195 149 245 138 226 184 190 134 119 207 189 182 158 165 102 172 124 173 170 -9 212 188 246 121 -9 105 240 239 271 213 239 96 117 236 205 306 193 116 95 241 192 127 144 119 160 147 263 234 91 126 269 113 158 157 112 165 234 158 190 133 190 104 143 136 217 252 244 151 -9 166 200 156 190 250 126 181 246 200 125 156 246 205 202 158 178 267 205 127 346 176 192 207 178 164 202 151 240 194 144 188 151 241 159 176 137 232 206 305 -9 147 126 163 148 174 161 173 206 204 124 204 254 228 133 228 232 149 374 183 189 204 163 200 173 196 363 208 161 244 111 222 263 234 120 -9 247 140 197 242 263 188 149 175 125 281 195 188 139 200 161 159 121 212 195 142 138 171 320 219 159 245 194 187 173 260 148 245 278 227 120 -9 155 180 297 269 175 270 163 268 224 272 195 253 189 259 112 267 108 290 208 273 108 292 319 245 234 290 162 194 237 245 306 164 274 239 178 193 278 264 200 215 168 159 149 102 283 194 193 246 184 317 237 311 226 129 129 248 169 326 163 257 170 182 162 208 216 260 206 224 278 223 190 234 180 308 143 255 270 154 316 293 207 233 168 132 176 376 -9 189 197 209 184 304 186 179 298 303 -9 192 168 289 135 158 195 196 216 173 268 296 266 202 200 153 238 202 205 272 139 257 286 197 108 274 204 -9 242 167 161 111 165 425 159 204 257 235 209 209 180 -9 264 268 133 264 168 138 240 229 264 220 171 308 206 185 211 -9 121 201 127 249 187 129 374 305 203 216 316 269 220 206 177 201 184 146 258 231 -9 267 205 
1204 613 Oroqen China EAST_ASIA 120 116 124 129 142 236 142 112 186 98 130 114 152 223 260 233 163 163 218 194 187 147 243 136 218 184 188 134 119 201 183 176 158 165 94 166 120 145 168 -9 212 185 246 118 -9 105 234 239 265 210 239 96 117 227 199 297 187 113 89 238 192 118 132 113 160 147 251 234 88 126 266 113 155 154 112 162 228 140 187 130 178 104 134 136 208 249 244 139 -9 163 197 156 184 250 126 181 246 200 119 148 246 197 194 158 170 263 193 123 314 168 190 203 168 164 198 143 236 194 144 184 147 233 159 176 133 216 202 273 -9 143 118 151 133 170 153 169 202 200 124 204 242 228 121 224 228 145 374 179 181 200 159 192 173 192 351 204 157 240 97 218 259 234 120 -9 225 132 193 238 255 172 149 175 113 273 183 184 131 196 157 139 113 210 187 142 138 163 320 209 155 241 194 183 173 260 144 237 274 207 116 -9 151 176 289 257 171 258 159 264 220 272 183 249 185 259 104 263 108 274 200 257 96 292 319 237 234 290 158 194 185 229 270 164 274 239 174 185 274 264 184 207 156 155 149 98 283 182 189 242 180 309 237 299 222 125 125 240 157 322 155 249 162 174 154 204 216 260 198 220 270 205 174 230 168 292 143 239 270 146 316 293 199 225 156 140 176 364 -9 189 185 209 164 288 174 175 298 303 -9 176 148 261 123 154 187 196 212 165 268 292 258 202 188 153 238 190 201 256 139 249 282 197 100 270 184 -9 242 163 145 111 165 417 143 200 253 231 207 209 176 -9 260 264 133 256 160 126 228 229 260 220 159 308 200 185 199 -9 121 201 123 233 181 117 338 293 191 180 316 209 216 202 173 201 180 142 258 227 -9 251 205 
1205 613 Oroqen China EAST_ASIA 126 126 156 135 144 234 142 120 186 98 136 120 156 223 260 233 173 167 224 194 189 147 247 140 218 204 200 138 119 201 191 176 156 167 -9 172 126 145 172 180 212 191 -9 124 141 111 240 245 271 210 239 111 117 233 199 300 184 116 89 256 192 127 144 119 163 156 239 234 91 132 263 110 158 157 112 165 234 152 193 133 193 110 146 133 208 249 230 151 179 166 197 156 184 256 141 193 -9 200 119 156 246 209 202 162 170 263 205 139 330 172 194 203 184 172 206 151 248 194 144 192 155 237 167 180 145 232 210 309 255 131 122 151 133 -9 157 169 202 208 152 212 242 240 133 228 228 145 386 183 189 212 163 188 197 200 355 216 161 244 115 218 267 230 120 187 237 128 185 246 259 196 153 183 129 281 191 184 135 204 161 147 117 212 199 146 154 163 324 235 155 241 190 195 173 -9 148 225 274 207 124 240 155 180 301 -9 175 270 159 260 224 272 187 257 189 263 108 271 108 286 220 265 96 296 323 245 242 298 170 194 197 233 298 178 274 223 174 193 282 260 208 207 156 167 149 106 287 182 201 258 184 313 237 315 214 133 133 256 173 322 163 245 174 178 154 208 220 272 198 224 282 223 174 234 168 304 173 263 262 158 328 285 215 237 168 128 176 376 211 197 197 233 172 304 194 191 298 303 144 192 148 273 131 158 187 196 184 177 264 296 290 198 204 149 242 206 209 272 139 257 286 205 120 274 204 190 242 179 161 119 161 409 167 204 245 243 213 217 184 131 260 276 121 264 156 134 240 237 256 224 159 308 198 209 207 146 119 203 123 249 187 129 366 297 203 180 312 265 216 206 181 209 180 142 262 231 235 267 217 
1205 613 Oroqen China EAST_ASIA 120 124 142 131 142 230 142 118 182 96 130 114 148 217 256 229 147 167 218 194 183 143 245 136 218 200 194 134 119 193 174 172 148 165 -9 166 120 143 168 180 208 188 -9 115 141 108 231 233 265 201 221 96 117 227 199 297 184 113 89 241 192 121 138 116 163 144 239 234 88 126 263 107 158 157 112 165 228 140 190 127 187 104 146 133 205 249 227 151 179 160 197 150 184 235 138 181 -9 197 119 152 246 205 198 158 162 263 185 127 322 168 190 199 178 160 202 143 244 194 144 188 155 237 159 172 141 232 206 277 251 131 114 151 133 -9 153 161 198 208 140 208 234 208 121 216 228 145 382 183 169 212 155 184 165 196 347 204 157 244 111 218 259 230 116 175 231 120 181 242 255 188 129 175 113 281 187 180 131 196 157 147 117 212 195 142 154 163 320 229 151 241 190 183 173 -9 144 225 274 207 108 236 151 180 297 -9 175 270 155 260 220 252 187 249 177 255 108 259 108 274 216 253 96 292 323 241 230 294 166 190 185 225 294 164 270 239 174 185 274 260 196 205 152 159 141 98 287 182 189 246 160 301 233 307 210 133 133 240 169 314 159 245 166 178 154 204 208 260 190 224 266 219 174 230 168 300 169 251 262 146 328 257 199 233 168 136 172 368 207 173 185 213 172 300 182 175 294 299 140 188 148 273 131 158 183 192 184 173 264 296 266 190 188 141 242 198 205 256 139 253 274 201 112 270 196 174 242 171 145 111 161 405 159 200 245 235 213 217 176 131 252 268 117 256 148 134 196 229 256 204 151 304 196 209 203 138 119 201 121 245 181 117 362 297 203 180 308 249 216 198 177 201 180 142 246 227 223 259 205 
1206 613 Oroqen China EAST_ASIA 126 128 140 -9 156 230 146 116 188 98 130 126 148 -9 262 235 173 165 218 198 -9 149 255 142 218 184 192 136 119 205 183 176 162 175 102 172 126 173 170 186 212 188 246 115 141 108 234 242 277 210 242 96 126 224 202 300 190 113 95 256 192 133 144 119 163 -9 263 237 91 126 266 113 158 166 112 165 -9 155 190 136 190 104 143 136 217 255 244 151 179 160 200 156 -9 253 135 193 255 200 125 152 246 205 202 166 174 267 -9 135 346 172 -9 203 182 172 202 143 -9 198 -9 -9 155 241 163 176 137 216 210 -9 255 151 126 155 156 170 153 165 206 204 140 208 242 228 121 228 232 153 382 183 181 208 -9 196 -9 204 351 208 -9 244 119 218 259 234 120 187 243 128 177 242 -9 188 153 179 129 277 195 184 139 204 153 159 113 212 191 154 146 171 320 223 159 245 190 187 173 260 148 245 274 219 128 236 155 184 301 265 175 274 151 264 220 276 195 253 185 -9 112 271 108 258 216 265 96 292 327 241 242 302 162 194 205 233 -9 168 278 223 190 185 282 260 200 -9 156 159 141 -9 287 202 189 -9 180 305 -9 311 218 129 125 244 165 330 -9 249 174 178 162 212 212 264 202 228 286 223 190 -9 184 296 169 259 266 150 320 289 203 -9 168 128 176 368 215 189 197 209 184 296 186 179 298 307 140 176 168 293 135 154 195 196 204 173 264 296 -9 206 208 141 246 -9 213 284 143 253 278 213 116 270 204 190 246 163 157 115 161 413 167 204 253 243 211 221 172 135 252 268 133 -9 160 134 220 233 -9 204 171 304 200 217 195 146 123 205 125 -9 191 129 374 301 191 208 324 241 216 206 181 205 184 150 266 227 235 267 221 
1206 613 Oroqen China EAST_ASIA 126 116 124 -9 142 230 146 112 180 98 130 120 148 -9 258 229 163 165 218 194 -9 145 251 136 204 184 184 134 119 193 176 176 158 165 100 172 126 147 170 184 212 185 246 115 141 105 231 239 271 210 233 96 117 218 196 297 181 113 95 256 192 133 132 113 163 -9 251 234 79 126 263 107 152 151 112 165 -9 155 187 130 190 89 134 130 205 246 241 151 179 157 194 156 -9 247 126 187 246 200 122 140 246 197 198 158 162 263 -9 127 334 164 -9 191 174 164 190 143 -9 198 -9 -9 155 237 151 172 129 208 210 -9 251 151 126 151 149 170 153 161 206 200 128 204 238 228 121 224 228 149 370 183 169 192 -9 192 -9 188 347 204 -9 240 97 214 255 230 116 167 225 120 177 238 -9 188 149 179 109 269 187 180 131 200 149 151 113 210 183 142 142 171 320 215 135 245 190 179 169 260 132 225 270 211 124 232 155 176 293 241 167 270 143 264 220 272 183 245 185 -9 108 255 100 254 200 253 92 292 323 205 234 302 158 170 193 233 -9 164 274 243 186 177 278 256 192 -9 152 151 141 -9 283 190 189 -9 180 301 -9 287 210 129 125 244 149 326 -9 245 166 178 158 208 204 264 198 224 286 209 182 -9 168 292 161 235 258 146 316 285 199 -9 164 132 176 368 215 185 193 209 168 296 182 175 294 303 140 176 156 269 119 150 167 192 184 165 260 292 -9 202 200 141 242 -9 209 256 139 245 278 197 104 254 180 182 246 163 153 111 141 405 167 200 249 235 203 213 176 131 252 268 121 -9 152 130 196 233 -9 204 151 304 198 209 195 130 119 197 123 -9 181 129 342 293 191 180 308 209 216 198 177 201 180 146 266 227 227 247 201 
1207 613 Oroqen China EAST_ASIA 124 128 142 131 142 234 138 112 186 98 130 120 148 -9 262 235 175 167 218 194 187 149 249 136 232 184 188 148 139 207 174 180 162 167 100 172 126 145 170 184 212 185 261 124 -9 120 237 236 280 216 239 111 126 -9 205 294 184 116 95 238 195 136 138 116 163 162 257 246 85 126 266 107 155 157 115 165 234 140 190 130 190 107 143 136 220 246 247 145 -9 166 197 156 -9 247 126 193 246 200 119 156 246 201 202 158 174 267 189 123 342 176 194 191 176 160 202 147 248 194 140 -9 155 241 163 176 141 216 210 277 251 147 126 159 153 170 157 169 206 212 136 204 246 232 141 228 228 149 -9 187 177 204 -9 200 153 196 351 216 145 240 115 222 267 230 120 -9 231 128 209 242 -9 180 153 179 109 273 195 180 143 196 157 159 117 210 191 154 146 171 328 235 155 249 190 187 173 252 144 241 274 207 116 -9 163 180 301 261 171 274 151 264 224 272 195 249 185 267 112 263 108 282 212 273 108 304 327 241 238 302 166 190 209 233 290 178 278 231 190 189 278 268 196 223 160 159 145 98 291 202 193 246 180 309 245 303 218 133 125 244 157 326 163 253 166 178 158 216 220 264 206 224 282 223 182 234 180 292 172 239 262 146 324 285 203 -9 172 132 180 376 203 189 197 229 172 300 -9 179 298 311 148 192 156 273 131 158 195 200 212 177 268 296 -9 206 204 149 246 198 205 284 139 253 278 213 116 274 208 194 250 167 -9 111 165 425 163 204 261 243 203 217 172 131 268 268 125 268 164 146 244 237 256 216 -9 308 206 209 199 138 121 197 129 249 191 129 358 309 207 180 312 245 220 206 181 213 188 142 258 227 231 267 209 
1207 613 Oroqen China EAST_ASIA 120 124 126 131 142 230 138 112 186 98 130 120 148 -9 258 233 171 165 216 194 187 147 249 136 226 184 188 138 119 199 174 172 158 165 94 166 126 143 168 180 212 182 249 115 -9 108 237 230 271 201 221 96 117 -9 196 291 184 116 95 256 192 133 132 113 157 156 239 237 79 123 260 107 152 157 109 165 228 140 190 130 178 98 137 127 208 240 244 142 -9 160 179 150 -9 235 126 187 246 197 119 156 246 197 198 158 162 263 181 123 330 168 194 191 168 156 202 143 244 194 140 -9 151 233 159 176 137 200 206 273 251 147 118 159 133 146 157 165 202 200 124 204 242 224 141 216 224 149 -9 187 169 204 -9 184 117 192 347 204 145 240 115 222 263 230 120 -9 225 120 181 238 -9 172 145 171 109 269 187 164 135 196 153 143 109 208 191 142 142 171 324 221 151 245 190 187 169 248 132 225 274 207 116 -9 163 180 297 245 171 258 139 260 220 272 195 249 185 267 108 263 104 282 208 265 104 296 319 237 230 298 162 190 189 233 286 174 274 231 182 173 278 264 192 203 152 155 141 98 287 194 185 242 180 301 237 299 210 129 125 240 153 322 155 249 166 174 154 208 216 260 198 220 274 209 174 234 168 292 157 239 262 146 320 257 199 -9 168 136 180 372 203 189 189 229 168 296 -9 175 282 303 140 192 144 261 123 154 163 196 212 173 260 292 -9 198 188 145 234 198 201 272 139 245 278 209 116 254 204 190 242 167 -9 111 149 417 155 200 245 231 203 209 172 131 256 264 125 264 160 142 208 233 252 204 -9 304 204 185 195 134 111 197 125 245 181 121 354 293 203 180 312 245 220 202 173 197 180 134 246 227 227 263 205 
1208 613 Oroqen China EAST_ASIA -9 130 140 131 142 234 138 120 188 102 136 120 152 -9 258 233 147 167 218 194 189 147 247 136 228 184 200 136 119 203 191 182 162 167 114 172 130 145 170 180 212 188 264 121 -9 129 237 239 274 201 236 111 117 236 199 309 187 -9 95 241 195 133 132 113 166 153 263 246 94 132 263 -9 158 157 112 165 234 158 205 130 190 104 140 139 217 246 244 139 179 166 197 156 190 250 129 193 246 200 119 152 246 209 202 162 178 267 189 131 334 176 192 207 182 164 202 147 244 202 -9 200 155 237 155 176 141 232 206 277 259 147 126 159 153 170 165 169 210 212 124 220 242 236 145 228 236 149 390 191 181 204 147 192 157 208 359 220 157 244 123 218 263 238 116 -9 243 136 197 242 255 -9 153 183 129 281 195 176 139 208 157 163 117 214 199 142 142 175 328 235 163 249 198 195 173 244 148 -9 278 211 120 -9 155 180 293 241 179 274 163 268 220 276 199 253 185 267 108 263 108 286 216 269 -9 292 323 245 242 298 162 194 209 241 274 174 274 239 -9 193 282 260 200 219 160 155 141 100 287 190 193 250 184 313 245 307 210 133 129 -9 173 326 163 253 166 182 154 212 224 268 198 224 286 223 174 230 168 300 169 235 266 166 316 285 203 241 164 132 176 380 211 201 197 217 172 300 194 187 298 303 144 192 164 297 131 166 199 -9 208 169 272 300 266 202 204 153 246 198 209 280 139 -9 278 201 100 274 204 202 254 175 173 111 165 413 167 204 249 231 217 221 176 131 260 272 133 -9 172 138 244 233 256 224 167 308 206 185 203 142 123 205 125 -9 191 117 342 301 203 180 320 269 220 206 181 -9 188 146 262 231 231 259 237 
1208 613 Oroqen China EAST_ASIA -9 116 124 123 142 230 138 116 180 98 130 114 148 -9 250 231 147 165 214 194 187 143 243 136 226 184 190 134 119 199 183 180 148 167 100 166 120 143 170 174 212 182 249 115 -9 105 222 239 262 201 221 96 117 236 199 309 187 -9 95 238 192 118 132 113 163 141 239 234 79 123 260 -9 143 151 109 162 234 152 187 130 178 101 140 127 208 237 244 139 179 163 179 156 184 235 129 187 246 200 119 148 246 197 198 158 174 259 181 127 322 164 190 195 178 160 202 143 244 198 -9 192 151 233 151 176 129 216 206 273 255 147 122 151 133 166 145 165 202 212 120 204 238 224 121 216 208 149 382 167 173 196 147 188 153 200 347 212 157 244 111 214 259 238 112 -9 239 136 173 238 251 -9 145 179 113 281 187 176 135 196 157 147 117 212 195 142 142 163 320 205 155 245 186 187 169 240 132 -9 270 207 108 -9 151 180 289 241 175 274 143 264 220 264 191 245 181 263 104 263 104 282 216 265 -9 284 319 233 234 286 150 186 209 233 274 164 270 239 -9 177 278 260 188 215 156 143 137 98 283 178 185 246 180 301 241 307 210 125 125 -9 165 318 151 241 162 174 154 208 220 256 198 220 282 209 170 226 168 300 157 235 262 134 316 257 199 233 156 136 176 372 203 193 193 209 160 296 186 179 298 303 140 176 156 293 119 158 191 -9 208 169 264 296 258 198 188 153 234 190 197 260 135 -9 274 193 100 266 192 194 246 167 145 111 165 413 163 200 245 231 199 209 168 119 252 256 121 -9 172 126 232 233 252 216 151 304 200 185 195 134 117 205 121 -9 191 117 342 297 203 180 316 241 212 206 181 -9 180 138 258 227 231 259 225
1209 613 Oroqen China EAST_ASIA 120 124 152 129 166 234 146 128 184 98 130 120 152 -9 258 233 165 165 218 194 187 147 251 138 226 184 200 142 139 207 191 186 162 167 102 166 120 147 170 182 212 191 249 118 144 123 237 239 274 201 236 111 117 239 199 294 181 -9 98 241 195 121 144 116 163 159 251 237 91 126 266 -9 161 157 112 165 234 158 193 133 193 104 143 133 208 252 244 148 179 163 197 156 190 247 138 187 252 200 119 156 250 205 202 158 170 263 205 135 342 176 190 207 184 164 198 147 244 194 144 196 155 237 159 180 153 208 210 309 259 143 122 155 153 150 165 173 202 212 128 204 246 232 133 224 232 149 382 187 181 208 163 188 181 216 359 220 161 264 115 218 263 230 116 187 235 140 193 242 259 188 157 179 117 281 191 180 131 200 153 163 121 212 199 142 150 171 320 219 143 249 198 187 169 256 144 237 278 211 124 240 155 -9 297 241 179 274 151 268 228 276 187 257 189 271 112 267 108 278 212 269 104 300 327 245 246 294 162 190 213 245 286 172 274 231 190 189 282 260 188 203 164 167 145 106 287 186 197 254 180 317 237 311 218 129 125 248 169 322 163 257 170 178 154 216 216 264 202 228 286 223 174 234 168 304 169 239 266 154 320 289 199 261 164 128 176 372 211 189 197 225 188 300 186 179 302 303 144 192 164 269 119 158 187 196 220 173 272 296 258 206 204 149 242 202 209 280 143 253 278 197 116 286 196 202 246 167 145 115 165 417 159 200 257 231 213 225 180 131 260 276 125 264 160 150 240 233 260 216 151 308 202 221 195 142 121 203 125 249 191 129 354 301 203 212 312 241 216 206 177 213 188 150 266 235 231 263 221 
1209 613 Oroqen China EAST_ASIA 120 124 140 129 144 230 140 112 182 96 130 118 148 -9 258 229 147 165 218 194 185 147 249 136 204 184 188 142 119 203 183 176 158 163 86 166 120 145 170 180 212 185 249 115 138 120 225 224 271 195 221 108 117 239 199 288 181 -9 95 241 192 118 132 113 157 156 251 234 91 123 260 -9 152 151 112 147 234 140 187 130 190 104 143 130 205 243 244 148 179 142 197 150 184 247 132 187 246 200 119 140 246 197 198 158 166 259 185 127 338 164 190 195 178 152 190 147 240 194 140 184 151 233 151 172 137 200 202 273 247 131 118 139 133 150 145 173 198 204 124 204 246 232 121 220 224 145 370 183 169 204 147 188 157 188 355 216 153 240 97 214 259 230 116 183 233 128 177 234 259 188 145 179 109 269 187 180 131 196 145 143 113 212 191 142 146 163 320 219 135 245 190 187 165 256 144 233 274 207 124 240 151 -9 297 241 167 274 147 268 220 272 179 245 185 267 108 267 104 258 212 253 96 296 323 241 234 278 158 190 185 233 274 168 270 235 178 185 282 260 184 201 156 147 145 98 283 178 189 246 180 305 237 287 218 125 121 244 157 318 163 249 166 178 154 212 212 256 198 216 278 213 170 226 168 296 147 239 262 146 316 289 199 257 160 140 176 364 207 189 189 209 184 300 182 175 302 299 140 176 164 265 119 146 187 196 208 169 268 296 258 202 188 141 238 198 209 280 139 245 274 193 116 278 180 186 242 163 141 111 141 405 159 200 249 227 209 221 160 119 252 264 121 256 160 150 236 233 256 204 151 308 198 185 195 138 121 199 125 245 191 117 342 301 191 180 312 241 212 206 173 209 184 146 262 223 227 255 209 
1210 613 Oroqen China EAST_ASIA 126 124 144 129 158 234 140 112 188 98 140 120 148 -9 264 229 175 165 222 198 187 147 251 136 228 206 188 134 119 203 191 180 158 167 112 174 126 145 170 186 212 194 249 115 141 120 231 242 268 210 221 96 126 239 208 309 184 116 101 241 192 130 144 122 163 150 263 246 94 123 263 110 158 157 115 165 234 161 187 136 -9 110 137 139 223 252 247 151 185 160 200 159 190 247 141 196 252 200 125 148 246 209 198 162 170 259 185 135 342 176 -9 207 -9 164 202 143 248 194 144 -9 155 237 155 180 145 224 220 -9 255 155 122 159 149 170 153 169 202 208 140 208 246 232 145 228 228 149 382 187 193 204 -9 196 -9 204 359 212 -9 244 119 218 263 238 116 183 247 128 205 242 -9 192 153 183 125 277 191 176 135 200 161 151 117 212 195 158 146 171 320 219 159 249 198 195 173 240 144 249 274 211 108 244 163 188 301 261 187 274 -9 268 220 272 187 249 189 275 112 263 108 258 200 269 -9 304 327 245 250 302 162 206 -9 233 274 170 278 239 186 185 278 264 196 215 168 151 149 98 291 194 189 -9 180 305 -9 307 230 133 125 248 169 322 167 257 162 178 162 208 216 268 202 224 278 227 182 234 184 300 169 -9 266 154 328 285 203 233 160 128 180 372 207 201 197 233 188 296 186 187 302 303 144 176 164 -9 131 158 183 200 212 173 264 304 262 206 204 153 242 -9 209 276 143 249 282 197 116 274 180 190 246 167 153 119 149 413 167 204 245 235 203 213 180 135 252 268 137 256 160 138 244 233 256 220 167 308 202 209 195 138 117 213 121 -9 -9 129 342 297 203 180 316 245 216 206 181 213 184 146 262 247 235 259 209 
1210 613 Oroqen China EAST_ASIA 126 116 124 129 156 230 138 112 182 98 130 118 146 -9 258 229 147 165 222 194 187 143 239 132 224 184 186 134 119 201 191 176 148 167 94 172 120 145 168 184 208 182 249 115 138 108 228 239 265 210 221 96 117 230 199 306 184 113 95 241 192 118 132 113 157 147 251 234 79 123 260 110 155 151 109 165 228 158 187 130 -9 104 137 133 214 249 244 142 179 160 194 150 187 235 132 187 246 200 125 140 246 205 198 158 162 259 185 131 330 176 -9 203 -9 152 202 139 240 194 140 -9 147 233 155 176 141 216 214 -9 251 147 118 155 149 170 153 169 194 196 136 208 238 224 141 216 228 149 374 187 177 200 -9 188 -9 192 347 204 -9 240 119 214 259 230 116 183 231 120 193 238 -9 188 129 179 113 273 191 172 131 192 157 147 113 208 183 142 142 171 320 215 155 237 190 195 169 240 132 225 274 207 108 244 163 180 297 261 171 270 -9 260 212 272 183 245 185 263 108 263 104 258 200 265 -9 300 323 237 234 298 162 194 -9 229 270 164 274 239 178 177 278 260 188 207 156 147 145 98 291 182 185 -9 180 301 -9 287 218 133 121 244 165 314 163 249 162 178 150 204 212 260 202 220 266 209 174 230 176 292 165 -9 266 138 316 257 203 225 160 128 176 368 207 185 189 229 172 292 182 187 294 303 140 176 156 -9 119 154 163 192 196 173 264 292 262 190 204 149 242 -9 197 272 139 249 262 193 100 258 180 186 242 163 153 111 141 405 159 200 245 227 203 213 176 119 248 264 121 256 148 134 204 233 256 204 159 304 196 209 195 138 117 205 121 -9 -9 117 338 293 191 180 312 237 212 202 173 213 180 142 258 239 231 259 205 
1211 613 Oroqen China EAST_ASIA 126 128 126 -9 158 236 138 112 188 98 136 120 148 -9 258 233 171 167 222 194 193 151 251 132 228 184 190 148 119 209 183 182 -9 167 96 172 128 145 170 182 208 185 264 121 -9 120 234 245 271 213 239 111 132 239 205 297 187 116 95 256 192 133 144 119 166 -9 251 237 88 135 263 -9 164 151 112 165 -9 152 196 130 190 113 143 136 208 252 244 151 179 166 -9 153 -9 253 138 181 252 200 125 156 246 205 198 162 174 263 -9 131 342 176 192 207 182 160 202 151 244 194 148 196 155 241 163 172 145 232 210 -9 247 151 122 155 149 162 153 177 202 212 140 208 250 228 141 216 236 157 374 187 181 204 159 188 189 212 367 212 157 240 111 218 267 230 116 -9 243 120 177 246 255 188 -9 179 113 277 187 180 135 208 165 163 121 212 195 158 142 175 320 221 159 249 -9 187 173 240 152 245 282 211 116 -9 155 188 301 265 175 274 155 268 220 276 203 253 189 -9 108 267 108 270 220 265 104 300 -9 245 238 306 170 194 193 233 306 174 278 223 190 185 286 268 196 -9 164 163 141 -9 291 182 197 254 180 309 237 -9 214 129 129 252 169 322 -9 245 166 174 154 212 220 268 206 220 278 213 174 234 176 304 165 239 270 146 320 289 203 -9 168 120 176 376 207 193 193 233 180 304 194 179 294 315 144 192 168 273 131 158 195 -9 192 173 272 300 -9 202 188 153 246 202 205 268 139 249 278 197 -9 270 200 198 242 163 -9 111 161 417 175 200 257 239 -9 213 -9 127 264 268 125 -9 168 134 208 237 260 216 167 304 -9 185 203 138 113 205 121 249 181 117 374 297 203 180 320 241 216 206 181 213 184 146 262 247 231 255 225 
1211 613 Oroqen China EAST_ASIA 124 116 124 -9 156 234 138 112 188 98 130 114 148 -9 258 229 167 165 218 194 187 145 245 132 226 184 188 142 119 201 183 176 -9 167 94 166 120 143 164 180 208 182 249 115 -9 105 228 230 262 210 236 96 132 230 199 288 184 116 89 256 192 121 141 116 157 -9 251 237 79 123 260 -9 155 151 112 159 -9 140 190 130 190 98 137 133 202 243 241 148 179 160 -9 153 -9 250 135 172 246 197 122 148 246 201 198 158 162 259 -9 123 342 176 190 195 168 152 202 143 244 194 144 188 151 237 155 172 145 216 210 -9 247 147 118 151 133 150 153 165 202 208 124 204 246 204 121 212 232 149 370 179 169 204 159 184 165 192 347 208 153 240 97 218 263 230 112 -9 239 120 177 246 255 180 -9 179 113 277 187 172 131 196 157 147 113 208 187 142 138 163 320 215 147 237 -9 187 165 240 152 245 274 207 112 -9 151 180 297 241 171 258 151 264 220 276 195 253 185 -9 108 267 104 250 216 257 104 292 -9 241 234 290 170 190 189 229 274 158 274 243 182 177 282 264 188 -9 156 143 141 -9 291 178 189 250 160 305 237 -9 210 129 125 244 157 322 -9 245 162 174 154 208 216 264 186 220 270 209 170 234 168 300 143 239 266 134 320 285 203 -9 168 140 176 376 195 193 189 229 176 300 190 175 294 299 144 176 164 269 119 158 167 -9 184 169 268 292 -9 198 188 153 246 198 205 260 139 249 262 193 -9 254 180 194 234 163 -9 111 149 405 167 200 249 231 -9 213 -9 119 260 268 117 -9 160 134 200 221 248 216 151 304 -9 185 199 118 111 197 121 249 181 117 342 293 203 180 306 241 216 202 173 197 184 142 258 227 227 247 205 
1212 613 Oroqen China EAST_ASIA 126 124 144 135 164 234 138 118 186 98 130 120 148 -9 258 233 177 165 218 -9 187 147 245 136 218 206 200 140 139 201 183 178 162 167 104 168 126 147 168 180 212 188 252 121 -9 -9 237 245 271 210 221 105 -9 239 199 288 187 -9 95 241 192 133 144 113 163 -9 -9 237 91 129 263 116 152 151 121 165 234 155 208 133 -9 110 146 139 217 246 244 154 179 163 200 156 184 247 132 193 255 200 119 156 246 201 202 166 174 263 205 131 342 172 198 207 -9 152 202 151 244 202 152 196 155 237 155 176 137 240 210 265 251 147 126 155 157 170 157 173 202 208 128 204 242 232 141 228 240 133 382 187 -9 208 -9 200 153 204 351 208 157 252 -9 222 267 230 124 -9 243 140 197 246 255 188 149 183 121 281 191 176 143 196 157 143 117 216 194 158 150 167 316 225 151 253 194 187 165 256 144 245 274 207 120 -9 155 192 289 261 175 278 155 264 -9 276 195 261 193 267 104 267 108 282 216 261 -9 296 323 241 246 294 162 202 197 241 302 174 274 239 190 189 282 260 200 211 -9 155 161 -9 287 194 197 250 184 321 249 311 218 137 129 252 161 -9 163 253 166 178 154 216 220 264 206 224 282 223 198 238 180 304 169 239 266 142 316 289 207 229 164 124 180 380 219 193 197 229 176 300 186 175 294 307 136 -9 -9 -9 123 158 199 -9 212 169 268 296 -9 198 204 149 254 206 209 284 143 -9 278 201 116 274 204 198 246 175 169 115 149 417 167 204 253 235 207 221 176 135 260 272 129 -9 164 142 240 233 264 208 159 308 202 229 203 118 123 213 125 -9 181 121 370 305 211 216 308 265 212 202 181 201 188 145 262 231 231 259 225 
1212 613 Oroqen China EAST_ASIA 120 116 124 129 144 230 138 116 182 98 130 114 146 -9 258 233 165 163 218 -9 187 145 245 136 218 188 192 136 135 193 183 176 158 165 102 166 120 143 164 180 208 182 249 115 -9 -9 231 239 268 207 221 102 -9 233 199 288 184 -9 95 241 192 127 132 113 163 -9 -9 234 85 120 260 113 152 151 115 156 234 140 187 130 -9 104 146 127 217 246 238 148 179 157 194 150 184 235 126 193 246 200 119 140 246 197 202 158 170 255 189 131 330 168 196 207 -9 152 198 147 244 194 144 184 147 237 155 172 133 220 206 265 251 131 122 151 153 150 153 165 198 200 124 204 242 228 129 216 228 133 370 179 -9 204 -9 188 113 200 347 204 157 240 -9 218 255 222 120 -9 225 120 177 238 251 172 145 179 109 277 187 176 135 196 145 143 113 210 187 142 138 159 312 221 151 245 194 187 165 248 132 237 270 207 108 -9 155 180 289 241 171 258 151 264 -9 276 187 253 185 263 112 267 108 258 200 253 -9 280 319 237 230 286 146 182 197 233 290 172 270 239 178 177 278 260 188 209 -9 155 141 -9 283 182 185 242 180 301 245 303 210 129 129 248 153 -9 155 241 162 174 150 212 208 260 186 220 278 223 174 226 180 300 165 239 262 134 316 285 207 229 164 132 176 376 207 173 181 229 164 292 182 175 294 299 132 -9 -9 -9 119 150 191 -9 204 169 260 292 -9 186 188 145 242 202 209 256 135 -9 278 185 116 254 204 190 246 167 157 111 149 417 163 196 241 235 203 201 172 131 252 268 121 -9 160 122 200 233 256 204 159 308 196 209 203 118 121 203 123 -9 181 117 358 293 191 204 308 237 212 198 181 201 172 142 254 231 223 255 205 
1327 615 She China EAST_ASIA 120 124 124 -9 164 230 138 112 180 106 130 122 152 217 262 235 147 171 218 194 193 147 245 138 218 184 190 134 139 209 189 176 158 163 100 172 120 171 170 180 212 185 249 115 147 129 225 239 271 201 236 105 135 221 202 309 190 116 98 241 195 127 132 113 163 153 251 246 91 132 269 116 158 157 118 171 -9 152 187 130 190 113 134 139 208 252 244 151 187 163 200 159 184 235 144 190 249 200 125 160 250 201 202 166 162 267 -9 127 350 176 198 207 184 168 206 151 240 194 144 196 155 237 159 176 137 228 210 281 255 147 126 155 133 170 157 177 198 204 144 204 258 228 145 224 232 149 386 183 189 204 151 200 201 196 351 212 157 240 115 218 263 234 120 -9 235 120 189 238 263 188 145 183 109 281 191 176 131 204 153 -9 121 212 195 142 158 167 316 221 159 245 194 195 177 260 144 241 274 207 128 244 151 188 297 241 187 274 163 260 220 276 191 257 193 259 -9 267 116 274 200 -9 108 300 323 245 242 298 -9 190 193 229 -9 164 270 243 182 189 286 264 204 209 164 159 153 98 287 194 193 250 184 313 241 303 214 129 129 244 169 326 163 253 170 182 158 208 220 268 198 220 290 217 182 238 176 300 169 239 270 154 320 289 203 233 168 140 176 380 211 197 197 229 176 304 186 179 294 303 140 196 164 289 127 154 191 192 208 181 264 296 274 202 196 149 246 210 217 276 139 253 286 201 116 274 180 202 242 163 161 115 145 413 163 200 257 239 203 221 -9 131 260 272 129 284 164 142 240 233 256 224 167 304 196 221 203 138 -9 203 123 245 191 129 362 297 203 180 320 261 220 210 181 225 184 150 246 231 227 267 241 
1327 615 She China EAST_ASIA 120 116 124 -9 164 230 138 112 180 98 128 120 146 217 258 233 147 167 218 194 191 145 243 132 204 184 188 134 119 203 183 174 154 163 94 166 120 145 170 180 212 185 249 115 141 105 225 239 271 201 221 96 117 221 199 297 181 110 89 241 195 121 132 113 157 147 239 234 91 123 263 107 158 157 109 165 -9 140 187 130 187 104 134 130 208 240 244 148 179 160 194 156 181 235 129 187 246 200 122 152 246 197 198 162 162 255 -9 123 334 172 196 203 174 152 198 143 240 190 144 196 155 233 155 176 133 220 210 273 251 131 126 151 133 166 145 169 198 200 128 204 242 221 133 224 228 145 370 175 173 200 147 196 197 192 347 204 137 240 97 214 259 230 116 -9 225 120 181 234 255 180 129 179 109 273 187 176 131 196 149 -9 113 208 195 142 138 159 312 215 155 237 190 183 165 240 144 225 274 207 124 240 151 184 297 241 167 258 151 260 216 264 183 253 185 259 -9 263 108 262 200 -9 96 296 323 245 242 290 -9 190 189 229 -9 164 270 239 178 177 278 260 188 203 152 155 141 98 287 194 193 250 184 301 237 299 214 129 125 240 153 322 155 241 170 174 158 204 212 264 198 216 278 209 174 234 176 300 143 239 266 134 320 257 199 221 156 128 172 364 207 185 197 209 168 296 186 175 282 303 140 176 152 261 119 154 179 188 192 177 264 292 258 198 188 141 242 190 213 256 135 249 262 197 116 258 180 190 242 163 145 115 141 405 147 200 253 227 203 221 -9 131 252 272 121 256 160 134 236 233 256 212 159 304 192 185 199 138 -9 203 121 237 191 117 362 289 203 180 308 245 216 210 177 217 176 146 246 231 227 263 225 
1328 615 She China EAST_ASIA 126 124 144 135 166 236 148 112 188 98 130 120 148 217 264 233 147 167 218 194 189 145 255 142 222 184 188 134 139 207 191 176 158 175 100 166 130 145 170 180 212 191 252 118 141 120 234 239 277 213 236 96 -9 236 205 309 190 116 95 253 195 127 144 119 157 153 251 246 91 126 269 113 155 157 115 162 234 158 190 133 190 107 143 136 214 243 250 148 178 163 200 159 184 253 144 196 252 200 119 152 246 201 198 162 170 271 185 131 338 172 200 203 188 164 202 151 244 194 156 196 151 237 163 176 137 216 206 281 251 155 130 155 148 170 165 177 198 212 128 216 242 228 121 228 228 145 386 183 -9 204 163 188 157 208 355 208 157 260 -9 226 267 234 120 187 225 136 185 246 251 188 149 175 113 281 191 176 143 208 157 143 117 212 183 142 146 175 324 235 159 245 194 187 177 256 148 237 278 223 124 240 163 180 289 269 187 278 147 272 220 276 191 253 185 271 104 263 108 278 212 273 104 304 319 237 242 298 150 214 193 233 302 168 274 239 190 189 278 260 196 211 160 163 153 102 287 194 193 250 184 313 237 303 226 137 129 248 169 322 163 261 170 178 158 212 220 268 198 224 286 217 198 234 184 304 173 259 270 134 320 289 199 237 172 132 192 376 203 197 189 225 180 300 194 187 302 307 144 196 -9 289 131 154 203 196 212 173 268 304 302 198 200 149 254 198 209 256 151 249 286 205 112 274 180 198 -9 179 149 115 165 425 167 204 253 227 207 213 180 139 252 268 121 256 164 150 236 233 260 204 159 308 204 213 203 -9 121 205 127 241 181 117 370 301 203 180 304 265 216 206 185 209 180 146 258 227 227 279 237 
1328 615 She China EAST_ASIA 124 116 144 129 156 230 140 112 182 98 130 120 148 217 260 233 147 167 218 194 183 143 251 128 218 184 188 134 119 207 191 172 148 165 94 166 120 145 170 180 212 188 246 115 141 105 231 224 268 210 236 96 -9 230 199 297 187 110 86 253 195 121 132 119 157 147 251 234 91 123 263 110 155 157 112 162 234 155 187 127 190 104 137 130 208 237 235 139 178 160 197 156 184 250 141 187 246 197 119 140 246 201 198 158 162 255 185 127 330 172 192 203 184 152 202 147 244 194 144 184 151 233 163 172 137 200 202 273 247 131 130 151 148 146 157 169 198 196 124 208 238 228 121 212 228 145 378 183 -9 204 159 188 117 192 343 204 137 240 -9 198 263 234 116 187 225 120 177 238 251 188 149 171 113 277 187 176 131 196 157 155 117 210 183 142 138 159 320 215 155 241 190 183 169 252 132 225 270 207 108 236 155 180 289 257 167 274 135 272 220 276 179 245 181 259 108 263 100 262 212 257 104 296 319 225 234 294 150 194 185 233 270 164 274 235 182 173 270 256 188 211 156 159 141 102 283 178 189 250 180 305 237 299 210 133 125 244 153 322 163 253 166 170 154 208 204 264 186 220 274 209 178 226 180 292 169 235 266 134 316 257 199 225 164 128 176 372 199 197 185 221 164 292 178 175 294 303 140 192 -9 289 123 150 187 192 192 169 260 288 266 198 188 141 250 190 201 252 143 249 286 201 104 254 180 182 -9 171 141 111 141 405 159 200 249 227 203 209 172 131 248 268 117 256 156 134 224 229 260 204 151 304 192 185 195 -9 119 197 127 237 181 117 338 297 191 180 304 265 212 206 177 197 176 146 258 223 227 267 221
1329 615 She China EAST_ASIA 126 126 124 129 156 236 140 112 182 106 130 122 148 217 260 233 -9 167 218 194 189 147 247 136 228 202 188 134 119 207 183 184 158 167 104 166 120 145 164 180 208 188 246 118 141 108 237 239 274 210 221 111 -9 236 196 309 193 113 98 241 195 133 144 119 163 150 251 237 91 132 266 113 158 157 115 165 240 152 202 133 187 110 143 139 211 246 244 148 181 160 200 156 184 250 132 193 252 200 125 152 246 201 202 158 170 -9 185 131 346 176 190 207 198 172 -9 147 244 198 148 184 159 241 163 172 141 216 210 273 251 155 130 151 133 170 161 -9 198 216 144 204 246 228 141 224 236 145 378 187 -9 204 159 196 185 196 355 216 157 240 119 218 263 234 120 183 239 128 -9 242 259 188 153 183 109 281 191 184 131 200 157 139 121 212 195 150 150 171 320 219 159 245 194 195 169 248 152 245 274 215 116 248 151 180 293 241 187 258 159 264 220 276 195 257 185 267 108 263 104 -9 216 269 96 -9 323 249 230 294 158 194 193 233 290 164 274 243 182 189 278 260 188 215 168 155 141 100 295 198 193 250 184 309 249 303 218 133 133 244 169 322 167 245 170 182 154 212 212 264 202 220 282 213 -9 234 180 304 177 259 266 150 320 289 203 257 168 136 180 372 207 193 193 233 176 300 174 179 302 303 144 196 160 273 131 154 179 192 212 173 268 296 266 202 188 157 234 190 209 264 143 253 282 213 120 274 204 202 246 167 157 115 145 405 167 200 249 235 217 213 172 131 260 272 117 288 176 134 252 237 260 208 167 312 198 217 199 138 119 207 133 241 191 129 358 293 203 180 316 269 216 206 185 221 184 150 -9 255 231 267 217 
1329 615 She China EAST_ASIA 124 116 124 129 142 234 138 112 182 98 130 114 148 217 258 233 -9 167 218 194 187 143 247 132 228 184 188 134 119 193 183 176 152 167 92 166 120 145 164 174 212 185 246 115 141 105 225 224 268 201 221 96 -9 218 196 309 190 110 89 241 195 133 141 119 157 150 251 234 88 129 266 107 155 157 112 165 234 152 190 130 178 107 140 130 208 240 233 148 179 160 179 150 181 247 126 187 249 200 125 140 246 197 202 158 170 -9 181 127 334 172 190 203 188 152 -9 143 240 194 148 184 155 237 163 172 141 208 196 261 251 151 126 139 133 166 153 -9 194 204 124 204 238 228 133 224 228 145 378 183 -9 204 159 188 117 196 351 212 157 240 97 214 255 234 120 183 237 120 -9 242 255 180 149 179 109 281 187 176 131 200 157 155 113 208 191 142 146 171 316 215 155 237 190 183 165 244 144 225 274 211 112 240 151 180 293 241 171 254 151 264 216 260 179 253 181 267 108 259 100 -9 200 257 96 -9 323 245 230 294 150 190 189 229 266 164 270 239 174 189 274 260 184 211 156 151 141 98 283 186 193 250 180 305 245 303 218 129 125 224 153 322 163 241 170 182 154 212 204 260 190 220 282 209 -9 230 176 300 161 239 262 146 320 257 203 229 164 128 176 364 195 173 189 213 164 300 170 175 298 299 136 180 148 261 119 154 163 192 208 169 264 292 258 202 188 149 234 186 209 260 139 249 274 209 116 274 180 190 246 167 145 111 145 405 167 200 249 231 207 201 172 131 256 264 117 256 160 126 248 233 252 204 159 304 196 213 195 118 119 201 127 241 183 117 334 289 203 180 308 261 212 202 181 217 176 146 -9 231 231 263 205 
1330 615 She China EAST_ASIA 126 124 -9 135 156 236 142 112 182 98 136 120 148 217 264 233 -9 171 218 194 189 147 247 136 228 204 190 148 139 205 191 184 162 165 104 166 120 175 170 184 212 188 258 115 141 108 234 242 274 210 221 105 138 236 205 312 190 -9 95 241 195 127 141 116 163 150 263 234 88 123 -9 116 164 157 112 165 234 158 193 133 -9 104 146 133 208 246 247 148 187 166 179 159 199 247 141 199 246 200 125 152 250 201 202 162 170 259 189 127 350 180 196 207 174 152 206 147 244 190 144 192 155 241 159 176 145 236 -9 273 251 147 126 167 148 170 157 173 206 220 136 208 254 232 145 224 228 149 382 187 173 204 147 196 185 200 347 208 149 240 115 202 267 234 124 183 239 128 201 242 255 188 153 183 109 281 187 180 131 204 153 143 121 212 187 142 142 175 324 229 159 245 194 195 173 260 144 245 278 211 116 248 155 184 297 261 171 -9 151 272 228 276 195 253 189 259 108 271 108 262 216 257 108 296 327 245 242 290 166 194 189 241 294 168 278 243 186 193 -9 268 200 219 164 159 149 102 287 190 201 254 184 309 237 307 214 133 129 248 169 -9 155 -9 166 170 154 212 216 260 198 224 286 213 174 230 172 304 165 239 270 142 320 289 199 241 164 132 176 376 211 197 197 221 160 304 182 183 294 303 144 192 164 293 139 154 191 192 208 177 264 296 266 202 188 153 238 202 209 284 139 253 278 205 116 266 204 202 236 175 145 115 145 421 159 200 257 239 203 221 -9 131 268 -9 129 256 160 138 208 233 260 220 167 312 204 189 203 150 119 201 123 253 183 121 362 301 207 180 308 261 216 206 177 221 188 146 -9 231 239 271 221 
1330 615 She China EAST_ASIA 126 116 -9 129 142 230 138 112 180 98 130 114 148 217 262 231 -9 165 218 194 187 143 245 132 218 196 188 134 119 197 174 176 158 163 100 166 120 143 170 180 208 182 246 115 141 105 231 224 271 207 221 96 117 236 196 312 184 -9 89 241 192 118 132 113 163 147 251 234 88 123 -9 110 155 157 112 165 228 158 187 127 -9 98 134 130 208 240 233 139 178 160 179 153 184 247 126 193 246 200 119 148 246 193 198 158 162 255 189 127 342 176 190 199 168 152 198 147 240 190 144 188 155 233 151 172 133 224 -9 265 247 143 126 151 133 166 153 161 198 200 124 204 246 224 133 224 224 149 374 187 173 204 147 192 181 192 347 204 141 240 97 198 255 230 116 175 237 120 189 234 255 188 149 179 109 277 187 176 131 196 145 147 113 208 183 142 138 159 324 221 147 245 190 183 165 244 140 245 274 207 112 240 151 180 293 241 167 -9 151 260 220 260 183 249 185 259 104 267 104 258 216 257 100 296 319 245 242 294 158 190 189 229 266 164 274 235 182 177 -9 260 184 215 164 159 137 98 283 186 185 246 180 309 237 303 210 129 125 240 169 -9 155 -9 166 170 154 208 212 260 190 216 286 213 174 230 168 300 143 239 266 134 320 257 199 233 164 128 176 376 203 189 193 209 160 292 174 175 294 299 140 176 148 273 131 150 187 188 196 169 260 292 266 194 188 153 234 198 201 276 135 249 278 201 116 258 200 178 234 175 141 111 141 405 147 200 245 235 203 201 -9 115 264 -9 129 256 156 126 204 225 252 204 159 308 198 185 199 138 111 201 121 249 181 121 334 289 203 180 308 209 212 202 177 201 176 146 -9 223 235 255 205 
1332 615 She China EAST_ASIA 126 126 124 135 156 230 140 124 186 106 138 120 156 217 258 235 165 -9 220 194 187 143 245 142 218 184 188 144 119 205 189 184 158 175 -9 166 120 175 172 184 -9 188 252 115 141 108 234 236 271 201 236 111 141 -9 199 303 193 -9 98 241 195 121 144 116 163 162 263 237 91 123 260 113 152 157 112 165 234 158 187 133 193 104 143 133 208 252 247 148 182 169 194 156 184 250 135 190 252 200 125 152 246 201 206 162 174 267 185 131 346 176 204 203 174 160 202 143 248 194 144 184 155 237 163 180 149 224 214 269 255 147 126 159 153 170 161 169 202 212 120 208 254 240 121 224 240 145 386 183 193 208 163 192 181 192 351 216 157 244 119 222 263 234 116 183 245 -9 177 242 263 192 157 183 117 281 195 180 143 204 161 147 125 216 194 146 142 175 324 219 155 241 190 203 169 256 140 237 274 223 116 248 155 188 289 265 175 258 151 264 216 276 195 249 189 267 108 267 108 282 212 273 104 296 331 249 242 298 162 194 189 241 294 172 278 243 186 181 278 268 192 215 156 167 149 106 287 194 193 254 -9 309 245 303 218 133 125 248 169 326 163 249 174 182 154 208 224 264 214 232 278 213 182 234 -9 300 177 263 266 146 324 289 207 233 168 136 176 372 215 193 197 229 176 300 178 175 302 307 148 196 164 289 131 158 207 192 212 181 264 292 266 202 188 153 250 198 213 280 151 253 -9 201 120 274 204 198 242 163 157 115 161 417 163 200 257 231 209 221 180 131 260 276 125 256 164 150 236 233 272 -9 167 308 204 217 207 142 119 201 129 245 191 129 362 309 203 204 316 265 216 206 181 209 184 146 262 231 235 267 221 
1332 615 She China EAST_ASIA 126 124 124 129 142 230 128 120 180 106 130 118 148 217 258 233 147 -9 218 194 187 143 243 132 218 184 188 134 119 201 183 182 158 175 -9 166 120 173 170 184 -9 188 252 115 141 105 231 224 265 201 221 102 126 -9 196 297 184 -9 98 241 195 121 132 113 157 147 251 234 91 123 260 110 146 151 109 162 234 152 187 127 190 101 140 133 208 252 244 139 179 163 179 156 184 250 126 187 246 200 119 152 246 197 202 158 174 259 185 127 330 176 188 191 168 152 190 143 240 194 132 184 151 233 159 176 145 208 198 269 251 147 118 155 148 166 157 161 198 208 120 204 238 228 121 224 224 133 374 183 173 204 147 188 177 192 347 204 129 240 115 214 255 230 112 183 225 -9 177 242 263 172 145 179 109 281 187 176 143 200 153 155 109 210 194 142 138 171 320 215 143 237 190 203 169 244 132 225 274 211 116 240 151 180 289 241 175 258 135 260 204 268 183 245 185 259 112 263 108 250 200 265 96 292 319 245 234 286 150 190 185 225 286 164 274 239 178 177 274 260 184 215 152 163 145 102 283 182 189 238 -9 301 237 303 210 129 121 240 153 318 155 249 170 174 142 208 204 256 198 220 278 209 174 226 -9 292 173 251 266 138 320 285 203 229 160 128 176 364 207 193 197 209 172 292 170 175 298 303 144 192 144 265 131 158 179 192 192 169 260 288 266 194 188 149 242 190 205 256 132 253 -9 197 116 274 196 178 236 163 149 111 145 409 159 192 249 227 203 201 172 131 248 268 125 256 160 134 196 225 256 -9 151 304 196 185 203 138 119 199 121 245 181 117 354 309 191 180 300 265 212 198 177 205 176 142 254 227 231 251 205 
1333 615 She China EAST_ASIA 126 116 142 137 164 232 142 122 188 98 140 120 148 225 258 235 171 167 220 194 193 149 247 140 218 184 188 134 119 207 191 180 158 167 100 172 130 173 170 184 212 188 249 115 147 108 234 245 271 210 236 105 138 236 202 297 190 113 89 241 195 136 141 119 169 159 263 246 91 126 266 113 158 157 112 165 234 158 187 136 190 107 140 -9 208 255 244 148 182 166 194 156 190 247 135 187 252 200 125 156 246 205 198 162 174 267 189 131 334 176 198 203 186 152 198 135 244 198 144 196 151 -9 159 180 137 236 210 285 251 151 118 151 133 170 165 173 198 204 128 204 254 228 141 232 236 145 386 187 173 204 163 196 189 204 355 212 157 256 97 218 263 234 120 183 245 -9 197 246 255 188 157 183 129 281 183 180 131 200 161 147 113 212 195 150 -9 171 328 215 155 241 -9 203 173 256 144 241 274 231 116 244 159 184 301 257 175 282 155 268 220 276 183 253 185 263 108 263 116 278 208 269 100 292 323 245 246 290 166 190 193 233 286 174 270 243 178 189 294 260 208 219 160 163 157 110 287 182 193 250 184 309 241 303 214 133 125 248 169 314 163 261 170 178 154 212 220 264 202 220 282 219 178 230 -9 304 173 239 266 154 320 257 207 241 168 132 180 376 207 201 197 229 188 300 190 187 302 311 144 196 164 289 135 162 191 196 212 177 268 296 298 198 188 149 246 206 213 264 132 249 282 201 116 282 204 202 246 171 149 111 165 417 167 208 253 235 217 213 172 119 252 276 129 256 168 150 244 233 252 208 167 308 200 221 199 134 121 201 129 245 181 117 354 297 203 180 320 269 216 210 181 205 188 146 258 -9 231 267 205 
1333 615 She China EAST_ASIA 120 116 124 129 156 230 142 112 188 98 130 120 146 217 258 233 171 163 218 192 189 143 243 136 204 184 188 134 119 205 189 172 158 163 94 166 120 145 166 182 208 185 249 115 141 108 231 242 265 201 221 96 126 236 199 288 187 113 89 238 192 127 138 119 157 147 251 234 85 123 257 110 155 157 109 165 234 155 187 130 187 104 134 -9 208 252 241 142 178 166 179 150 184 235 132 184 249 197 119 152 246 201 190 158 174 267 189 127 334 172 182 203 168 152 198 135 240 194 144 196 147 -9 155 172 129 216 210 273 251 131 118 147 133 166 157 165 198 196 128 204 246 208 121 216 228 145 374 183 169 204 147 192 169 196 351 204 149 240 97 218 255 230 116 183 225 -9 193 242 255 188 145 183 109 277 183 176 131 200 157 155 113 208 191 150 -9 171 324 215 155 241 -9 187 169 256 132 229 274 223 108 240 151 180 297 245 175 274 151 260 208 276 179 245 185 263 116 259 104 258 200 257 96 292 319 245 238 290 158 190 185 229 266 170 262 239 178 177 282 256 188 211 152 159 141 102 287 178 193 242 180 297 237 299 214 125 117 224 165 314 155 253 166 174 150 204 208 264 202 220 282 209 174 230 -9 300 169 235 266 138 316 257 199 233 164 128 176 372 203 201 197 209 176 296 170 179 298 307 140 192 148 265 131 150 187 192 184 169 260 296 266 194 188 141 242 202 213 256 132 245 278 201 116 266 180 194 242 171 141 111 141 409 167 192 245 235 213 213 168 119 248 264 129 256 152 138 236 217 248 204 151 308 200 185 195 134 117 201 117 241 181 117 334 297 203 168 308 245 212 202 177 205 184 146 254 -9 227 251 205 
1334 615 She China EAST_ASIA 126 128 144 131 156 236 146 124 -9 98 130 120 148 221 258 233 173 173 222 194 187 149 249 136 218 184 206 136 119 205 189 184 148 167 96 166 130 145 170 180 -9 188 252 118 141 108 234 242 274 210 242 111 138 233 196 300 187 113 95 241 195 133 144 119 163 159 251 246 91 132 266 116 161 157 112 165 234 155 190 133 190 110 143 130 208 252 247 142 179 160 -9 156 196 241 141 190 252 200 122 152 254 205 202 162 178 263 185 127 346 172 192 207 168 164 198 143 244 206 144 192 155 237 159 172 141 236 210 277 255 155 126 155 157 170 161 173 202 204 128 208 254 228 141 228 232 149 374 187 189 204 163 192 189 196 355 212 161 256 119 214 259 238 116 183 241 -9 197 242 255 180 145 179 137 281 187 176 143 200 153 151 121 212 195 146 150 175 328 223 155 253 -9 203 165 244 144 245 274 211 128 244 151 180 297 257 175 278 155 268 224 280 199 253 189 267 112 263 108 262 212 261 104 300 319 241 234 298 162 194 197 237 286 168 270 243 182 181 282 260 204 219 160 163 157 106 287 202 193 250 184 309 241 311 214 133 125 244 -9 326 163 253 170 182 158 208 216 272 202 220 266 217 190 234 -9 308 173 251 270 134 320 293 203 233 168 132 188 376 207 193 197 229 184 300 182 191 306 303 144 192 164 293 131 158 191 200 192 177 272 296 286 202 204 153 246 190 217 272 151 245 282 201 120 274 204 202 254 167 157 115 165 409 167 204 257 235 213 221 180 131 260 268 121 264 172 150 240 233 272 204 167 308 204 185 203 138 119 203 125 245 191 129 354 301 203 180 312 265 216 206 181 209 184 146 258 -9 235 259 237 
1334 615 She China EAST_ASIA 126 116 140 119 156 232 146 120 -9 98 130 120 148 217 252 233 167 165 218 194 187 149 245 136 218 184 188 134 119 201 189 176 148 163 86 166 120 143 168 180 -9 185 246 115 141 105 231 233 274 210 239 111 126 230 196 291 187 110 86 238 192 121 138 116 157 147 251 234 91 123 263 113 158 151 109 162 234 155 187 130 178 107 134 127 208 249 241 142 179 160 -9 156 190 235 123 181 246 197 119 140 254 197 202 158 162 263 181 127 342 168 192 195 168 152 198 143 244 194 132 188 151 233 159 172 137 232 202 273 255 147 110 143 153 170 157 173 202 196 124 204 238 228 137 224 224 133 370 183 173 200 147 188 157 196 351 204 157 240 97 210 255 234 116 175 241 -9 177 234 255 180 129 175 117 277 187 164 135 196 153 155 121 212 195 142 150 175 316 217 155 245 -9 187 165 240 144 237 274 211 124 240 151 180 289 241 167 270 151 260 208 268 195 245 185 259 108 263 104 250 200 257 100 292 319 241 230 294 150 194 189 237 270 164 262 239 178 177 278 256 184 211 160 151 141 98 283 182 189 246 180 297 241 307 214 133 125 240 -9 318 155 245 162 174 154 204 212 260 198 220 266 209 182 226 -9 304 161 239 266 134 312 257 199 233 168 128 180 368 203 185 197 229 176 292 170 187 294 303 140 176 152 289 119 158 187 192 184 173 264 296 258 198 196 145 234 186 205 256 143 245 262 197 104 266 204 198 236 167 141 115 141 405 167 200 249 235 203 201 172 115 256 256 121 260 160 142 204 225 256 204 167 308 202 185 195 138 119 203 121 241 183 117 338 301 191 180 312 249 216 206 177 201 176 146 254 -9 231 255 225 
1335 615 She China EAST_ASIA 126 128 124 129 164 234 138 118 188 98 130 -9 158 -9 264 233 177 -9 218 194 193 143 247 142 218 184 200 134 139 209 189 180 158 169 102 172 128 171 172 180 -9 191 252 115 153 108 237 245 274 201 230 111 135 236 202 315 190 110 98 241 195 133 144 125 163 150 263 234 91 123 266 113 158 157 118 162 249 158 187 136 193 110 143 130 208 234 247 151 188 166 194 156 190 253 135 190 246 200 125 156 246 205 202 158 174 263 189 139 346 176 194 203 178 164 198 151 248 194 144 192 155 233 159 172 141 224 210 269 255 155 126 147 153 174 157 177 206 208 136 204 258 228 121 224 228 145 382 183 173 212 159 188 157 200 355 216 157 240 123 218 263 234 124 183 239 -9 193 246 259 188 149 183 117 273 191 180 143 200 149 147 117 222 195 146 146 171 320 217 159 245 198 195 181 252 152 237 274 211 116 248 167 180 289 253 175 274 155 264 228 260 187 245 181 271 108 267 104 270 216 269 104 300 331 249 246 286 162 194 197 237 298 172 278 239 186 189 290 260 208 219 160 159 157 110 283 202 197 254 180 -9 237 303 222 -9 129 240 169 322 163 257 174 182 154 208 216 260 198 228 -9 209 182 238 -9 304 161 243 270 154 332 257 203 257 164 136 176 376 207 189 197 229 168 304 186 187 298 303 144 176 164 265 127 158 163 -9 208 177 264 296 282 202 208 149 246 206 213 272 139 253 274 197 116 278 180 202 246 171 153 115 161 405 171 204 249 239 209 217 180 135 256 276 125 -9 160 138 236 233 264 224 167 312 202 217 203 138 117 201 123 253 187 117 366 301 203 180 320 249 216 210 181 213 184 146 262 -9 227 259 225 
1335 615 She China EAST_ASIA 126 124 124 129 142 230 138 112 188 98 130 -9 152 -9 246 231 173 -9 218 194 187 143 243 136 218 184 188 134 119 205 176 180 148 165 100 172 120 147 170 174 -9 188 246 115 141 105 234 236 268 195 221 96 117 236 196 288 187 104 95 241 192 133 141 122 163 150 239 234 91 120 260 110 155 157 115 162 234 149 187 127 178 104 143 130 205 228 244 148 178 163 194 150 181 247 132 187 246 200 125 148 246 197 194 158 170 263 181 127 338 172 192 195 174 152 190 143 244 194 144 188 155 225 155 172 137 220 196 269 255 147 118 139 153 170 145 173 194 208 124 204 254 228 121 224 228 141 374 183 169 204 151 188 157 192 347 204 157 240 115 198 255 230 120 183 225 -9 181 242 255 172 129 179 109 269 191 180 131 196 149 147 113 214 187 142 142 159 316 215 147 233 198 183 169 240 144 225 274 211 112 244 155 180 285 241 175 270 143 260 220 252 183 241 181 263 108 263 104 250 212 257 96 284 319 241 238 286 154 190 189 229 298 168 266 235 182 185 282 256 184 211 160 155 145 106 283 198 193 238 164 -9 237 303 214 -9 125 224 157 318 163 249 170 178 150 200 208 256 198 220 -9 209 174 234 -9 304 147 235 266 134 316 257 195 237 164 136 176 364 195 185 193 209 168 296 182 175 294 303 144 176 152 261 119 154 163 -9 208 173 256 288 274 198 188 149 242 198 209 264 139 245 262 197 116 274 180 194 228 171 145 111 141 405 167 204 245 223 209 217 172 131 252 264 121 -9 160 126 200 229 256 204 159 300 200 185 199 134 111 199 123 245 183 117 366 289 191 180 316 237 216 202 181 197 184 146 262 -9 227 219 209 
1336 615 She China EAST_ASIA 128 124 144 137 164 230 140 114 186 98 140 120 148 221 268 233 167 171 218 198 187 149 251 142 226 202 188 134 119 201 191 180 162 167 106 168 130 145 170 180 212 185 249 115 141 120 237 -9 268 210 221 111 117 236 205 297 190 113 95 241 195 127 144 119 166 153 263 -9 91 132 266 119 158 157 115 165 234 158 187 136 190 104 140 133 205 240 247 -9 179 166 203 156 190 253 126 193 252 200 125 152 246 197 202 -9 162 263 189 127 342 176 194 207 -9 164 206 155 244 202 144 192 155 237 151 180 149 228 210 285 251 147 122 159 156 166 157 173 206 204 128 216 246 228 149 216 -9 149 374 187 181 204 163 192 165 208 363 208 141 256 119 198 263 234 120 183 231 124 205 242 259 192 141 183 109 285 187 176 131 196 157 143 117 216 187 158 142 159 324 229 151 245 194 187 169 256 144 245 278 211 120 248 159 184 297 249 175 274 151 268 220 280 195 249 185 271 108 263 108 266 220 261 104 288 327 241 230 294 166 194 185 229 294 176 274 235 182 193 286 264 200 223 164 163 141 98 287 198 201 250 184 309 245 315 226 129 125 240 169 322 167 253 162 178 -9 212 216 264 198 232 -9 217 174 234 -9 304 173 259 266 158 320 289 203 241 168 136 176 368 211 193 193 229 176 296 186 187 302 307 144 196 148 265 131 158 187 196 228 177 268 296 298 202 200 149 258 206 213 280 143 253 282 209 112 274 204 202 252 179 157 119 145 421 -9 204 249 227 209 205 184 119 264 264 125 288 164 134 204 233 272 208 167 308 198 185 199 138 131 205 123 245 191 129 362 301 203 216 316 265 224 206 178 201 188 142 258 231 231 267 221 
1336 615 She China EAST_ASIA 124 116 124 129 162 230 138 114 182 98 130 114 146 217 246 233 147 163 214 194 187 143 245 136 218 184 188 134 119 201 189 176 154 163 102 166 120 145 164 180 212 182 246 115 141 108 234 -9 265 201 221 111 117 233 196 297 184 113 89 238 192 127 141 116 163 150 251 -9 91 126 260 113 155 151 109 162 228 155 187 133 187 98 137 130 205 228 244 -9 179 160 179 147 184 247 126 190 249 200 122 140 246 193 194 -9 162 255 181 123 334 168 192 203 -9 152 198 143 240 198 144 192 155 233 151 176 137 200 210 269 251 131 118 159 133 150 157 165 198 200 124 208 242 228 145 216 -9 133 370 183 177 200 159 188 157 208 359 204 137 240 97 198 255 230 112 183 225 120 191 234 255 188 129 183 109 281 187 176 131 196 153 147 117 208 183 146 142 159 316 225 151 241 194 183 165 240 144 237 274 207 108 240 159 176 297 241 167 270 143 260 220 268 187 241 181 267 112 263 104 262 216 257 104 288 319 237 230 294 150 190 185 225 282 164 270 235 182 177 278 260 188 207 156 159 137 90 287 178 193 250 180 301 237 303 214 125 125 240 153 322 163 249 162 174 -9 208 216 260 198 224 -9 209 174 226 -9 304 169 235 258 154 316 285 199 229 160 136 176 368 207 189 189 213 164 296 178 187 302 303 140 176 136 261 127 158 187 184 184 177 264 292 266 198 188 149 246 206 205 268 143 249 262 193 104 266 200 186 246 171 149 115 141 409 -9 200 245 227 207 201 168 115 260 256 117 256 156 126 200 217 252 204 151 304 196 185 195 138 121 201 121 237 191 117 350 293 191 168 316 245 216 206 178 197 184 138 246 227 227 263 205 
1347 617 Tu China EAST_ASIA 124 124 142 135 142 236 140 124 188 102 130 120 164 225 262 235 169 167 224 196 187 145 249 140 226 200 206 142 119 203 191 180 162 175 112 172 120 145 170 184 208 185 249 115 147 120 237 242 271 210 224 96 138 242 205 309 190 113 95 241 192 133 144 119 160 153 266 246 91 126 266 110 155 157 115 165 234 158 190 130 193 110 146 136 208 252 241 142 179 169 194 156 184 250 144 190 246 200 122 152 258 205 202 166 170 259 185 135 346 176 192 203 180 164 202 143 248 198 148 196 155 237 167 176 141 212 210 277 255 159 126 155 157 166 168 161 206 216 124 204 262 224 121 216 236 149 382 183 193 204 159 192 185 204 351 204 157 256 119 214 259 242 120 187 243 128 193 242 255 180 157 179 113 281 199 176 139 200 153 155 121 212 191 142 150 171 316 219 159 245 202 187 173 240 144 245 274 227 116 244 155 180 301 245 171 274 159 260 220 276 187 249 189 271 112 267 104 266 212 257 100 300 327 245 234 294 162 194 197 233 282 176 282 239 182 189 278 268 196 223 164 159 153 98 287 186 193 250 180 309 249 311 214 129 129 244 181 322 167 253 174 182 154 204 208 268 198 224 282 219 178 234 180 304 169 239 270 138 316 293 199 233 164 128 188 372 215 193 185 217 179 300 182 187 302 303 144 192 152 285 123 158 171 192 212 177 268 296 270 202 188 157 246 206 209 268 143 245 282 201 116 266 200 190 246 167 149 111 165 409 167 204 249 227 203 213 176 119 264 272 129 256 176 138 244 233 264 204 167 308 208 209 207 138 119 203 129 245 191 117 350 297 203 180 316 241 216 206 181 209 180 146 258 223 231 267 233 
1347 617 Tu China EAST_ASIA 124 116 124 129 142 230 138 112 180 92 130 120 158 217 258 235 169 165 218 194 187 143 245 128 218 184 186 134 119 201 189 180 162 159 102 166 120 143 168 174 208 185 249 115 141 108 234 242 271 201 221 96 117 230 199 291 184 110 95 241 192 130 132 113 157 153 251 234 88 123 260 110 152 154 112 162 234 140 187 127 190 104 134 133 202 237 230 142 179 169 179 150 184 247 138 172 246 194 122 140 246 201 194 162 166 259 181 131 334 164 190 203 174 160 186 143 244 198 140 188 147 233 163 172 137 208 206 273 251 151 122 155 149 166 157 161 202 212 120 204 242 208 121 216 224 149 378 183 181 204 147 192 157 200 347 204 153 244 97 198 255 230 116 183 231 120 193 238 255 180 153 175 109 277 191 176 131 196 153 159 109 208 191 142 146 159 316 215 155 233 194 183 169 240 132 225 266 207 116 240 151 172 297 241 167 258 151 260 216 276 187 241 181 259 108 259 104 262 200 257 96 288 319 237 234 282 162 214 197 225 270 170 278 239 178 185 274 260 184 219 164 159 153 98 287 186 189 246 176 305 245 307 214 129 129 224 153 322 163 249 162 170 154 192 208 260 190 220 278 209 174 226 176 304 161 239 266 138 316 289 199 229 160 128 176 372 207 189 185 209 164 292 182 175 298 303 140 176 152 273 119 158 163 188 184 173 248 292 262 202 188 153 234 202 205 256 139 245 262 201 104 254 196 182 232 163 141 111 153 409 159 196 249 227 203 209 168 115 252 272 121 256 172 126 244 233 248 204 159 308 200 185 195 138 117 197 123 245 183 117 338 285 203 180 312 241 216 202 177 209 176 146 258 223 227 267 221 
1348 617 Tu China EAST_ASIA -9 124 144 131 156 230 150 124 186 98 130 120 158 227 260 233 169 165 218 194 191 -9 257 136 226 198 192 138 139 207 187 184 158 165 94 172 130 173 170 174 212 188 252 115 144 105 234 242 271 213 236 96 117 236 205 300 190 113 95 256 192 133 138 116 163 159 263 246 91 132 266 107 155 157 115 165 234 152 196 133 199 113 143 133 208 252 232 151 182 169 200 156 193 256 141 187 252 200 119 156 246 201 198 158 166 259 189 127 334 176 190 207 168 160 202 147 244 198 144 196 155 241 151 176 141 228 220 269 251 147 122 155 149 178 165 173 198 212 124 208 238 228 121 228 240 149 382 183 177 208 163 192 185 208 355 204 149 240 115 214 255 238 116 199 249 140 193 242 259 192 149 183 133 281 187 180 131 208 161 139 117 208 199 142 146 175 320 225 155 241 194 199 181 260 152 245 278 227 120 244 167 184 297 261 175 274 151 268 228 276 195 249 185 263 108 267 108 286 212 257 100 296 323 249 238 298 166 190 189 237 282 174 270 243 190 189 282 264 196 211 164 155 157 102 291 198 197 254 180 317 249 311 222 129 125 248 153 330 155 245 174 178 154 208 208 260 202 224 282 213 202 230 176 300 169 255 266 146 320 273 207 233 172 128 180 376 203 193 185 209 184 304 198 179 298 303 152 196 164 293 131 162 167 196 212 177 264 300 290 202 188 149 242 198 209 268 143 253 282 201 112 270 204 190 242 167 161 115 165 417 163 204 253 239 203 213 172 135 268 268 121 288 168 146 248 237 256 224 159 308 204 185 207 138 113 201 123 245 191 129 350 301 203 180 316 249 216 206 181 217 172 150 258 235 235 271 241 
1348 617 Tu China EAST_ASIA -9 116 124 129 142 230 138 112 180 92 130 114 148 217 258 229 147 165 218 190 175 -9 247 128 224 184 190 136 119 207 183 180 158 163 94 166 126 145 170 174 212 182 249 115 141 105 234 239 265 210 236 96 117 236 196 297 181 110 95 241 192 133 132 113 157 150 260 234 91 126 260 107 152 157 109 165 234 140 190 130 193 101 131 133 202 252 227 139 179 160 194 150 190 250 132 187 246 200 119 152 246 197 194 158 162 259 185 127 330 172 190 195 168 160 198 143 228 198 140 184 151 237 151 172 129 208 210 261 251 131 122 151 149 146 157 169 198 196 124 208 238 228 121 212 232 145 370 183 169 204 159 192 117 204 351 204 145 240 97 210 255 230 112 187 241 136 181 238 255 188 149 183 117 269 183 180 131 196 157 147 109 208 183 142 142 175 320 205 147 233 190 183 169 244 132 241 274 207 112 236 155 184 297 257 175 270 143 264 224 272 191 249 181 251 108 263 104 242 200 257 96 292 323 237 238 278 158 190 185 233 278 164 270 239 182 185 274 260 188 207 160 155 157 98 283 186 185 246 176 313 237 303 214 117 125 224 153 314 155 241 166 170 154 200 208 260 202 220 278 209 198 222 168 300 169 239 266 138 316 257 203 229 160 128 176 372 195 193 185 209 176 292 170 175 294 303 140 188 144 269 119 154 163 192 184 173 264 296 278 194 188 141 238 194 209 268 135 249 282 193 104 254 204 186 232 163 141 111 141 405 155 200 245 227 203 209 168 131 252 264 121 256 164 138 200 225 248 208 151 304 202 185 199 118 111 201 121 233 183 121 346 297 203 180 300 245 212 206 177 201 172 150 254 231 227 259 221 
1349 617 Tu China EAST_ASIA 122 128 126 129 158 232 146 112 186 98 140 120 148 217 262 233 173 167 218 194 191 137 243 136 218 184 202 136 139 201 191 182 158 165 110 172 130 145 170 184 212 188 252 115 141 108 240 233 271 210 239 111 138 -9 196 309 190 116 89 250 -9 130 132 119 166 150 263 237 94 126 -9 110 155 157 112 165 249 155 -9 133 193 104 146 133 214 249 -9 148 185 169 200 156 190 250 141 190 252 200 119 152 254 201 198 162 -9 263 189 127 -9 176 192 203 172 172 202 143 244 198 144 192 155 241 163 176 145 216 200 269 255 151 130 159 157 174 169 173 198 208 128 208 250 228 145 228 240 149 382 183 193 200 167 196 189 204 363 -9 153 244 115 218 255 238 120 183 237 132 201 246 259 180 129 203 117 277 191 184 131 196 157 147 117 218 191 142 150 175 324 221 155 245 194 187 169 244 144 -9 270 231 116 240 159 192 297 265 175 274 155 264 224 276 187 253 193 -9 112 263 100 266 216 257 104 292 323 241 234 294 170 194 209 241 286 168 274 239 -9 193 290 260 188 -9 164 159 -9 110 291 210 197 250 184 309 241 307 226 129 129 248 157 322 163 249 174 182 154 212 216 268 198 220 266 209 190 234 180 300 161 255 266 146 324 293 207 237 172 128 176 376 203 185 197 213 184 300 -9 187 306 307 140 176 148 289 131 162 203 200 196 173 268 -9 286 210 200 149 238 194 209 260 142 249 278 201 116 270 204 198 246 167 165 115 161 421 171 204 253 -9 213 217 176 119 260 272 121 -9 160 142 248 237 260 216 159 312 200 185 199 138 119 203 127 245 191 121 354 301 203 204 324 209 216 206 181 217 180 146 270 227 235 263 221 
1349 617 Tu China EAST_ASIA 120 116 124 129 156 230 138 108 180 92 130 114 146 217 258 229 171 165 218 194 185 137 231 136 204 184 188 134 119 199 183 180 158 165 102 172 130 143 170 180 212 188 252 115 141 105 234 233 265 201 230 96 132 -9 196 303 184 113 89 241 -9 118 132 113 157 144 263 234 91 123 -9 107 155 157 112 162 234 140 -9 133 187 104 140 121 205 243 -9 139 182 157 197 150 184 235 132 187 246 194 119 144 242 201 198 158 -9 247 189 127 -9 172 188 195 168 168 190 135 244 194 140 188 147 241 159 172 141 200 196 265 251 147 122 151 149 170 153 157 198 196 124 204 250 228 141 224 236 141 370 183 177 200 159 188 149 196 347 -9 141 240 111 214 255 230 116 179 229 128 193 238 255 180 129 175 113 269 183 184 131 196 157 167 113 204 191 142 142 171 320 209 151 245 194 183 165 240 132 -9 266 207 112 240 151 188 293 245 167 270 139 264 220 272 183 245 189 -9 108 259 100 250 216 253 96 288 323 233 234 286 158 190 185 233 282 164 270 231 -9 173 278 256 188 -9 152 151 -9 98 291 202 193 250 176 301 237 307 210 125 125 244 153 322 155 249 162 178 154 204 212 260 190 216 266 209 186 230 168 292 161 239 266 134 316 289 207 233 160 128 172 364 199 173 185 209 164 296 -9 175 298 303 140 176 148 289 123 158 187 192 184 169 268 -9 278 206 188 141 230 190 205 252 139 245 278 201 116 254 180 190 236 163 161 111 145 405 167 204 245 -9 213 205 164 119 252 264 121 -9 160 134 240 233 252 216 151 304 196 185 199 138 107 201 123 245 183 121 350 297 191 180 312 209 216 202 181 197 176 142 258 223 231 259 221
1350 617 Tu China EAST_ASIA 126 130 128 -9 158 230 152 -9 186 98 132 120 148 223 264 233 175 163 218 194 187 147 243 140 224 184 200 142 119 207 187 182 162 163 94 168 128 145 172 174 212 191 255 121 141 108 231 242 277 210 239 111 138 -9 199 300 187 116 95 241 195 127 132 119 172 150 251 234 91 132 260 116 158 157 112 168 -9 155 190 133 190 110 146 136 214 252 244 142 179 163 194 159 196 247 141 190 246 200 125 160 246 201 198 166 178 263 -9 127 342 172 194 207 178 164 202 151 244 206 144 188 155 241 159 176 153 224 210 273 255 151 130 159 149 170 165 169 210 204 140 212 246 228 145 228 232 145 382 183 181 208 159 192 189 216 359 204 161 244 119 214 267 230 116 187 225 140 197 242 255 192 149 187 109 281 187 192 143 200 153 143 117 210 191 154 150 171 320 221 155 245 190 195 169 256 144 -9 278 227 124 244 159 184 297 269 175 270 151 268 220 280 187 249 189 263 112 263 104 274 212 265 104 296 323 245 238 298 154 198 193 233 294 164 274 239 -9 177 286 260 -9 219 -9 167 -9 106 291 194 193 246 180 -9 253 307 214 129 129 244 153 326 167 249 162 182 154 204 216 260 190 232 278 209 190 238 180 312 169 239 262 154 324 257 207 229 164 140 180 376 -9 201 193 209 184 308 182 191 302 303 148 192 172 289 123 154 -9 200 216 177 260 -9 298 198 204 153 246 206 205 260 151 -9 278 205 120 278 204 202 246 171 141 111 -9 417 167 208 253 -9 -9 213 180 135 260 268 121 268 164 138 240 233 264 220 -9 312 196 217 203 138 119 205 125 249 191 117 362 305 203 216 312 237 228 206 181 201 184 150 258 231 235 267 221 
1350 617 Tu China EAST_ASIA 120 128 124 -9 152 230 140 -9 182 98 130 120 148 217 260 233 173 163 218 194 175 143 243 140 204 184 188 136 119 201 183 176 154 161 86 166 126 143 170 174 212 188 249 115 141 105 225 236 274 201 230 108 126 -9 199 294 184 113 89 238 192 121 132 116 163 147 239 234 79 129 260 107 158 151 109 165 -9 155 190 130 187 104 140 133 208 246 238 133 179 163 194 156 190 247 129 181 246 200 113 152 246 197 198 158 170 263 -9 127 338 172 194 199 168 152 190 151 240 198 140 188 155 241 151 172 141 216 210 273 251 131 126 155 137 170 161 169 202 200 128 204 238 228 121 228 228 133 378 183 173 204 147 184 161 200 347 204 157 240 111 198 263 222 112 187 225 128 177 242 255 172 149 179 109 273 187 164 139 196 149 147 117 208 191 142 146 163 320 215 151 237 190 187 169 240 144 -9 274 211 116 240 155 180 297 229 171 258 147 260 208 276 183 249 185 259 112 263 104 250 196 253 96 288 323 241 230 290 150 190 181 233 282 164 270 239 -9 173 282 260 -9 215 -9 155 -9 98 291 182 193 242 180 -9 249 307 210 117 125 228 153 322 163 245 162 174 150 192 212 256 190 224 262 209 174 230 168 288 155 235 262 150 320 257 203 229 160 132 176 372 -9 185 193 209 172 292 182 183 302 303 140 176 160 261 119 150 -9 192 192 173 260 -9 258 190 188 141 242 198 201 256 139 -9 274 197 104 270 180 186 228 167 141 111 -9 413 167 192 253 -9 -9 209 172 131 248 268 121 256 164 138 224 221 256 216 -9 312 192 185 199 134 119 201 115 245 183 117 350 297 191 180 312 209 216 206 181 197 176 146 246 227 227 259 217
1351 617 Tu China EAST_ASIA 124 124 124 141 166 238 148 122 186 100 130 122 158 223 262 235 177 169 218 194 187 149 249 136 224 184 188 142 139 207 189 176 158 167 98 172 120 145 170 180 212 188 249 115 141 105 231 230 271 210 236 96 132 239 199 315 190 116 95 256 192 133 144 122 163 159 266 234 94 135 266 119 161 166 115 162 249 158 190 130 184 110 146 130 214 255 247 154 182 166 197 159 193 250 126 193 255 200 119 156 246 201 202 162 178 255 181 135 334 176 198 207 198 164 -9 147 244 198 148 196 155 241 155 176 141 216 212 269 259 151 126 159 157 174 161 173 198 212 144 204 262 228 149 228 232 149 382 187 177 204 159 196 189 208 371 204 157 256 119 222 263 234 120 187 237 128 205 242 259 180 149 183 117 281 191 180 135 200 157 151 117 212 191 142 138 171 320 219 155 249 194 203 173 260 144 237 274 231 116 240 163 180 297 241 187 258 155 -9 224 276 187 253 193 263 108 267 104 250 212 269 96 300 323 241 242 290 166 198 189 233 298 170 274 235 182 177 282 260 188 219 164 167 153 102 291 198 197 250 184 313 241 311 226 133 129 248 169 322 167 241 162 182 158 212 212 260 202 220 278 223 178 234 180 304 169 243 266 154 324 289 215 261 164 128 180 372 -9 189 197 213 172 296 178 195 306 303 140 192 164 269 119 154 187 204 212 177 264 300 294 202 204 153 242 202 209 272 142 245 282 201 116 278 200 206 246 171 141 115 165 421 167 208 253 231 203 225 180 135 272 268 129 -9 172 142 244 241 260 224 171 312 206 209 207 146 119 203 125 241 191 129 366 297 203 208 312 265 220 206 181 213 184 146 262 223 235 267 225 
1351 617 Tu China EAST_ASIA 120 124 122 129 158 230 138 112 180 98 130 114 158 217 258 233 173 163 218 188 187 143 233 132 218 184 188 134 139 201 185 172 158 163 92 172 120 143 170 180 208 188 249 115 141 105 225 224 271 201 221 96 117 233 196 288 190 116 95 238 192 121 132 119 157 144 239 234 91 123 260 107 158 157 112 162 228 152 190 127 178 98 140 127 205 240 244 142 182 160 179 150 181 235 123 172 246 200 119 152 246 201 202 158 170 255 181 131 322 172 192 199 174 164 -9 139 240 190 144 184 155 233 151 172 137 216 210 265 251 151 114 139 149 170 149 169 198 204 124 204 238 228 121 212 220 145 382 183 177 200 147 192 185 196 351 204 153 240 115 210 255 234 112 183 229 128 197 238 255 180 129 179 117 277 191 176 131 196 157 151 113 212 191 142 138 163 312 213 155 245 190 187 173 244 132 225 266 227 108 236 155 176 297 241 175 258 143 -9 224 272 187 253 181 255 108 263 100 250 208 265 96 296 323 233 230 290 154 194 189 233 294 168 266 235 182 173 278 256 184 207 148 155 149 98 287 178 193 250 180 309 237 307 214 125 125 248 157 314 159 237 162 178 154 208 204 260 190 216 266 213 174 222 168 304 157 239 266 146 316 257 203 233 160 128 176 364 -9 185 193 209 168 288 170 187 298 299 140 176 152 265 119 150 167 192 208 177 260 300 258 194 192 153 234 186 209 260 139 245 278 201 112 278 180 198 238 171 141 111 141 417 163 204 249 231 199 217 176 131 260 264 125 -9 160 130 196 225 256 208 167 304 200 185 207 134 111 197 125 237 183 117 362 289 191 180 308 241 212 194 181 205 180 142 258 223 231 259 221 
1352 617 Tu China EAST_ASIA 126 128 126 141 156 230 142 118 186 98 134 120 152 217 262 233 171 169 218 194 187 147 249 140 226 184 192 142 139 203 189 176 158 163 102 172 126 173 172 182 212 188 249 118 147 108 225 242 271 210 233 105 117 236 196 306 187 116 95 241 195 133 141 119 160 150 266 234 91 132 260 113 158 157 112 165 234 155 190 133 178 104 143 136 214 -9 232 148 178 166 197 156 193 235 132 190 249 200 119 156 246 197 202 162 166 -9 181 135 346 176 194 207 182 164 190 155 240 194 144 196 155 237 159 176 141 228 210 273 251 151 126 159 153 150 161 173 210 208 128 216 258 232 121 224 232 149 382 183 185 208 159 200 117 200 351 208 153 240 115 214 267 238 120 183 241 120 197 242 255 -9 149 183 129 273 187 180 139 200 153 147 117 212 191 158 146 171 324 223 163 249 190 195 177 256 152 241 278 231 116 240 155 184 301 245 195 274 155 260 224 276 195 253 193 271 108 271 116 262 216 257 96 300 323 241 246 298 162 -9 189 233 286 166 274 235 186 189 286 264 188 211 168 159 153 106 287 198 193 254 184 309 241 303 210 133 125 244 169 322 167 257 166 178 158 212 216 268 202 220 286 219 190 238 168 304 161 251 266 158 320 293 199 233 164 140 180 376 215 189 197 217 176 300 182 187 302 299 140 176 152 289 127 158 195 196 208 173 268 300 266 202 200 149 258 194 213 272 135 253 282 201 116 278 204 206 250 167 153 111 165 405 159 204 257 239 203 221 180 135 260 272 129 264 160 134 244 233 256 220 167 308 202 217 203 138 121 205 121 249 191 117 354 305 207 216 316 249 220 210 181 221 192 150 258 235 235 255 221 
1352 617 Tu China EAST_ASIA 124 116 124 133 156 230 138 114 180 96 130 118 148 217 260 233 147 165 216 194 187 145 243 136 226 184 186 134 119 203 176 172 158 163 102 172 120 143 170 180 212 182 249 115 141 108 225 239 271 201 221 96 117 236 196 288 178 104 95 238 195 124 132 113 157 150 263 234 91 120 260 113 155 151 109 162 234 140 190 130 178 98 143 133 208 -9 230 139 178 160 194 156 190 235 129 187 246 200 119 152 246 197 202 158 162 -9 181 131 330 168 188 199 162 160 186 147 240 194 144 188 155 237 151 172 125 220 196 273 251 143 118 151 149 150 145 161 198 208 120 216 250 228 121 212 228 145 378 183 169 204 151 188 117 192 347 204 145 240 111 210 259 230 116 183 203 120 189 238 255 -9 149 179 109 269 187 180 131 200 149 155 113 212 187 142 142 159 324 215 155 241 190 187 169 240 132 225 270 207 108 236 151 180 289 241 175 270 139 256 224 272 187 253 189 263 108 259 104 250 216 253 96 288 319 237 234 290 158 -9 157 233 274 164 274 235 186 185 282 256 184 207 160 159 141 98 283 182 189 246 180 305 237 299 210 129 125 240 153 314 167 253 162 178 154 204 204 260 198 216 278 209 190 234 168 292 161 235 266 138 316 257 195 229 160 132 176 368 211 185 193 209 164 300 178 179 294 299 128 176 148 289 123 150 191 196 204 173 260 296 254 198 188 149 242 186 205 252 135 249 274 193 104 258 196 198 242 167 141 111 149 401 159 200 245 231 203 221 176 131 260 264 117 256 152 126 228 233 256 208 167 304 196 209 199 118 113 201 121 245 181 117 342 293 203 180 304 245 216 206 181 209 192 138 254 231 227 251 209 
1353 617 Tu China EAST_ASIA 130 128 142 133 164 234 138 -9 188 100 136 118 148 217 264 233 -9 167 218 194 199 149 249 140 228 184 192 144 139 207 191 180 162 175 102 172 126 145 170 180 212 188 249 115 150 126 237 236 271 207 236 111 126 230 202 321 187 116 95 241 195 136 144 119 163 147 263 246 91 132 -9 107 149 157 115 168 234 158 190 139 193 110 140 133 214 240 244 148 184 166 -9 159 -9 235 135 196 252 200 119 152 250 205 210 166 170 267 185 131 346 176 190 207 202 164 202 151 252 194 144 188 151 237 159 176 141 224 218 273 255 147 122 155 153 178 149 169 202 212 124 208 238 -9 145 228 228 149 378 187 193 204 163 188 117 200 355 -9 161 260 119 218 267 230 116 167 229 128 207 242 259 188 149 203 109 273 187 176 143 208 153 147 121 210 187 154 146 179 324 237 155 249 190 199 169 264 148 -9 278 227 112 244 163 188 289 245 175 274 155 268 220 280 195 257 197 -9 104 -9 104 278 212 257 108 296 323 245 242 306 162 202 209 241 310 164 270 239 -9 189 278 272 188 -9 164 159 -9 110 287 202 193 250 180 309 237 315 214 133 129 240 157 322 163 265 170 178 154 208 216 264 206 220 286 215 174 234 180 304 165 239 266 154 324 293 203 257 168 136 180 376 211 193 189 233 172 300 190 187 298 307 148 192 164 269 131 158 203 196 212 169 264 300 290 198 188 157 242 198 213 272 139 -9 282 201 112 270 200 202 254 171 149 111 -9 421 167 204 245 243 209 221 180 135 272 272 133 260 164 150 224 237 272 208 -9 304 202 209 195 146 111 203 127 245 191 129 358 297 211 -9 308 253 220 210 181 213 188 146 266 235 231 271 237 
1353 617 Tu China EAST_ASIA 124 124 124 129 156 230 138 -9 186 98 130 114 148 217 260 231 -9 167 216 194 187 147 245 132 218 184 188 134 119 207 191 172 158 163 94 166 126 145 168 180 208 188 249 115 138 123 231 233 271 201 221 96 117 227 196 291 184 113 89 238 195 118 138 113 160 147 251 234 91 126 -9 107 146 151 109 165 234 152 187 136 187 98 134 130 202 240 241 139 179 160 -9 150 -9 235 129 190 246 200 119 152 246 201 198 158 166 267 185 127 338 172 186 203 168 156 202 135 248 194 144 184 151 233 155 172 137 212 204 265 251 143 118 147 148 170 149 165 202 204 124 204 238 -9 129 212 228 145 374 183 173 204 147 184 117 188 351 -9 161 240 97 214 263 230 112 167 225 128 197 242 255 184 145 183 109 269 187 172 139 204 149 155 117 208 187 150 138 163 320 215 155 249 190 183 169 240 148 -9 270 207 112 236 151 188 289 245 175 270 147 264 216 272 175 241 181 -9 108 -9 104 258 208 253 100 296 319 241 230 298 154 170 189 229 290 164 262 235 -9 185 278 260 184 -9 152 155 -9 98 287 178 193 242 180 309 237 311 210 133 129 224 157 314 159 257 166 170 154 204 204 260 198 216 274 213 170 234 168 296 143 239 262 138 316 257 203 237 164 132 172 376 203 185 185 229 168 292 182 179 294 303 136 176 152 261 127 154 163 192 204 169 260 292 262 194 188 149 242 194 209 260 135 -9 282 197 104 258 180 198 238 159 145 111 -9 417 167 196 241 227 203 209 176 119 268 272 117 256 148 138 204 229 256 204 -9 304 192 205 195 142 111 201 125 245 183 129 342 293 203 -9 304 209 216 198 177 209 176 146 258 231 231 259 221
1354 617 Tu China EAST_ASIA 124 126 140 131 164 234 138 124 186 106 136 120 148 217 260 233 -9 167 218 198 189 149 251 136 226 184 188 138 141 201 191 182 158 165 96 166 126 145 170 184 212 191 252 115 156 108 231 245 274 216 239 111 117 236 199 303 187 116 98 238 -9 133 138 119 163 159 251 234 91 126 260 113 161 157 118 165 246 155 199 -9 193 107 140 136 208 -9 244 142 179 160 -9 156 199 250 144 193 246 200 122 140 254 205 206 158 174 263 185 127 346 176 196 199 178 164 206 -9 248 194 144 192 155 237 159 176 141 224 206 273 255 155 126 151 152 166 157 181 202 208 144 204 242 228 141 216 224 153 382 187 177 204 155 192 169 212 367 212 137 244 119 230 255 238 120 187 243 128 215 238 259 188 161 187 109 281 187 176 131 200 157 143 117 212 191 154 150 175 324 221 155 245 194 195 173 256 144 -9 274 231 124 248 151 188 297 249 187 258 163 268 224 276 203 253 189 -9 108 267 104 250 220 265 100 296 327 245 238 302 162 194 193 241 290 174 274 235 -9 185 286 260 200 219 156 163 -9 102 291 198 189 254 180 305 241 311 218 133 125 252 169 334 163 249 170 178 162 212 216 260 198 224 286 223 178 226 184 304 157 235 262 150 320 269 203 233 164 132 176 376 207 189 197 221 172 296 190 183 302 311 140 196 168 293 119 154 183 196 208 173 264 300 298 206 208 149 246 202 209 -9 151 -9 278 197 116 266 184 210 242 175 169 115 141 409 167 200 245 239 213 201 172 135 268 268 121 264 164 142 248 233 260 216 159 304 196 217 207 134 121 -9 121 245 181 133 358 297 203 180 308 249 216 206 181 217 188 142 262 235 231 259 221 
1354 617 Tu China EAST_ASIA 120 116 124 129 160 230 138 120 180 92 130 118 148 217 258 233 -9 165 218 194 175 143 249 132 218 184 188 136 139 199 189 176 154 161 96 166 120 143 170 180 212 185 249 115 150 108 225 239 268 195 221 105 117 236 196 291 187 110 98 238 -9 133 132 113 163 150 251 234 79 123 260 110 158 151 112 162 234 152 187 -9 187 104 134 133 208 -9 241 139 179 142 -9 150 181 247 126 190 246 197 119 140 246 205 202 158 162 263 185 119 334 168 190 199 178 152 198 -9 244 194 140 192 155 237 151 176 141 220 200 273 251 151 122 151 133 158 157 169 202 208 124 204 242 228 141 212 224 145 374 187 173 204 147 184 165 200 351 204 137 240 97 210 255 238 120 187 225 128 177 238 255 172 161 179 109 277 183 168 131 196 157 151 113 208 183 142 134 175 320 209 151 245 190 183 169 240 132 -9 274 207 120 240 151 180 297 241 171 258 139 264 224 268 179 253 185 -9 108 263 100 250 216 265 96 288 323 245 234 294 154 170 189 237 266 172 270 235 -9 185 278 260 188 215 156 155 -9 98 287 182 189 246 160 301 237 307 214 129 121 240 169 322 155 237 166 178 150 204 208 260 190 216 282 213 174 226 176 300 143 235 262 138 316 257 199 229 160 128 176 372 203 185 185 213 168 292 182 183 294 299 136 180 164 261 119 150 179 196 184 173 264 300 266 198 208 141 234 198 205 -9 139 -9 274 193 104 258 180 198 242 143 141 111 141 405 167 200 245 227 203 201 172 131 260 268 121 264 148 138 244 233 256 212 151 304 196 185 199 134 117 -9 121 245 181 129 334 293 203 180 308 241 212 198 173 209 184 138 250 231 227 259 205
1355 617 Tu China EAST_ASIA 128 126 138 135 162 230 -9 124 188 102 130 120 148 217 258 243 173 167 218 196 187 149 243 138 228 184 204 144 119 201 189 180 154 169 102 166 130 169 170 186 212 188 249 118 144 108 237 242 274 216 239 111 138 239 196 309 190 -9 89 241 195 133 144 113 166 147 251 249 91 132 263 113 155 157 121 168 249 158 190 133 193 104 146 136 217 -9 244 151 179 166 194 156 184 253 141 187 249 200 119 152 250 205 206 162 174 267 189 127 342 172 196 207 172 164 202 147 244 194 144 196 155 241 163 176 141 224 210 273 255 155 126 151 157 170 165 181 210 208 140 208 254 228 141 228 228 149 374 183 193 212 159 204 157 196 351 212 149 260 111 222 263 238 116 187 245 136 189 242 259 184 149 191 109 285 195 184 131 200 157 139 113 216 191 150 150 171 320 215 155 249 194 187 177 260 148 249 278 215 116 244 163 188 289 261 175 270 151 264 208 280 191 245 185 271 108 267 104 270 220 265 104 300 323 245 246 302 162 194 189 249 306 170 274 235 178 189 278 264 196 223 164 159 141 110 295 202 193 242 184 313 245 299 230 133 125 248 161 326 163 249 170 178 154 212 220 260 198 232 286 209 174 234 184 300 169 239 266 154 320 289 203 233 168 140 176 380 -9 197 197 213 172 304 182 179 306 311 148 192 164 289 131 154 195 196 216 -9 260 300 270 202 188 149 242 198 209 264 135 245 282 201 116 270 200 202 246 171 161 119 149 409 171 204 257 239 203 213 180 135 268 276 121 264 172 146 244 233 260 216 167 304 200 229 207 138 125 205 123 245 191 121 374 297 207 180 -9 245 212 206 181 205 188 150 254 231 231 267 241 
1355 617 Tu China EAST_ASIA 120 124 124 129 144 230 -9 112 180 98 130 120 148 217 258 229 147 167 218 190 177 143 243 128 204 184 202 134 119 199 189 178 148 163 94 166 130 145 170 174 212 182 249 115 141 108 234 224 271 201 221 99 117 230 196 288 187 -9 89 241 192 121 138 113 160 144 239 234 88 132 260 107 155 151 118 165 234 155 190 130 178 98 143 136 202 -9 227 145 179 160 179 156 184 250 126 187 246 200 119 140 246 197 194 158 162 259 177 123 338 168 194 203 168 152 202 147 236 194 144 172 155 237 163 172 137 200 206 273 251 151 122 151 153 150 149 165 198 196 124 204 238 208 141 228 228 149 370 183 177 204 155 188 117 196 347 204 137 240 111 210 259 230 112 187 243 132 177 238 259 172 137 179 109 269 187 176 131 192 153 155 113 208 191 142 146 163 312 215 151 245 190 183 177 256 140 245 274 211 108 240 159 188 289 225 171 258 139 260 208 276 191 241 185 263 108 263 100 254 204 257 100 296 319 241 238 298 158 190 185 233 286 164 274 235 174 189 278 260 188 207 156 155 141 98 291 178 193 242 160 301 237 295 222 129 121 240 157 322 155 245 166 174 150 208 212 260 198 220 270 209 170 226 180 296 157 239 262 154 316 289 199 233 156 128 172 376 -9 173 197 209 168 296 174 175 298 303 140 176 164 269 123 150 183 192 184 -9 260 292 266 198 188 149 242 198 209 264 135 245 278 197 116 266 180 190 246 167 153 115 145 405 163 200 249 231 203 209 168 131 260 272 121 264 168 134 220 233 256 208 159 304 196 217 195 134 119 201 121 245 181 117 354 297 191 180 -9 209 204 202 181 197 180 142 254 231 227 263 205 
1356 617 Tu China EAST_ASIA 128 116 142 143 156 230 148 -9 182 98 136 128 156 229 262 233 -9 169 218 194 187 145 249 136 218 184 202 156 135 205 183 176 162 163 100 172 120 145 172 184 212 188 249 127 141 105 237 236 277 210 239 96 138 -9 202 297 193 113 95 250 195 136 141 119 163 156 263 246 94 129 263 113 -9 157 112 165 249 152 199 133 193 110 146 139 214 237 241 148 182 166 -9 162 190 247 141 196 249 200 119 152 246 201 198 162 170 263 193 123 338 176 196 203 180 156 198 147 244 198 148 196 155 237 159 176 137 220 206 273 255 155 126 155 153 166 153 173 198 212 128 212 242 236 121 228 228 153 382 183 169 204 163 188 185 204 351 212 157 244 115 226 263 230 120 187 225 132 197 238 255 172 149 183 121 277 187 176 131 196 157 151 113 216 191 158 142 179 324 223 159 241 194 203 181 256 140 -9 278 243 124 248 151 184 301 261 167 274 139 272 224 276 195 253 189 -9 104 263 108 270 212 269 104 296 323 245 234 302 166 194 193 233 290 174 274 239 -9 193 286 264 184 -9 160 163 -9 110 291 202 193 242 180 313 245 303 218 129 125 244 169 -9 155 261 166 182 154 216 220 264 198 224 266 213 202 230 180 308 169 239 262 142 316 257 203 233 168 136 184 372 207 189 -9 229 172 296 -9 191 302 303 148 200 164 289 127 158 179 200 212 173 -9 296 266 202 204 149 242 202 213 268 139 253 282 201 112 270 204 202 246 175 157 127 -9 417 167 200 257 235 199 229 172 131 260 272 121 -9 168 138 244 237 260 204 151 308 200 209 203 138 119 203 121 241 191 121 358 305 203 180 312 -9 216 202 181 209 188 142 262 231 231 259 213 
1356 617 Tu China EAST_ASIA 126 114 124 129 156 230 140 -9 180 98 130 120 148 217 258 233 -9 167 218 194 177 143 245 128 218 184 200 138 119 199 183 176 158 161 96 166 120 143 168 180 212 185 246 115 141 105 231 224 271 201 221 96 117 -9 196 288 184 113 86 241 192 127 132 113 160 153 251 237 91 126 263 110 -9 154 109 165 237 149 190 133 178 104 143 136 208 237 233 142 179 154 -9 156 184 247 129 193 246 197 119 140 246 201 198 158 162 259 185 119 330 172 190 199 180 152 198 147 244 194 140 196 155 237 151 172 133 208 206 273 251 147 126 151 133 150 153 169 198 208 128 204 242 236 121 228 228 149 378 183 169 204 147 188 153 200 351 204 157 244 111 214 255 222 116 183 225 120 177 238 255 172 149 183 109 269 187 176 131 196 157 163 109 212 175 154 138 171 316 223 155 237 194 187 177 244 132 -9 270 219 108 244 147 180 293 241 163 254 139 268 220 268 191 245 185 -9 108 263 100 266 200 257 100 288 319 241 230 290 162 194 185 229 266 168 270 239 -9 177 282 260 184 -9 152 159 -9 102 283 186 181 242 160 305 233 299 214 129 121 244 169 -9 155 257 162 178 154 208 216 260 198 220 266 209 190 230 172 292 169 239 262 138 316 257 203 229 164 128 180 368 203 177 -9 209 172 292 -9 175 298 299 140 192 152 289 119 146 163 192 184 169 -9 296 262 198 200 145 242 190 205 268 139 245 274 197 104 266 200 186 246 175 157 111 -9 417 167 200 253 223 199 209 172 131 252 272 121 -9 164 126 236 233 256 204 151 308 200 209 195 138 111 201 121 237 181 117 334 297 203 180 312 -9 212 202 181 201 188 142 254 223 231 251 205
1095 616 Tujia China EAST_ASIA 126 124 144 129 166 234 140 120 188 98 136 120 148 227 260 233 167 169 218 194 187 143 249 136 226 184 192 140 139 209 189 184 -9 163 100 172 124 173 172 180 212 185 249 118 141 108 237 245 271 210 236 99 129 236 199 312 190 116 95 250 195 133 144 113 163 150 266 234 91 123 -9 116 164 151 118 165 234 155 190 130 187 104 143 133 208 237 -9 142 179 169 179 150 190 250 141 193 252 200 119 156 246 -9 206 158 170 267 185 131 346 176 196 203 198 164 202 151 244 198 148 192 155 237 151 172 141 232 206 313 255 147 118 155 153 170 161 173 202 208 124 204 242 232 137 224 244 149 378 183 185 204 151 188 193 192 351 -9 157 240 115 210 267 238 120 187 239 140 193 242 259 192 -9 179 113 277 191 180 131 208 157 163 121 212 187 158 158 171 320 221 151 245 198 199 173 256 152 233 274 223 116 248 159 180 297 245 187 274 159 -9 -9 276 195 257 193 275 108 271 104 262 220 269 104 292 323 249 242 298 166 190 209 233 286 178 270 239 182 189 286 264 208 209 168 167 157 98 287 186 201 254 184 305 -9 -9 214 133 125 244 169 322 167 257 170 178 158 212 220 268 214 220 286 219 186 226 184 308 169 239 266 154 320 285 199 245 164 128 176 376 203 193 189 229 188 296 190 187 302 299 140 184 164 289 119 150 199 200 204 177 272 296 294 210 188 149 242 190 209 272 139 249 278 205 112 274 204 202 246 167 157 115 141 417 163 200 253 231 207 209 188 131 268 272 137 256 164 134 240 237 260 220 151 304 -9 209 203 146 113 199 121 245 191 129 354 297 203 204 324 265 216 206 181 209 184 150 258 227 231 259 221 
1095 616 Tujia China EAST_ASIA 126 124 142 129 164 230 138 112 188 98 130 118 146 217 260 233 165 167 214 194 187 143 245 132 204 184 188 138 119 207 174 180 -9 161 98 172 120 145 172 180 212 185 249 115 141 108 225 239 271 201 221 96 117 230 196 294 187 113 86 241 195 130 132 113 157 144 254 234 88 123 -9 110 155 151 115 165 234 152 187 127 178 104 143 130 205 228 -9 142 179 154 179 150 184 250 135 187 246 200 119 148 246 -9 202 158 162 263 185 131 342 168 194 195 170 160 198 147 232 194 144 184 151 237 151 172 141 224 206 269 251 147 118 151 153 170 157 161 198 208 124 204 242 228 121 224 220 149 378 183 173 200 151 188 153 188 347 -9 145 240 111 210 263 230 116 175 203 136 189 238 255 180 -9 175 109 269 187 176 131 196 145 143 121 208 187 142 154 159 316 215 147 237 190 183 169 244 136 229 274 207 112 236 151 180 293 241 175 258 151 -9 -9 272 195 245 185 263 108 263 100 258 204 257 100 292 323 241 230 290 158 174 197 233 286 164 270 239 182 185 274 260 184 203 156 159 137 98 287 182 193 246 180 297 -9 -9 210 129 121 240 169 322 163 257 166 178 154 208 212 268 190 220 282 209 186 226 168 300 161 235 262 130 320 285 195 229 156 140 172 376 203 173 189 209 172 296 182 175 294 299 140 176 156 269 119 150 191 192 196 173 268 288 262 198 188 149 238 190 205 260 135 245 278 197 104 274 180 190 238 167 153 111 141 405 163 200 241 227 203 201 172 115 256 264 133 256 160 130 200 233 260 204 151 304 -9 209 195 134 111 193 121 245 181 117 354 293 203 168 308 237 216 198 177 209 180 146 246 223 231 251 201 
1096 616 Tujia China EAST_ASIA 126 128 144 131 160 240 142 112 182 98 136 120 148 227 260 235 165 167 218 194 187 145 253 140 218 200 192 146 137 207 183 176 162 167 106 174 130 177 170 184 212 191 249 115 141 108 -9 239 271 207 221 111 117 230 202 306 190 116 95 256 195 136 141 119 163 -9 257 246 91 123 266 110 161 154 121 168 234 155 193 139 193 104 143 133 214 252 247 151 179 166 200 156 193 247 138 196 252 200 125 156 246 201 202 166 174 263 185 127 334 176 194 211 178 160 210 147 244 194 144 188 155 241 159 176 153 224 206 273 251 147 122 155 157 174 161 173 202 204 128 216 246 244 121 224 240 149 374 187 177 204 163 188 197 196 355 204 157 260 119 218 255 238 116 187 243 128 189 242 263 188 149 183 113 281 199 180 139 200 165 151 121 214 195 158 150 171 324 223 155 249 198 211 177 256 148 245 278 219 120 240 151 180 297 241 175 258 151 272 220 276 199 253 189 259 108 263 108 278 220 269 104 292 327 241 234 298 162 -9 189 241 286 174 282 235 182 189 278 260 196 211 164 171 149 98 291 178 193 250 184 305 241 311 226 129 129 248 165 326 167 245 166 174 162 212 220 272 206 228 286 223 198 234 176 300 176 239 266 150 320 269 199 257 164 128 176 376 211 189 189 229 180 312 190 191 302 307 140 192 168 293 123 154 203 196 208 177 268 296 -9 206 204 145 254 198 209 264 147 245 274 197 116 274 200 202 246 179 149 115 165 421 167 204 253 239 203 213 180 119 268 268 133 256 156 150 240 233 260 204 159 312 204 213 199 138 119 201 129 245 183 117 354 301 207 216 324 269 216 206 181 213 -9 146 258 231 235 267 237 
1096 616 Tujia China EAST_ASIA 124 116 124 129 144 230 140 112 180 98 130 114 146 217 258 233 165 165 216 194 187 143 251 136 204 184 186 138 119 201 183 174 158 163 96 166 130 143 164 180 212 188 249 115 141 108 -9 224 271 201 221 96 117 230 199 297 187 113 89 241 195 121 132 119 157 -9 239 234 91 123 260 110 155 151 112 165 234 140 187 130 190 104 140 133 205 252 235 139 179 157 194 150 193 235 126 193 246 197 119 140 246 201 190 158 162 259 185 127 334 168 190 195 174 152 206 143 240 194 140 184 151 233 151 172 129 212 202 273 251 131 118 151 148 170 153 161 198 200 128 204 242 240 121 216 224 149 370 183 169 204 163 188 153 188 351 204 149 256 119 214 255 230 116 183 229 120 177 238 255 188 149 175 109 281 191 180 131 196 161 139 109 212 187 142 150 171 324 219 151 245 198 183 169 256 144 245 278 207 116 236 151 180 293 241 171 258 151 268 216 268 195 245 181 251 104 263 104 250 200 265 100 292 323 233 230 294 158 -9 185 233 282 170 270 235 174 181 274 256 184 207 156 155 141 98 287 178 185 246 184 301 241 299 218 129 121 240 153 322 163 237 162 162 158 208 216 264 202 224 278 209 174 234 168 300 161 235 262 134 316 257 191 229 164 132 176 368 207 181 189 225 172 300 186 191 294 307 136 192 156 269 123 150 199 192 208 173 260 296 -9 202 196 141 242 190 205 256 139 245 262 197 104 254 180 190 242 167 149 111 141 421 167 200 249 231 203 209 172 115 252 264 125 256 148 134 200 233 252 204 159 304 202 209 199 138 111 201 119 241 181 117 350 289 191 180 304 209 216 198 177 201 -9 146 258 227 231 263 225 
1097 616 Tujia China EAST_ASIA 126 128 124 135 144 230 146 114 188 106 -9 120 158 217 264 235 177 171 224 194 187 149 247 142 226 184 188 138 119 205 191 186 158 163 108 166 122 173 172 184 212 191 252 121 -9 108 237 239 277 -9 239 111 132 239 199 297 187 113 98 244 195 133 132 116 166 150 263 234 94 126 260 113 161 166 115 168 234 152 190 133 -9 104 -9 142 202 249 244 145 179 166 194 156 196 241 141 187 246 197 122 140 254 209 202 158 174 263 197 131 346 176 196 195 182 160 198 143 248 194 144 196 155 237 163 -9 141 228 212 273 251 151 126 143 152 170 157 165 -9 204 124 208 246 236 141 228 232 153 374 183 177 204 163 188 185 212 351 208 157 244 123 222 263 238 116 183 243 128 209 246 263 188 -9 179 117 281 191 180 143 200 157 143 125 212 187 162 150 167 320 223 155 245 190 187 177 248 132 -9 274 231 116 -9 155 184 305 241 187 278 163 260 224 276 199 253 189 259 112 263 108 282 212 257 96 300 323 245 242 290 166 190 213 245 286 176 278 239 -9 181 294 260 184 219 164 151 149 98 291 210 193 250 184 313 237 307 226 125 -9 248 169 334 163 241 170 170 154 216 220 268 206 220 290 209 194 234 176 312 173 239 270 154 328 285 207 257 168 128 176 372 207 -9 189 209 184 300 194 199 298 303 144 192 164 -9 131 154 191 192 220 177 264 296 270 202 204 153 238 198 209 268 139 249 282 201 116 274 208 198 246 171 157 111 169 421 167 200 245 235 213 213 172 131 252 268 137 256 168 150 236 237 256 224 159 308 206 213 207 138 119 203 125 241 191 125 354 301 203 204 316 241 216 206 181 221 184 146 258 227 235 259 221 
1097 616 Tujia China EAST_ASIA 120 116 124 129 142 230 138 112 186 98 -9 114 152 217 258 235 167 163 218 194 187 143 243 140 216 184 188 134 119 201 191 184 156 161 100 166 120 147 170 174 212 188 249 115 -9 108 231 239 271 -9 236 108 117 236 196 294 187 113 89 241 195 118 132 113 163 147 251 234 88 120 260 107 152 154 109 162 234 140 187 118 -9 98 -9 142 202 249 244 133 179 163 179 150 184 241 135 172 246 197 119 140 246 205 194 158 166 255 189 119 326 168 190 191 168 152 190 135 240 194 144 188 155 237 159 -9 137 228 212 269 251 131 126 143 149 166 157 165 -9 204 120 204 242 232 141 228 224 153 370 183 173 204 147 188 157 196 347 204 145 240 119 218 255 230 116 183 237 120 205 238 255 188 -9 179 109 277 187 176 131 196 153 139 125 212 183 142 134 167 320 215 151 233 190 187 169 244 132 -9 274 211 112 -9 155 180 289 241 175 270 151 256 220 276 191 249 189 259 108 263 108 262 208 257 96 300 319 245 242 290 150 174 185 237 278 174 270 243 -9 181 274 256 184 207 152 143 141 98 283 198 193 242 180 301 229 303 210 125 -9 248 169 322 163 241 166 170 150 212 208 260 202 220 278 209 178 230 176 292 169 239 258 134 316 285 195 241 168 136 176 372 207 -9 189 209 164 300 182 183 294 299 140 176 136 -9 127 146 179 184 184 173 264 292 262 190 188 153 238 186 205 268 139 245 282 197 116 254 204 190 242 163 153 111 161 417 159 200 245 235 203 209 172 111 252 264 133 256 168 122 196 237 256 224 159 304 198 185 203 134 113 203 121 233 183 117 346 297 191 180 308 241 212 202 177 205 180 146 258 227 231 259 221
1098 616 Tujia China EAST_ASIA 126 124 144 129 160 230 138 120 188 106 130 120 148 -9 258 233 173 167 218 198 193 147 255 146 226 184 188 156 139 207 174 182 162 167 104 172 120 177 170 180 212 188 255 115 -9 129 237 233 274 201 236 117 117 239 208 294 184 113 98 241 195 136 132 119 163 153 266 237 88 132 263 116 158 166 118 162 252 155 187 133 190 113 -9 139 208 243 -9 148 179 166 200 156 199 250 135 187 255 200 125 156 246 201 202 158 170 263 189 123 342 176 194 203 178 164 202 147 244 194 156 196 151 237 155 180 141 228 206 309 251 151 126 155 133 170 165 169 202 212 128 204 242 228 141 228 232 149 382 183 181 212 159 192 189 200 351 212 141 244 119 214 267 238 112 -9 239 128 201 238 -9 192 -9 183 121 281 195 184 143 196 153 155 117 212 191 154 154 171 324 221 155 249 190 195 177 256 148 -9 278 207 128 -9 159 180 297 261 175 266 -9 -9 216 276 195 253 189 267 108 263 108 282 216 257 104 296 327 241 230 302 158 202 209 233 286 174 278 -9 -9 189 278 264 184 223 -9 155 153 106 291 178 193 250 184 313 -9 311 -9 129 125 248 173 322 155 261 170 182 154 208 220 264 198 224 286 227 174 226 176 304 169 239 262 138 320 289 203 261 156 -9 188 372 215 197 197 233 172 300 186 187 298 303 144 196 168 297 131 162 195 -9 192 177 268 300 270 202 200 153 242 -9 209 268 139 253 282 201 116 274 200 202 246 167 157 115 145 405 167 204 253 235 209 221 176 139 264 272 133 -9 168 126 200 233 268 -9 159 -9 202 225 207 142 123 205 129 241 -9 121 354 297 207 180 312 245 220 206 181 -9 192 150 258 239 235 259 225 
1098 616 Tujia China EAST_ASIA 124 116 124 129 156 230 138 112 188 98 130 114 148 -9 258 233 165 163 216 194 187 147 243 138 218 184 188 134 139 207 174 172 148 161 92 172 120 143 170 180 212 188 249 115 -9 108 222 233 268 198 221 96 117 236 199 294 184 113 98 241 192 133 132 116 157 150 251 234 85 132 260 110 155 157 112 162 252 152 187 127 178 104 -9 130 208 228 -9 139 179 160 179 150 196 247 126 187 246 197 119 140 246 193 202 158 170 263 189 123 338 172 190 203 174 152 186 143 244 194 140 196 147 221 151 176 129 208 202 273 243 147 118 139 133 150 157 169 202 208 124 204 242 228 141 212 232 149 374 183 177 200 147 188 153 192 347 212 137 240 111 210 263 234 112 -9 231 120 197 238 -9 180 -9 179 109 277 191 176 135 196 149 147 117 208 187 146 150 171 320 219 151 237 182 195 165 240 144 -9 266 207 120 -9 155 176 297 241 171 266 -9 -9 208 276 183 253 185 263 108 263 104 262 212 253 100 280 323 225 230 286 150 194 193 229 270 168 274 -9 -9 185 278 260 184 215 -9 155 141 100 287 178 189 242 180 301 -9 303 -9 121 125 240 153 318 155 253 162 174 150 204 208 260 198 220 282 209 174 226 168 300 143 235 262 134 316 285 195 229 156 -9 176 364 207 181 189 229 172 300 170 187 294 303 144 176 148 289 131 162 183 -9 192 177 260 300 270 198 188 141 238 -9 201 252 139 249 278 197 116 270 184 190 246 167 149 111 141 405 163 204 249 227 203 201 172 131 264 260 125 -9 160 126 200 221 252 -9 159 -9 198 221 199 126 117 203 127 241 -9 121 338 293 203 180 308 241 212 198 173 -9 180 146 258 227 235 259 205
1099 616 Tujia China EAST_ASIA 122 -9 142 133 158 234 140 124 186 98 130 120 156 -9 258 229 173 165 218 -9 187 147 249 128 218 200 200 142 119 207 183 184 164 175 104 166 120 145 170 184 212 188 258 115 -9 120 231 239 271 201 230 111 129 239 196 297 181 113 95 253 195 133 144 113 166 153 251 237 91 126 260 113 152 166 -9 165 240 -9 193 133 187 107 143 133 208 246 244 154 182 166 197 159 -9 253 138 187 246 200 -9 156 246 197 202 166 166 263 201 127 346 176 196 211 178 152 198 143 244 198 148 192 159 237 151 172 145 240 202 301 255 155 126 159 161 178 161 169 206 208 124 -9 250 232 141 228 228 153 390 187 177 204 151 188 189 208 351 208 165 240 115 214 267 230 120 -9 237 132 193 238 -9 188 -9 195 113 277 191 180 143 200 149 143 117 212 195 142 158 -9 320 219 155 245 190 203 169 256 152 -9 274 211 116 -9 155 188 297 241 175 -9 151 260 216 276 195 249 193 267 108 263 108 278 220 269 -9 288 323 241 238 298 162 206 193 233 302 174 274 -9 -9 -9 282 260 204 219 164 163 -9 98 287 202 193 250 164 309 -9 315 222 133 125 244 169 326 159 257 170 182 158 208 216 264 198 224 282 209 194 238 180 312 169 239 270 150 316 289 199 -9 168 -9 176 376 203 201 201 237 188 296 194 191 302 307 144 -9 148 -9 123 158 199 192 208 177 264 300 270 202 204 153 242 -9 209 252 143 245 282 205 116 262 200 198 242 175 157 111 165 405 167 200 245 239 213 221 180 131 264 268 121 -9 164 138 244 237 -9 216 171 -9 -9 209 207 138 123 203 127 241 181 117 370 297 203 216 316 265 220 206 181 209 184 146 266 231 231 263 237 
1099 616 Tujia China EAST_ASIA 120 -9 140 133 156 234 138 112 182 98 130 120 148 -9 258 229 165 163 218 -9 185 143 245 128 218 184 188 138 119 207 174 180 158 167 94 166 120 145 170 180 212 188 246 115 -9 105 231 224 268 195 221 105 117 239 196 297 181 113 86 241 192 121 132 113 157 147 239 234 85 126 260 107 152 166 -9 165 234 -9 190 130 178 98 143 127 208 246 238 139 179 166 194 150 -9 247 126 187 246 197 -9 152 246 197 198 158 162 263 185 123 334 176 194 203 168 152 190 143 240 194 144 192 151 233 151 172 125 216 202 273 251 131 126 155 153 170 153 165 202 204 124 -9 242 228 121 224 228 149 366 183 177 200 147 188 181 204 351 204 157 240 115 214 259 230 116 -9 225 128 177 238 -9 172 -9 179 113 273 187 172 139 196 149 139 109 208 191 142 142 -9 316 193 155 237 190 203 169 252 132 -9 270 207 100 -9 151 180 297 241 167 -9 147 260 208 272 191 245 181 263 104 263 104 274 200 253 -9 280 323 237 230 298 158 190 185 225 298 170 270 -9 -9 -9 282 260 200 211 156 155 -9 98 283 198 189 246 160 309 -9 311 218 129 121 244 169 306 155 249 162 178 154 200 212 260 198 220 266 209 170 234 176 292 165 239 266 146 316 257 195 -9 168 -9 172 364 203 185 193 233 172 296 174 187 298 299 140 -9 148 -9 119 150 187 192 184 169 260 288 262 198 192 141 242 -9 205 252 139 245 274 201 116 258 180 186 242 167 149 111 165 405 163 192 245 235 205 213 172 131 252 260 121 -9 152 138 244 233 -9 204 159 -9 -9 209 199 134 119 201 125 229 181 117 366 285 191 180 312 245 212 206 181 197 176 146 254 223 231 255 217
1100 616 Tujia China EAST_ASIA 126 128 144 129 144 234 144 120 186 98 136 120 152 223 264 233 169 173 218 -9 193 143 245 140 218 184 192 142 119 207 191 188 158 163 100 166 124 145 170 186 212 188 252 115 -9 129 231 239 271 213 236 96 126 239 199 309 193 116 89 -9 195 136 144 119 160 150 251 246 91 126 260 119 161 157 109 165 234 158 190 136 193 113 134 136 217 246 247 148 179 169 200 156 184 250 129 187 246 200 122 152 246 205 206 162 174 259 193 131 342 176 196 203 168 160 202 151 240 198 144 196 159 237 163 176 141 216 210 277 251 151 118 151 153 170 165 169 202 208 136 208 250 221 141 224 228 149 374 187 197 208 -9 188 185 200 359 208 165 264 111 214 263 230 120 -9 243 140 193 242 255 192 129 179 113 281 195 188 135 196 157 155 117 212 191 162 138 171 324 227 159 241 190 183 173 252 132 225 278 227 124 -9 155 192 297 249 187 274 155 260 224 276 195 253 185 267 112 263 104 282 208 257 108 292 323 245 238 302 -9 202 197 233 298 172 274 239 190 193 290 260 196 215 164 159 153 98 287 206 193 254 184 305 245 307 222 137 125 244 173 326 155 253 170 178 154 208 224 272 202 224 278 213 198 230 180 308 165 239 262 138 324 289 207 241 164 128 176 372 207 185 197 217 168 300 182 191 298 303 140 192 164 289 131 150 183 196 212 173 260 296 294 202 200 153 242 206 205 264 -9 249 282 197 112 254 204 202 252 167 153 115 165 405 163 208 257 235 211 213 180 131 264 268 129 268 164 150 240 233 260 216 167 308 202 205 203 138 119 201 129 245 195 129 366 301 203 204 324 249 216 206 181 213 184 146 270 235 235 271 245 
1100 616 Tujia China EAST_ASIA 120 116 124 129 144 230 138 112 182 98 132 118 148 217 258 229 159 165 218 -9 177 143 243 136 218 184 188 138 119 205 174 186 154 161 94 166 120 145 170 180 212 188 252 115 -9 108 225 224 271 198 221 96 117 230 196 291 181 113 86 -9 192 121 138 119 157 150 239 237 91 123 257 113 155 157 109 162 234 149 187 130 187 104 134 130 205 246 227 145 179 157 197 150 184 235 129 181 246 197 119 148 246 205 198 158 162 255 185 127 326 176 190 199 168 160 202 143 236 194 140 196 155 233 151 172 137 208 210 273 251 147 118 151 133 166 161 165 202 200 124 204 238 208 121 224 228 149 370 187 189 204 -9 176 153 196 347 204 145 260 97 210 255 230 116 -9 225 136 177 238 255 188 129 175 109 265 183 176 131 192 157 151 113 210 191 154 130 163 320 215 155 241 190 179 169 240 132 225 278 211 120 -9 151 180 297 241 171 258 155 260 220 272 191 241 185 259 108 259 104 250 200 253 96 288 319 237 238 294 -9 194 193 229 282 164 270 247 182 173 278 248 188 211 160 159 141 98 287 182 189 242 180 301 237 303 214 133 121 240 165 322 155 249 162 178 154 208 216 264 202 216 270 209 174 226 168 292 161 235 262 134 316 285 199 233 156 132 172 368 203 181 185 209 164 300 174 187 294 299 140 176 164 261 123 146 163 192 192 169 260 296 266 194 188 141 238 190 197 260 -9 249 282 193 104 254 180 202 242 163 141 115 141 405 159 196 249 227 207 209 172 119 264 256 125 256 148 134 196 229 256 204 155 304 200 185 199 118 107 197 125 233 191 117 350 297 203 168 308 233 216 198 177 201 184 142 262 223 235 267 205 
1101 616 Tujia China EAST_ASIA 124 124 142 -9 156 230 140 120 186 98 136 120 158 217 264 233 169 165 218 194 193 149 255 136 224 188 192 134 137 207 -9 180 -9 163 102 172 126 143 172 174 -9 185 258 115 144 105 234 245 271 -9 221 105 117 239 196 309 190 116 98 250 192 133 144 116 163 147 251 246 91 132 260 110 158 157 118 165 -9 158 190 130 187 107 143 133 214 246 244 139 -9 166 197 156 190 247 132 196 246 200 119 140 246 209 206 162 170 259 -9 135 342 180 194 207 -9 160 202 147 252 198 148 196 155 237 159 176 145 252 210 273 263 151 126 159 153 174 165 173 202 212 128 208 258 232 141 228 236 145 -9 183 189 208 159 196 153 216 371 220 157 240 123 218 259 234 116 183 237 132 197 242 259 188 -9 179 125 277 191 184 131 200 161 147 117 208 199 142 154 159 320 221 155 237 194 195 173 256 152 245 278 231 120 -9 163 188 293 241 187 274 155 268 213 276 191 245 185 263 104 263 112 266 216 269 108 300 327 249 246 294 162 206 189 233 294 170 274 243 182 185 282 260 200 219 156 159 153 98 287 202 189 250 180 305 237 307 214 129 125 248 169 322 163 261 170 174 158 212 224 272 202 224 278 221 190 234 184 304 173 263 266 142 320 289 207 233 168 128 180 376 203 201 189 225 176 300 198 175 302 307 140 184 168 261 131 158 195 192 204 181 272 296 266 194 200 153 246 198 209 284 143 253 286 205 116 274 180 206 250 175 157 115 165 409 167 208 253 231 207 209 180 139 260 268 125 256 164 142 244 233 260 208 159 308 196 221 203 154 123 205 125 245 187 129 362 301 191 216 324 209 216 206 177 213 184 146 250 231 239 271 225 
1101 616 Tujia China EAST_ASIA 120 116 142 -9 142 230 140 112 186 98 130 120 148 217 260 233 161 163 214 194 187 147 243 128 220 184 190 134 119 205 -9 172 -9 163 94 166 124 143 166 174 -9 179 249 115 141 105 234 236 271 -9 221 96 117 236 196 294 187 113 95 238 192 133 138 113 163 147 251 234 91 123 257 107 158 157 109 162 -9 152 187 130 187 104 134 133 205 237 230 139 -9 157 179 156 184 235 132 190 246 200 119 140 246 201 202 158 170 259 -9 123 330 176 192 203 -9 156 190 147 244 194 144 192 151 221 155 172 137 208 206 273 255 147 118 151 133 170 161 161 202 204 124 204 242 232 129 228 228 145 -9 183 173 204 147 192 149 212 347 208 141 240 97 214 255 230 116 183 229 120 177 238 255 188 -9 175 109 277 187 180 131 200 153 147 113 208 195 142 150 159 320 215 155 237 190 195 169 256 132 245 270 231 120 -9 159 184 293 241 175 270 151 260 208 276 179 245 181 259 104 263 104 262 212 257 104 292 323 241 230 290 154 194 185 229 270 170 270 243 182 177 274 256 188 219 152 155 141 98 287 198 185 242 160 305 237 303 214 129 121 244 157 322 159 245 170 170 158 208 208 260 198 220 278 209 182 230 168 300 143 239 262 134 320 285 203 217 164 136 176 372 203 197 189 209 168 300 174 175 294 299 140 184 152 261 119 154 187 192 184 173 264 292 262 194 188 149 238 194 201 276 139 245 282 193 116 266 180 190 242 163 157 111 141 405 163 204 249 227 207 209 172 135 256 268 121 256 156 138 204 233 252 204 159 304 196 209 199 134 111 205 121 241 181 121 338 297 191 204 308 209 216 202 177 209 180 146 246 231 231 263 221 
1102 616 Tujia China EAST_ASIA 128 116 124 133 162 230 140 112 186 100 136 122 158 -9 262 233 167 171 218 194 187 149 251 140 218 200 192 142 119 215 191 182 158 165 102 172 130 177 168 180 212 191 249 115 150 126 237 245 271 213 236 96 138 239 196 300 187 113 95 250 195 121 144 119 163 156 263 246 88 126 -9 107 158 157 112 165 240 152 190 130 193 104 140 139 205 246 244 148 182 166 179 156 184 250 141 196 249 200 125 152 246 201 202 166 178 255 189 127 342 176 196 203 184 156 206 151 244 194 144 196 155 241 155 176 149 240 216 273 251 151 126 159 153 170 157 173 202 208 136 204 250 236 141 228 232 145 386 187 177 208 163 188 189 200 371 208 161 244 115 218 267 238 120 -9 245 140 189 242 259 188 -9 179 109 277 191 180 147 200 161 159 117 208 191 142 154 171 324 235 155 245 194 195 169 260 152 225 282 215 120 -9 159 192 297 241 171 274 -9 272 224 268 195 253 189 259 108 263 108 274 212 261 108 292 323 241 234 298 162 194 193 233 294 164 266 -9 178 189 278 260 212 215 160 155 149 110 291 202 193 258 184 301 -9 -9 214 141 129 248 157 326 163 249 170 182 158 204 220 264 202 228 286 223 174 230 180 296 173 239 262 146 320 293 203 -9 168 128 184 372 203 193 197 209 172 300 182 179 294 307 148 192 164 289 123 162 195 -9 208 177 268 296 294 206 204 153 246 -9 213 272 155 249 262 205 116 274 184 202 246 175 -9 115 141 417 159 200 249 239 215 209 176 131 276 272 129 -9 160 154 252 233 -9 224 167 308 198 209 199 118 117 205 129 249 -9 125 362 305 203 204 320 245 216 206 181 209 188 146 258 251 231 267 241 
1102 616 Tujia China EAST_ASIA 126 112 124 129 156 230 138 112 186 98 134 122 148 -9 258 233 161 167 216 194 187 147 245 128 204 184 188 134 119 203 176 182 154 161 94 166 130 173 166 180 212 185 246 115 141 105 225 242 271 201 221 96 117 236 196 291 178 113 89 238 192 118 132 119 157 147 257 234 82 123 -9 107 158 151 109 165 234 152 187 127 190 104 140 133 202 228 235 133 179 166 179 153 184 247 132 172 246 200 116 148 246 197 198 158 174 255 189 127 342 172 190 199 168 152 202 143 240 194 144 184 155 237 155 172 137 240 202 273 251 147 114 151 149 166 153 173 198 200 124 204 238 224 133 212 232 133 382 183 169 200 147 188 157 188 351 204 157 240 97 214 255 234 112 -9 225 128 181 238 255 180 -9 179 109 277 187 176 131 196 149 151 113 200 183 142 146 171 320 199 155 237 194 195 165 236 136 225 278 211 108 -9 155 184 297 241 167 258 -9 264 224 252 191 249 185 259 108 263 104 274 208 257 100 292 323 233 230 294 154 194 193 233 282 164 262 -9 178 177 274 260 188 211 156 155 141 98 287 178 189 254 180 301 -9 -9 210 129 125 248 153 322 159 249 170 178 154 204 212 264 198 224 266 213 170 230 176 292 169 235 262 146 316 257 203 -9 164 128 176 368 203 185 189 209 164 296 178 175 282 295 140 188 152 273 119 154 167 -9 184 169 264 292 266 194 200 149 242 -9 205 268 142 245 262 201 116 262 180 198 228 175 -9 111 141 409 159 200 245 235 199 209 164 131 256 272 125 -9 156 142 244 229 -9 204 159 304 192 209 199 118 111 203 129 245 -9 117 350 301 203 180 316 209 212 206 181 205 180 146 250 235 231 267 237 
1103 616 Tujia China EAST_ASIA 128 116 144 135 164 234 146 124 186 98 136 120 160 217 264 235 173 167 214 -9 191 145 245 136 226 184 188 138 139 207 -9 180 162 169 104 166 124 143 170 184 212 188 249 118 141 108 234 239 271 201 236 99 138 239 199 312 187 116 101 241 195 136 144 119 163 147 263 234 91 129 266 110 161 166 112 171 234 155 190 133 187 101 140 133 214 249 232 151 179 169 197 150 190 250 141 196 246 200 125 152 246 205 202 162 174 263 189 123 338 180 196 203 180 156 198 143 248 202 144 184 155 237 151 176 141 232 210 273 255 147 118 163 153 170 153 169 198 212 140 204 242 232 141 216 236 153 382 191 193 208 151 192 185 196 359 212 145 264 115 222 263 234 120 -9 231 124 197 242 251 188 -9 179 121 277 203 184 131 200 161 159 121 212 191 142 154 175 316 209 155 245 190 199 169 240 156 225 274 227 120 236 155 184 297 261 179 -9 -9 268 220 272 191 245 193 255 108 267 108 278 224 261 108 288 327 241 246 298 170 198 185 233 298 168 278 239 182 189 282 276 212 219 156 163 149 98 291 202 197 246 184 309 -9 311 214 133 133 224 173 326 163 257 174 178 158 208 212 268 198 224 278 223 170 226 180 300 173 -9 266 150 324 285 203 -9 160 128 184 368 211 201 197 233 192 300 186 187 302 307 140 -9 152 269 131 158 199 192 212 177 264 296 278 202 200 157 254 -9 209 252 135 245 282 213 120 266 208 194 274 175 -9 115 161 413 159 200 253 235 211 221 176 131 260 272 121 264 -9 138 204 233 -9 204 159 304 198 189 207 142 119 205 125 245 -9 117 366 297 191 216 320 245 216 206 181 213 176 146 262 235 239 279 245 
1103 616 Tujia China EAST_ASIA 126 112 140 127 156 230 144 112 180 98 130 120 158 217 258 233 165 165 214 -9 187 143 243 132 226 184 186 134 119 201 -9 172 148 163 94 166 120 143 170 180 212 188 249 115 141 108 234 233 268 201 221 96 129 236 196 297 187 113 95 238 195 127 138 113 160 144 251 234 88 120 266 110 161 166 109 165 234 152 190 130 181 98 140 130 205 246 227 139 179 163 179 150 184 250 129 172 246 200 119 152 246 197 202 158 162 255 185 119 330 176 194 191 178 152 198 143 244 190 144 184 151 237 151 172 129 200 204 273 255 143 110 155 153 166 153 165 198 204 124 204 242 228 121 212 232 149 374 187 185 204 151 188 153 184 355 204 129 244 115 214 263 230 120 -9 225 120 197 242 251 172 -9 175 109 269 183 176 131 196 157 143 109 212 191 142 142 159 312 207 155 245 190 187 169 240 152 225 274 211 108 236 151 180 297 241 175 -9 -9 260 216 272 175 245 185 247 112 267 108 266 200 257 96 288 319 241 242 294 158 170 177 229 278 164 270 239 182 189 278 264 184 207 156 155 145 98 291 198 197 246 176 301 -9 303 210 133 129 224 153 322 159 245 162 174 158 204 208 264 198 224 266 223 170 226 168 292 161 -9 266 146 320 257 195 -9 156 128 180 368 195 189 193 209 172 296 182 187 302 307 140 -9 152 261 127 154 191 192 208 173 260 292 266 194 200 157 234 -9 209 252 135 245 262 197 100 254 204 190 246 163 -9 111 141 405 159 196 245 231 209 213 164 131 252 260 117 264 -9 134 196 229 -9 204 159 304 198 185 195 138 119 201 121 233 -9 117 346 293 191 180 308 209 212 202 177 205 176 142 258 231 231 267 241 
1104 616 Tujia China EAST_ASIA 126 124 144 135 144 238 140 120 186 98 132 120 152 225 260 233 -9 165 218 202 187 147 247 140 226 184 188 138 139 207 189 180 162 163 102 172 130 173 170 184 212 188 255 115 141 -9 240 245 271 210 236 111 135 230 199 288 190 116 95 241 195 133 144 116 166 147 263 246 91 126 266 110 164 157 115 165 234 158 202 130 -9 110 140 130 205 252 247 151 182 169 200 156 184 250 138 193 246 200 119 156 246 205 202 162 178 259 205 135 342 176 192 211 178 168 206 155 244 206 148 196 159 237 159 176 149 224 214 273 255 139 130 159 149 174 161 173 210 208 124 208 250 236 141 228 228 153 386 187 193 204 -9 204 193 200 367 212 157 244 97 218 267 234 116 187 239 128 197 242 -9 192 149 183 121 277 187 180 143 208 157 147 113 212 191 142 146 171 324 229 155 245 198 207 177 240 152 245 274 227 116 244 167 188 293 265 187 274 151 272 220 284 195 253 185 271 112 267 108 250 220 257 104 296 323 245 246 298 154 202 213 229 294 174 274 235 182 189 282 264 188 219 160 159 157 106 291 198 193 250 184 301 237 307 218 133 129 248 169 322 163 257 170 170 158 212 208 276 206 220 282 209 178 226 -9 304 161 239 270 166 320 293 199 241 164 136 188 372 203 197 197 229 184 300 202 175 302 303 144 188 148 -9 131 162 199 192 216 173 264 292 286 198 192 149 242 206 209 272 143 253 262 201 120 270 204 202 250 167 157 111 161 405 163 208 253 235 207 213 168 131 260 268 129 256 156 134 204 233 260 204 171 304 202 185 203 150 119 207 123 245 181 117 362 301 203 180 312 269 216 206 181 213 188 146 258 231 235 263 221 
1104 616 Tujia China EAST_ASIA 124 116 124 129 142 218 138 112 186 98 130 114 148 225 258 229 -9 165 214 194 185 143 245 140 218 184 184 134 119 199 174 172 152 163 94 166 120 143 166 184 208 188 249 115 141 -9 231 239 271 210 221 102 117 227 196 288 184 113 86 238 192 118 132 113 163 147 251 234 85 123 257 110 158 154 109 162 234 140 187 127 -9 104 134 127 202 252 244 151 179 160 197 150 184 247 129 187 246 194 119 152 246 197 198 158 166 259 189 131 334 176 190 203 168 160 202 147 244 202 144 184 151 225 151 172 137 208 200 273 255 131 126 159 133 170 157 165 198 204 124 204 238 228 141 216 224 145 374 183 169 204 -9 196 173 188 359 204 141 240 97 214 259 230 116 175 231 120 177 230 -9 188 129 179 113 277 187 164 131 196 157 143 109 206 187 142 138 171 320 215 155 245 198 187 165 240 144 237 274 207 116 240 151 180 293 261 175 270 151 260 216 260 175 253 185 259 108 259 104 250 200 257 104 296 319 237 238 294 150 194 193 225 282 164 270 235 178 185 274 260 184 219 148 155 141 98 287 178 189 246 180 301 237 303 214 125 121 248 153 322 155 245 170 170 154 204 208 272 190 220 282 209 170 226 -9 292 143 235 266 138 316 257 199 237 164 136 176 372 203 193 193 209 176 296 174 175 294 299 140 196 148 -9 127 150 159 192 212 173 264 292 266 194 188 141 238 190 205 268 142 249 262 193 116 270 180 202 246 167 153 111 149 405 159 204 245 231 199 209 164 115 256 264 129 256 156 126 196 233 260 204 159 304 200 185 199 138 111 197 121 245 181 117 350 301 191 180 312 241 212 202 181 205 180 146 258 219 231 259 201 
1297 629 Uygur China CENTRAL_SOUTH_ASIA 126 128 124 129 160 230 146 116 188 98 138 120 148 217 258 233 -9 165 218 198 187 147 251 140 218 184 188 138 119 203 189 180 162 169 98 172 126 147 172 180 212 188 249 124 -9 108 237 224 271 213 248 96 135 233 199 312 187 116 95 250 192 136 138 119 163 153 251 246 91 129 266 110 158 157 109 165 234 155 205 136 190 113 143 139 208 249 244 139 182 166 200 162 187 247 126 184 252 200 125 156 246 209 202 162 166 263 189 115 338 176 194 203 168 152 202 143 240 194 144 200 155 237 159 180 153 216 210 265 255 155 122 159 157 174 157 173 202 212 128 212 250 208 141 228 232 149 386 187 193 204 163 192 161 200 359 212 153 244 119 -9 267 238 120 -9 241 136 205 242 263 192 157 179 121 285 187 176 135 -9 153 151 113 212 194 162 154 175 320 219 159 249 190 199 165 256 148 -9 278 231 116 -9 163 188 297 253 187 278 147 268 220 276 203 249 181 259 104 267 104 262 220 257 100 292 327 249 246 298 162 198 -9 253 310 168 270 239 182 185 290 268 192 215 168 167 -9 100 287 194 185 250 180 -9 245 303 230 133 125 244 157 330 163 245 166 186 162 208 208 264 198 220 282 227 174 234 188 300 169 259 270 186 328 289 199 237 168 136 184 380 215 193 197 233 188 300 186 191 302 303 148 192 160 293 119 158 203 192 212 165 268 300 286 202 192 141 238 206 209 264 151 245 286 193 100 274 208 206 242 171 157 111 169 421 167 200 -9 235 213 213 176 135 260 268 125 260 160 142 240 233 264 224 159 308 196 225 207 138 123 -9 125 253 183 129 378 297 207 208 320 209 216 210 181 221 184 146 262 231 235 259 209
1297 629 Uygur China CENTRAL_SOUTH_ASIA 120 128 124 129 156 228 138 114 180 98 130 114 146 217 258 229 -9 153 218 194 177 143 245 128 218 184 186 134 119 199 176 180 158 163 94 166 126 143 170 180 208 185 249 124 -9 105 234 224 265 210 224 96 132 218 196 297 184 107 89 241 189 130 132 113 157 147 251 234 79 126 260 104 155 151 109 162 228 155 187 127 190 113 137 139 205 240 244 139 178 160 194 156 187 235 126 184 252 200 119 140 246 209 186 162 162 259 181 115 330 172 186 203 168 152 202 143 236 194 140 188 151 237 155 180 133 212 200 265 251 147 118 151 153 170 145 165 198 208 128 208 242 208 129 224 228 145 386 183 177 200 151 188 117 196 351 212 141 244 97 -9 251 230 120 -9 241 132 189 238 255 180 149 179 113 273 187 164 131 -9 153 151 113 200 187 142 142 175 312 215 155 237 190 199 165 252 140 -9 274 211 112 -9 151 176 293 225 175 270 143 264 220 268 183 245 181 259 108 267 104 258 220 257 96 280 323 237 242 290 154 190 -9 245 302 156 270 239 174 177 278 264 188 215 148 159 -9 98 283 178 177 246 176 -9 229 303 210 117 121 224 157 330 163 245 166 178 154 204 204 260 190 220 278 209 170 226 172 300 1